ID: 1084166867

View in Genome Browser
Species Human (GRCh38)
Location 11:67379198-67379220
Sequence GGCACCACTGGGGCCCCCGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 181}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084166858_1084166867 10 Left 1084166858 11:67379165-67379187 CCTCGTGTGCACACCCTCCAGTG 0: 1
1: 0
2: 2
3: 9
4: 143
Right 1084166867 11:67379198-67379220 GGCACCACTGGGGCCCCCGAGGG 0: 1
1: 0
2: 0
3: 17
4: 181
1084166855_1084166867 24 Left 1084166855 11:67379151-67379173 CCTCCTTTCCACTGCCTCGTGTG 0: 1
1: 0
2: 1
3: 14
4: 176
Right 1084166867 11:67379198-67379220 GGCACCACTGGGGCCCCCGAGGG 0: 1
1: 0
2: 0
3: 17
4: 181
1084166861_1084166867 -4 Left 1084166861 11:67379179-67379201 CCTCCAGTGTGCGTGTGCAGGCA 0: 1
1: 0
2: 1
3: 11
4: 128
Right 1084166867 11:67379198-67379220 GGCACCACTGGGGCCCCCGAGGG 0: 1
1: 0
2: 0
3: 17
4: 181
1084166854_1084166867 25 Left 1084166854 11:67379150-67379172 CCCTCCTTTCCACTGCCTCGTGT 0: 1
1: 0
2: 4
3: 24
4: 255
Right 1084166867 11:67379198-67379220 GGCACCACTGGGGCCCCCGAGGG 0: 1
1: 0
2: 0
3: 17
4: 181
1084166860_1084166867 -3 Left 1084166860 11:67379178-67379200 CCCTCCAGTGTGCGTGTGCAGGC 0: 1
1: 0
2: 0
3: 17
4: 156
Right 1084166867 11:67379198-67379220 GGCACCACTGGGGCCCCCGAGGG 0: 1
1: 0
2: 0
3: 17
4: 181
1084166856_1084166867 21 Left 1084166856 11:67379154-67379176 CCTTTCCACTGCCTCGTGTGCAC 0: 1
1: 0
2: 0
3: 14
4: 160
Right 1084166867 11:67379198-67379220 GGCACCACTGGGGCCCCCGAGGG 0: 1
1: 0
2: 0
3: 17
4: 181
1084166862_1084166867 -7 Left 1084166862 11:67379182-67379204 CCAGTGTGCGTGTGCAGGCACCA 0: 1
1: 0
2: 4
3: 13
4: 129
Right 1084166867 11:67379198-67379220 GGCACCACTGGGGCCCCCGAGGG 0: 1
1: 0
2: 0
3: 17
4: 181
1084166857_1084166867 16 Left 1084166857 11:67379159-67379181 CCACTGCCTCGTGTGCACACCCT 0: 1
1: 0
2: 4
3: 28
4: 224
Right 1084166867 11:67379198-67379220 GGCACCACTGGGGCCCCCGAGGG 0: 1
1: 0
2: 0
3: 17
4: 181

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084166867 Original CRISPR GGCACCACTGGGGCCCCCGA GGG Intronic