ID: 1084169087

View in Genome Browser
Species Human (GRCh38)
Location 11:67391924-67391946
Sequence CACGTGGACCAATGGGGAGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 183}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084169078_1084169087 13 Left 1084169078 11:67391888-67391910 CCTGTGAGCGTTTTTCTCACGTG 0: 1
1: 0
2: 0
3: 2
4: 44
Right 1084169087 11:67391924-67391946 CACGTGGACCAATGGGGAGGCGG 0: 1
1: 0
2: 0
3: 14
4: 183

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084169087 Original CRISPR CACGTGGACCAATGGGGAGG CGG Intronic
901150285 1:7096787-7096809 CAGGCAAACCAATGGGGAGGAGG - Intronic
901613947 1:10522336-10522358 AACGAGGACCAATGGTTAGGAGG + Intronic
902686048 1:18078296-18078318 CACCTGGACCCATGGGCTGGGGG - Intergenic
904289297 1:29473797-29473819 CACGTGGACCAGTGGGAACCAGG - Intergenic
905866401 1:41379402-41379424 CAGCTGGAGAAATGGGGAGGTGG + Intronic
906524531 1:46486460-46486482 AAGTTGGACCAAGGGGGAGGTGG - Intergenic
912897311 1:113606047-113606069 CACTTGGACCCAGGAGGAGGAGG - Intronic
913667216 1:121059283-121059305 CCCGTGGAGCACTGGGCAGGAGG + Intergenic
914018906 1:143846434-143846456 CCCGTGGAGCACTGGGCAGGAGG + Intergenic
914657458 1:149754638-149754660 CCCGTGGAGCACTGGGCAGGAGG + Intergenic
915891414 1:159777458-159777480 CACATGGACACATGGGGATGGGG - Intergenic
917833682 1:178922030-178922052 CATGTGGACAAATGGGGTTGTGG + Intergenic
918180570 1:182083347-182083369 CACTTGAACCCAGGGGGAGGTGG + Intergenic
921613836 1:217243588-217243610 GACGTGGACAAAAGAGGAGGAGG - Intergenic
1063492009 10:6472794-6472816 CACTTGAACCCATGGGGCGGAGG - Intronic
1065732771 10:28724301-28724323 CACTTGGGCCAATGGGAAAGAGG + Intergenic
1067224943 10:44369479-44369501 CATCTGGACCAATGGGGAAGAGG + Intergenic
1069289861 10:66765199-66765221 AACGTGGATCCACGGGGAGGAGG - Intronic
1069866913 10:71509887-71509909 CAAGTGGACCAGGGTGGAGGTGG + Intronic
1071598011 10:86942168-86942190 CAGGTGGGCCAAGGGGAAGGTGG + Intronic
1072269640 10:93763626-93763648 CACGTGGACTAATAGTGTGGAGG + Intronic
1072702140 10:97650363-97650385 CACTTGAACCCATGGGGCGGAGG - Intronic
1076298615 10:129406619-129406641 GACCTGCACCAATGGGGCGGGGG + Intergenic
1083358894 11:62091319-62091341 CACTTGAACCCATGGGGTGGAGG - Intergenic
1084004683 11:66316697-66316719 CACGTGGACCACAGGGGACCAGG - Exonic
1084169087 11:67391924-67391946 CACGTGGACCAATGGGGAGGCGG + Intronic
1084476486 11:69392301-69392323 CTCCTGGACCACAGGGGAGGAGG + Intergenic
1084944925 11:72633280-72633302 GACGTGGGACAATGGGGAGGCGG - Intronic
1085009162 11:73124670-73124692 CACTTGAACCAAGGGGGCGGAGG + Intronic
1085177220 11:74500287-74500309 CACATGGACACATGGGGTGGGGG - Intronic
1086110485 11:83193602-83193624 CGTGTGGACAAATCGGGAGGTGG - Intergenic
1090291552 11:125550374-125550396 CACTTGAACCAATGAGGTGGAGG - Intergenic
1093411279 12:18870245-18870267 CACTTGGACCTGTGGGGTGGAGG + Intergenic
1096092457 12:48912175-48912197 CACTTGAACCTGTGGGGAGGAGG + Intronic
1098051219 12:66455440-66455462 CACGTGGAACCATGATGAGGAGG - Exonic
1098336097 12:69406409-69406431 CACTTGAACCAAGGGGGTGGAGG - Intergenic
1101073093 12:101096967-101096989 CAGGTGGTACAACGGGGAGGGGG + Intronic
1104073580 12:125369963-125369985 CACTTGAACCAGTGAGGAGGAGG + Intronic
1105775367 13:23654453-23654475 CACCAAGACCAATGGGAAGGCGG + Intronic
1105928973 13:25034197-25034219 CAGGAGGACCATTGAGGAGGTGG + Intergenic
1109048522 13:57445281-57445303 AAAGTGGACCAATGGGGCAGAGG + Intergenic
1113577584 13:111405023-111405045 CACGTGGAGCTTTTGGGAGGCGG - Intergenic
1113696426 13:112349241-112349263 CACGTGGGCCAATCAGCAGGGGG + Intergenic
1115766780 14:36631234-36631256 CACATGGACACATGTGGAGGGGG + Intergenic
1116360642 14:43992168-43992190 CACTGGGACCTATGGGAAGGTGG + Intergenic
1116918327 14:50547051-50547073 CACATGGACACAGGGGGAGGGGG + Intronic
1116943702 14:50816152-50816174 CACATGGACTAATTGGCAGGAGG + Intronic
1119042732 14:71289736-71289758 CAGGTGGACCAACTGGGTGGAGG - Intergenic
1120695080 14:87635807-87635829 CACTTGAACCAAGGAGGAGGAGG - Intergenic
1121985030 14:98497048-98497070 CACTTGGACCCATGAGGTGGAGG + Intergenic
1122120743 14:99552209-99552231 CCCCTGCACCACTGGGGAGGAGG + Intronic
1130661979 15:85837925-85837947 GACTTAGACCAGTGGGGAGGTGG - Intergenic
1130796791 15:87218182-87218204 CACTTGGTCCAATGGGGAAGTGG - Intergenic
1130871764 15:87977633-87977655 GACATGGAGCAATGGGGAGCAGG + Intronic
1132870197 16:2112454-2112476 CAGGTGGACCTTTGGGGATGGGG - Exonic
1133305013 16:4803015-4803037 CAAGCGGGCCAATAGGGAGGAGG - Intergenic
1133775200 16:8890066-8890088 CACGTGGACAACTTGGGAGAGGG - Intergenic
1134084979 16:11349998-11350020 CAGTTGGAACAATGGGGCGGGGG + Intronic
1134522346 16:14924502-14924524 CAGGTGGACCTTTGGGGATGGGG + Intronic
1134710016 16:16323153-16323175 CAGGTGGACCTTTGGGGATGGGG + Intergenic
1134717231 16:16363153-16363175 CAGGTGGACCTTTGGGGATGGGG + Intergenic
1134949587 16:18345492-18345514 CAGGTGGACCTTTGGGGATGGGG - Intergenic
1134957520 16:18389006-18389028 CAGGTGGACCTTTGGGGATGGGG - Intergenic
1135944096 16:26849896-26849918 CACATGGACACATGGGCAGGGGG + Intergenic
1139379419 16:66521240-66521262 CACATGGAGACATGGGGAGGGGG + Intronic
1141114133 16:81293754-81293776 CACGTGAACCCAGGGGGCGGAGG + Intergenic
1141138914 16:81484535-81484557 CTCGTGGCCCAAGGGGGAAGAGG - Intronic
1141562000 16:84875638-84875660 CACTTGAACCCATGAGGAGGAGG - Intronic
1146848726 17:36203118-36203140 CACTTGAACCCAGGGGGAGGGGG - Intronic
1147054799 17:37825893-37825915 CACGGGGACCAAAGAGAAGGAGG - Intergenic
1148600765 17:48892731-48892753 GACGTCAACCAATGGGGACGCGG + Intergenic
1148820170 17:50355495-50355517 CACCAGGACCAATGAGGAGCTGG + Exonic
1150131492 17:62671650-62671672 CAGGTGGGCCAATGTGAAGGTGG + Exonic
1151241647 17:72762921-72762943 CACGTAGACCATTTGGGATGAGG + Intronic
1151850340 17:76686115-76686137 GATGTGGACCGATGGGGAGGCGG + Intronic
1153514579 18:5891808-5891830 CACCGGGACCAATCGGGAGGGGG - Exonic
1155356653 18:24960134-24960156 CAAGTGAAGCAATGGGGCGGGGG - Intergenic
1157186483 18:45544874-45544896 CACTTGAACCCATGGGGCGGAGG - Intronic
1157203127 18:45676299-45676321 CAGGTGGCCCGGTGGGGAGGTGG + Intronic
1158316294 18:56214461-56214483 CACTTGAACCCAGGGGGAGGAGG - Intergenic
1159777282 18:72618446-72618468 CACATGCACCACTGTGGAGGAGG + Intronic
1160923798 19:1533418-1533440 CATGGGGGCCAGTGGGGAGGTGG + Intronic
1160925436 19:1542723-1542745 CCCATAGACCAATGAGGAGGTGG - Intergenic
1161127140 19:2564453-2564475 CACCTGTACCACTCGGGAGGCGG + Intronic
1161992141 19:7690150-7690172 CACGTGGACTACAGGTGAGGAGG - Exonic
1163105660 19:15121723-15121745 CACTTGAACCCAGGGGGAGGCGG + Intronic
1164722458 19:30442224-30442246 CACGTGCTCCAATGTGGAAGGGG + Intronic
1165166562 19:33861221-33861243 CACTTGAACCATTGGGGGGGGGG + Intergenic
1165746935 19:38235118-38235140 CACTTGAACCAAGGAGGAGGAGG - Intergenic
1168555740 19:57338416-57338438 AAAGTGGGCCAAAGGGGAGGTGG + Intergenic
926686191 2:15699572-15699594 CACCAGGACCAATGAGGGGGTGG - Intronic
927667716 2:25043613-25043635 CTCTTGGACCAAGTGGGAGGAGG + Intronic
927732112 2:25482985-25483007 CAGACGGACCCATGGGGAGGGGG + Intronic
928437144 2:31261923-31261945 CACCTGCACCACTGGGGCGGTGG - Intronic
928511828 2:32010273-32010295 CACGAGGATGAATGAGGAGGCGG + Exonic
929033190 2:37667795-37667817 CACCCCCACCAATGGGGAGGAGG - Intronic
936929629 2:117774384-117774406 GACGTGGACCAGTGAGGTGGTGG + Intergenic
939419006 2:141941654-141941676 CACGTGGAACAGTGGGAAGCTGG + Intronic
939975614 2:148714097-148714119 CACATGGACACATGGGGATGGGG - Intronic
946616673 2:221517541-221517563 CACCTGGACCAGGGTGGAGGAGG + Intronic
947530996 2:230908529-230908551 AACCTGGACCTGTGGGGAGGAGG - Exonic
1170135041 20:13063736-13063758 CACTTGAACCCATGGGGAGAAGG - Intronic
1172427174 20:34863288-34863310 GAGGGGGACAAATGGGGAGGGGG - Intronic
1172427831 20:34867780-34867802 CATGTGGAGCAATGGGAAGGAGG - Intronic
1173521810 20:43705431-43705453 CTGGTGGAACAGTGGGGAGGGGG + Intronic
1174896816 20:54458031-54458053 CACTTGGTCTGATGGGGAGGTGG + Intergenic
1178268582 21:31168174-31168196 CACTTGAACCCATGGGGCGGAGG - Intronic
1178338369 21:31764230-31764252 CACGAGGACCAAGGGGGATGAGG - Intergenic
1178840000 21:36130441-36130463 CACGAGGATGAATGAGGAGGCGG - Intergenic
1180741389 22:18055480-18055502 CACGGCGACCAACGGAGAGGAGG - Intergenic
1180997729 22:19973783-19973805 TACGTGGCCCACTGCGGAGGCGG + Exonic
1181776138 22:25161335-25161357 CACGTAGACCACTGGGGATCAGG + Intronic
1182304872 22:29360984-29361006 CACCAGGAAGAATGGGGAGGAGG + Intronic
1182312185 22:29417119-29417141 CACCAGGAAGAATGGGGAGGAGG + Intronic
1185305297 22:50112161-50112183 AGCGTGGTCCAGTGGGGAGGGGG - Intronic
950456137 3:13093781-13093803 CACGTGGACCAACAGTGGGGAGG - Intergenic
950668225 3:14509972-14509994 CACGGGGACCCATGAGGAGGAGG + Intronic
952161754 3:30700848-30700870 CAGTTGGAACAAAGGGGAGGGGG + Intergenic
952191290 3:31025957-31025979 CATGATGAACAATGGGGAGGGGG - Intergenic
954107350 3:48416417-48416439 CACCGGGGCCAGTGGGGAGGAGG - Exonic
954116986 3:48472410-48472432 CACGTGAACCCATGAGGCGGAGG + Intronic
954539656 3:51385176-51385198 CTCCTGGACCAATGGGGAAGTGG + Exonic
954610918 3:51944069-51944091 CACCTGGGCCAGAGGGGAGGTGG - Exonic
958791482 3:98656689-98656711 CGCTTGGACCCAGGGGGAGGAGG - Intergenic
960214552 3:115015504-115015526 CACATGGACACATGGGGAGGGGG - Intronic
962052352 3:131830266-131830288 AACTTGGACCAAGGTGGAGGTGG - Intronic
962285205 3:134079316-134079338 CTCGTGGATCCAAGGGGAGGAGG - Intronic
963527317 3:146430837-146430859 CACATGGATCAGTGGGGAAGGGG - Intronic
967330441 3:188284438-188284460 CAGGAGGCCCAAGGGGGAGGTGG + Intronic
968461899 4:730373-730395 CACGTGGCCCACGGGGGTGGGGG - Intronic
971875100 4:32298165-32298187 CACTTGGACCCATGAGGTGGAGG + Intergenic
971884681 4:32428123-32428145 CACTTGAACCCATGAGGAGGAGG + Intergenic
972547551 4:40095019-40095041 CACGTTGGACAATGGGCAGGAGG - Intronic
975416708 4:74113136-74113158 CAAGTGGTGGAATGGGGAGGAGG + Intergenic
977737673 4:100436817-100436839 CACATGGACACATGGGGCGGGGG + Intronic
978589305 4:110307371-110307393 CACCTGGACCTATGAGGTGGAGG - Intergenic
980069314 4:128226708-128226730 CACGTGGAACACAAGGGAGGAGG - Intergenic
987693406 5:21297636-21297658 CACTTGAACCCATGAGGAGGAGG - Intergenic
988391071 5:30632100-30632122 CACTTGGAAATATGGGGAGGGGG - Intergenic
989085707 5:37673806-37673828 CACATGGACACATGGGGAGGGGG - Intronic
991028048 5:62052140-62052162 CCCATGTACCAGTGGGGAGGGGG + Intergenic
991186200 5:63811166-63811188 CACCTCTATCAATGGGGAGGTGG - Intergenic
991746866 5:69751909-69751931 CACTTGAACCCATGAGGAGGAGG + Intergenic
991750839 5:69803333-69803355 CACTTGAACCCATGAGGAGGAGG - Intergenic
991798468 5:70331854-70331876 CACTTGAACCCATGAGGAGGAGG + Intergenic
991826244 5:70627222-70627244 CACTTGAACCCATGAGGAGGAGG + Intergenic
991830127 5:70678228-70678250 CACTTGAACCCATGAGGAGGAGG - Intergenic
991890800 5:71331169-71331191 CACTTGAACCCATGAGGAGGAGG + Intergenic
992153170 5:73926492-73926514 CAGGTGAACCAAAGGGTAGGGGG - Intronic
992202406 5:74397413-74397435 CACGTCAAGCAATGGGGAGTTGG - Intergenic
992625617 5:78633701-78633723 CCTGTGGACCAATGGGGTAGGGG + Intronic
992678734 5:79131889-79131911 GACATAGACCAATGGGGAGGAGG + Exonic
993994902 5:94711135-94711157 CACCTGGAACAATCTGGAGGAGG - Intronic
1001051012 5:168414486-168414508 CAAGTGGACCCAGGGGGAGGTGG + Exonic
1001582985 5:172812314-172812336 CACTTGAACCAAGGGGGCGGAGG + Intergenic
1001698913 5:173692511-173692533 GATGGGGACCATTGGGGAGGTGG + Intergenic
1002342220 5:178524609-178524631 CAGGTGGTCCATGGGGGAGGAGG - Intronic
1005524396 6:26631602-26631624 CATGTGGACCAATGAGAAGTGGG + Intergenic
1005557503 6:27002299-27002321 CACTTGAACCCATGAGGAGGAGG + Intergenic
1005883092 6:30075000-30075022 CACTTGGTCCACAGGGGAGGAGG - Intronic
1006131858 6:31874457-31874479 CACCTGGAGCAGAGGGGAGGAGG + Exonic
1006508197 6:34504695-34504717 CTCCTGGAACACTGGGGAGGAGG - Intronic
1006924505 6:37647153-37647175 CAGGTGGGCCAAGGGGGAGCGGG - Exonic
1007634095 6:43287620-43287642 AAAGTGGGCCAGTGGGGAGGGGG + Exonic
1009209574 6:60845543-60845565 CACTTGAACCCATGGGGAAGAGG + Intergenic
1010116446 6:72317090-72317112 CATGGGGAGCAGTGGGGAGGAGG - Intronic
1013161826 6:107552536-107552558 AGCCTGGACCAAAGGGGAGGAGG + Intronic
1013990404 6:116248524-116248546 CACGAGGAGTAATGGGGAGAAGG + Exonic
1018335181 6:162779066-162779088 CACATGGACACATGGGGTGGGGG - Intronic
1028207503 7:88033819-88033841 CACGTGGGCCTGTGGGGTGGTGG - Intronic
1030939816 7:115632073-115632095 CACATTAACCAATGGGGAGCAGG - Intergenic
1031086179 7:117303877-117303899 CAGGTGGAACAATTGTGAGGTGG - Intronic
1033604348 7:142914979-142915001 CACCAACACCAATGGGGAGGTGG - Exonic
1035350120 7:158239536-158239558 CAGCAGGACCAATGGGGACGTGG + Intronic
1039967023 8:42290918-42290940 CATAGGGAACAATGGGGAGGAGG - Intronic
1040891247 8:52318875-52318897 CACATGGACACATGGGGGGGTGG + Intronic
1042831210 8:73030877-73030899 CAAGTGGAACCATGGGGAGGAGG + Intronic
1049433704 8:142576714-142576736 CACCAGGACCCATGGGCAGGTGG + Intergenic
1049759430 8:144325399-144325421 CACGGGGCACCATGGGGAGGGGG - Intronic
1049791531 8:144474729-144474751 CACAGGGAACAGTGGGGAGGAGG - Exonic
1051656799 9:19389884-19389906 CACTGGGACCAGTTGGGAGGTGG + Intergenic
1053582791 9:39424616-39424638 CACATGGAGCAATGTGAAGGGGG - Intergenic
1054104370 9:60983359-60983381 CACATGGAGCAATGTGAAGGGGG - Intergenic
1054581974 9:66923491-66923513 CACATGGAGCAATGTGAAGGGGG + Intronic
1055741889 9:79398088-79398110 CAGGTGGATGAATGGAGAGGAGG + Intergenic
1057851817 9:98571950-98571972 CACATGGGGCACTGGGGAGGAGG - Intronic
1060141971 9:121218299-121218321 CAGGTGCACCAAAGGGGATGGGG + Intronic
1061059698 9:128244382-128244404 CACTAGGACCACTGGGGATGTGG + Intronic
1061399562 9:130360968-130360990 CAGGTAGACAAATGGGCAGGTGG - Intronic
1186963918 X:14766879-14766901 CACGTGGACACATGAGGATGGGG - Intergenic
1187273108 X:17796586-17796608 CACTTGGCACAATGGTGAGGAGG - Intergenic
1187943411 X:24403130-24403152 CACTGGGGCCTATGGGGAGGGGG - Intergenic
1192961280 X:76133725-76133747 CACGTGGACACATGGGTTGGGGG + Intergenic
1193277304 X:79604557-79604579 CACCTGCACCACTGGGCAGGTGG + Intergenic
1198266865 X:135017570-135017592 CTCGTGGACCAAGTGGGTGGTGG - Intergenic
1198743253 X:139863447-139863469 CACTTGAACCCAGGGGGAGGAGG + Intronic
1199700156 X:150369779-150369801 CACGTGCACCACTGGGGTGTGGG + Intronic
1201233442 Y:11888165-11888187 CACTTGAACCAAGGAGGAGGAGG + Intergenic