ID: 1084171035

View in Genome Browser
Species Human (GRCh38)
Location 11:67401264-67401286
Sequence CGCCCCCGGAGGTATCCATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 37
Summary {0: 1, 1: 0, 2: 1, 3: 1, 4: 34}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084171035_1084171041 -8 Left 1084171035 11:67401264-67401286 CCCCATGGATACCTCCGGGGGCG 0: 1
1: 0
2: 1
3: 1
4: 34
Right 1084171041 11:67401279-67401301 CGGGGGCGCCTAGGCCTCCTCGG 0: 1
1: 0
2: 0
3: 8
4: 189
1084171035_1084171045 10 Left 1084171035 11:67401264-67401286 CCCCATGGATACCTCCGGGGGCG 0: 1
1: 0
2: 1
3: 1
4: 34
Right 1084171045 11:67401297-67401319 CTCGGCCCCTCCTTGCCCACAGG 0: 1
1: 0
2: 2
3: 42
4: 228

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084171035 Original CRISPR CGCCCCCGGAGGTATCCATG GGG (reversed) Intronic