ID: 1084171470

View in Genome Browser
Species Human (GRCh38)
Location 11:67403115-67403137
Sequence CAGGCCCACTTCCAGTTCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 330
Summary {0: 1, 1: 0, 2: 5, 3: 32, 4: 292}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084171470_1084171479 17 Left 1084171470 11:67403115-67403137 CCTCAGAACTGGAAGTGGGCCTG 0: 1
1: 0
2: 5
3: 32
4: 292
Right 1084171479 11:67403155-67403177 TGTAATTCCAGCACTTTGGGAGG 0: 11596
1: 306145
2: 263594
3: 149163
4: 135954
1084171470_1084171476 13 Left 1084171470 11:67403115-67403137 CCTCAGAACTGGAAGTGGGCCTG 0: 1
1: 0
2: 5
3: 32
4: 292
Right 1084171476 11:67403151-67403173 GGCCTGTAATTCCAGCACTTTGG 0: 193
1: 13636
2: 238966
3: 276084
4: 184125
1084171470_1084171473 -8 Left 1084171470 11:67403115-67403137 CCTCAGAACTGGAAGTGGGCCTG 0: 1
1: 0
2: 5
3: 32
4: 292
Right 1084171473 11:67403130-67403152 TGGGCCTGCCGTGGTGGCTCAGG 0: 1
1: 2
2: 40
3: 347
4: 1382
1084171470_1084171480 23 Left 1084171470 11:67403115-67403137 CCTCAGAACTGGAAGTGGGCCTG 0: 1
1: 0
2: 5
3: 32
4: 292
Right 1084171480 11:67403161-67403183 TCCAGCACTTTGGGAGGCTAAGG 0: 215
1: 12542
2: 187277
3: 295419
4: 200870
1084171470_1084171477 14 Left 1084171470 11:67403115-67403137 CCTCAGAACTGGAAGTGGGCCTG 0: 1
1: 0
2: 5
3: 32
4: 292
Right 1084171477 11:67403152-67403174 GCCTGTAATTCCAGCACTTTGGG 0: 8353
1: 231656
2: 273926
3: 181702
4: 144141
1084171470_1084171483 27 Left 1084171470 11:67403115-67403137 CCTCAGAACTGGAAGTGGGCCTG 0: 1
1: 0
2: 5
3: 32
4: 292
Right 1084171483 11:67403165-67403187 GCACTTTGGGAGGCTAAGGCGGG 0: 2567
1: 121353
2: 262759
3: 233184
4: 222831
1084171470_1084171482 26 Left 1084171470 11:67403115-67403137 CCTCAGAACTGGAAGTGGGCCTG 0: 1
1: 0
2: 5
3: 32
4: 292
Right 1084171482 11:67403164-67403186 AGCACTTTGGGAGGCTAAGGCGG 0: 2398
1: 119370
2: 202468
3: 127652
4: 75874

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084171470 Original CRISPR CAGGCCCACTTCCAGTTCTG AGG (reversed) Intronic
900300822 1:1976253-1976275 CAGGCCCACCTCCAACACTGGGG - Intronic
901155670 1:7136309-7136331 CAGCCTTCCTTCCAGTTCTGTGG + Intronic
901290073 1:8117173-8117195 CAGGCCCACCTCCAGGCCTCTGG - Intergenic
902610756 1:17595922-17595944 CAGTCCTACTTCCAGCTGTGAGG - Intronic
903056360 1:20638896-20638918 CAAGCCCACCTCCAGCTCAGAGG + Intronic
903542474 1:24104806-24104828 CAGGCCCACCTCCAGCACTTTGG - Intronic
903819862 1:26094048-26094070 TAAGCCCCCTTCCAGTTTTGAGG + Intergenic
903992582 1:27284145-27284167 CAGGCCCACATTTAATTCTGTGG - Intronic
904332612 1:29772287-29772309 CAGACCTACTTGCAATTCTGAGG - Intergenic
905098893 1:35501024-35501046 AAAGCCCACTCCCAGTCCTGGGG + Intronic
905212155 1:36381784-36381806 CAGTCCCAGTTCAAGTTCTAAGG + Intronic
908818540 1:68058431-68058453 CAGGCCCACCTGCAGTTTTCTGG + Intergenic
909167562 1:72248125-72248147 CAGCCCCACTTCCAGCACTGAGG + Intronic
910076824 1:83290543-83290565 TAGGCCCACCTCCAATACTGGGG - Intergenic
910161592 1:84278161-84278183 CATCACCACTTCCAGTTATGTGG + Intergenic
910930427 1:92437932-92437954 CTGACCCACCTCCAGTTCTGTGG - Intergenic
912812288 1:112803379-112803401 TAGGGTCACTTCCAGCTCTGAGG - Intergenic
915735009 1:158078915-158078937 CTGGCCTCCTTCCGGTTCTGTGG - Intronic
916245665 1:162686017-162686039 CAGGCACTCTTACAGATCTGTGG - Intronic
917591389 1:176480376-176480398 CAGGCCTGATTCCAGTCCTGAGG + Intronic
918263753 1:182820807-182820829 CAGCCCCACCTCCAGCACTGGGG + Intronic
918363738 1:183784903-183784925 CAGGCCCCCTTCTAATACTGTGG + Intronic
919776967 1:201200473-201200495 CAAGCCCACCTCCAGGTGTGAGG - Intronic
920457492 1:206112272-206112294 CAGGCCCACGTCCAACACTGCGG - Intronic
921017114 1:211202218-211202240 CAGCCCCACTTCCACTGATGTGG + Intergenic
921097421 1:211899265-211899287 CTGGCCCACTCCCAGTCCTCTGG + Intergenic
921572019 1:216791156-216791178 CAGGCTCCCTTCCAGCACTGGGG - Intronic
922798245 1:228352055-228352077 CAGGCCCAGTTCCAGTCCTCCGG + Intronic
923551214 1:234965420-234965442 CAGGCCTGCTTCCAGGACTGTGG + Intergenic
924083022 1:240419548-240419570 CATGGCCACTTCCATTACTGCGG - Intronic
924856666 1:247881228-247881250 CAGGCCCACCTCCAACACTGGGG - Intergenic
1063094588 10:2898563-2898585 CAGGCCCACCTCCAACACTGAGG + Intergenic
1063217334 10:3936673-3936695 CAGGCCCACCTCCAGCATTGGGG - Intergenic
1063241653 10:4175812-4175834 CAGGCCCACATGGAGGTCTGTGG - Intergenic
1064403449 10:15040108-15040130 CATGACAACTTCCAGTCCTGGGG + Intronic
1064423026 10:15206486-15206508 CAGGCCCACCTCCAACACTGGGG - Intergenic
1065293989 10:24257716-24257738 CAGTCCCAGTTCCAGATCTTTGG - Intronic
1066676203 10:37890015-37890037 CAGGCCCACCTCCAGCATTGGGG + Intergenic
1067575191 10:47404351-47404373 CAGGCCCCCATCCAGTCCTCAGG - Intergenic
1067686446 10:48468815-48468837 CGGCCCCACTCCCAGTTTTGAGG - Intronic
1067794088 10:49308141-49308163 CCTGCTCACATCCAGTTCTGTGG + Intronic
1068452744 10:57212780-57212802 CAGAGTCACTTCCAGTTCTCAGG + Intergenic
1069878760 10:71578875-71578897 CAATGCCACTCCCAGTTCTGGGG - Intronic
1069981355 10:72255105-72255127 CAGGCTAACTTCCAGGCCTGGGG - Intergenic
1070273170 10:74978103-74978125 CAACCCCACTTCCTGTTTTGTGG + Intronic
1070771105 10:79082788-79082810 CTGCGTCACTTCCAGTTCTGGGG + Intronic
1071049003 10:81422898-81422920 CAGGCACAGTTCCAGAGCTGGGG + Intergenic
1071106511 10:82103733-82103755 AAGGGCCTCCTCCAGTTCTGAGG + Intronic
1072647073 10:97265034-97265056 CTGGTGCACTTCCAGTTCTAAGG - Intronic
1074205674 10:111280901-111280923 AAGGCCCCCTTCCAGATCTGAGG + Intergenic
1075565379 10:123499785-123499807 CAGGCCCACCTTCTATTCTGTGG - Intergenic
1076086929 10:127640612-127640634 CTGGCCCTCTGCCAATTCTGTGG + Intergenic
1076108814 10:127845755-127845777 AAGCCCCACTTCAGGTTCTGGGG - Intergenic
1077067580 11:649736-649758 CAGGCCGAGTTCCAGTGCGGTGG + Intronic
1077077041 11:706581-706603 CCTGCCCACTCCCAGCTCTGGGG + Intronic
1077654526 11:4006072-4006094 CAGCCCCACCTCCAGCACTGGGG - Intronic
1080625578 11:34027868-34027890 CAGGCCCACTCCCTGATCTCTGG - Intergenic
1081201163 11:40216929-40216951 CAGGATCATTTTCAGTTCTGAGG + Intronic
1081751774 11:45516412-45516434 CAGGCTCACCTCCAGCACTGGGG - Intergenic
1082690964 11:56304139-56304161 CTTGTCCACTTCCAGTTCTCAGG + Intergenic
1083502974 11:63128479-63128501 CAGGCCCACCTGCAGTTATCCGG + Intronic
1083591419 11:63897550-63897572 AAGCCCCACCTCCAGTTCTCTGG + Intronic
1084171470 11:67403115-67403137 CAGGCCCACTTCCAGTTCTGAGG - Intronic
1088191155 11:107229515-107229537 CAGGCACTCTTCCAGGTTTGGGG + Intergenic
1088968076 11:114745497-114745519 CAGGCCCACCTCCAATACTGGGG + Intergenic
1089267531 11:117276311-117276333 CCGGCCTTGTTCCAGTTCTGAGG - Intronic
1090929461 11:131282317-131282339 CAGGCCCACCTCCAACACTGGGG + Intergenic
1091488793 12:915321-915343 CAGAACCACTTCCTGTCCTGTGG - Intronic
1091553273 12:1552926-1552948 CATGCCCATTTCCAGTTTTGAGG + Intronic
1092395057 12:8118695-8118717 CAGGCCCACCTCCAACACTGAGG + Intergenic
1093906826 12:24703021-24703043 CAGGCCCACCTCCAACACTGGGG - Intergenic
1094630896 12:32172757-32172779 CAGGCACAGTTCCAGAACTGGGG + Intronic
1095728933 12:45483778-45483800 TAGGCCCACCTCCAGTACTGGGG + Intergenic
1096518443 12:52170967-52170989 CAGTCCCAGTCCCAGTTCCGAGG + Exonic
1097264967 12:57739243-57739265 CAGGGTCACTGCCAATTCTGGGG + Intronic
1099892896 12:88611195-88611217 CAGGCCCACCACCAATACTGGGG + Intergenic
1101568376 12:105931068-105931090 CTGTTCCACTTCCAGTTCTTTGG - Intergenic
1101719827 12:107341739-107341761 CAGGCTCACTTCCAACACTGGGG - Intronic
1101732815 12:107440615-107440637 CAGGCTCGGTTCCAGGTCTGGGG - Intronic
1101808356 12:108085200-108085222 ATGTCCCACTTCCAGTACTGAGG - Intergenic
1103461921 12:121111586-121111608 CAGGAGGACTTCCAGTCCTGAGG - Intergenic
1103980890 12:124736305-124736327 AAGTCCCACTTCCACTTCTGGGG - Intergenic
1104331985 12:127855576-127855598 CAGGCCCACCTCCAACACTGGGG + Intergenic
1104530736 12:129568570-129568592 CAGTCCCACTTGCAAATCTGTGG + Intronic
1105630400 13:22157790-22157812 CAGGCCCACTTCCAACAGTGGGG + Intergenic
1106439865 13:29756897-29756919 CAGGCCCACCTCCAACACTGGGG - Intergenic
1107442395 13:40439866-40439888 CAGGGCCCTTTCCAGCTCTGAGG + Intergenic
1108578339 13:51807978-51808000 AAGGCCCACATTCAGCTCTGAGG + Intergenic
1108975439 13:56438475-56438497 CAGGTCCCTTTCCAATTCTGGGG + Intergenic
1110888742 13:80671805-80671827 GAGGCCCACTTCCAATACTGGGG + Intergenic
1111221590 13:85211420-85211442 CAGGCCCGCTTCCAACACTGGGG + Intergenic
1112337318 13:98525942-98525964 CAGCCCAACTTCCCCTTCTGGGG + Intronic
1113800458 13:113083646-113083668 CAGACCCACGGCCAGTTATGGGG + Intronic
1116774860 14:49167549-49167571 CAGGCCCGCCTCAAGTGCTGGGG + Intergenic
1117800105 14:59434330-59434352 CAGGCCCGCTTCCAGCATTGGGG + Intronic
1118932770 14:70257842-70257864 CAGGCCTAATTCCATTTCTTGGG - Intergenic
1119263695 14:73252400-73252422 CAGGCCCAGCTCCGGTCCTGAGG - Intronic
1120016540 14:79480671-79480693 AAGGCCCACCTCCAATACTGGGG - Intronic
1123018827 14:105388114-105388136 CAGGCCTAGTTCCATTTCTAAGG - Intronic
1123061822 14:105597964-105597986 CACGCACACGTCCAGCTCTGGGG + Intergenic
1123086560 14:105719695-105719717 CACGCACACGTCCAGCTCTGGGG + Intergenic
1123087630 14:105724144-105724166 CAGGCCCACCTCCAACACTGGGG - Intergenic
1127960620 15:63887773-63887795 CAGCTCCTCTTCCAGTGCTGGGG + Intergenic
1128240788 15:66099800-66099822 CAGGCTCATTTCCAGCTCAGAGG + Intronic
1129209640 15:74060248-74060270 TAAGCCCACTTCCAGGCCTGGGG - Intergenic
1129233019 15:74207145-74207167 GAGGCCCACGTGCATTTCTGCGG + Intronic
1131204007 15:90426148-90426170 AAGCCCCTCCTCCAGTTCTGTGG - Exonic
1132146885 15:99434543-99434565 CAGGCACAGTTCAAGTTCTGAGG - Intergenic
1134793269 16:17010678-17010700 CAGCCACACTTCCAGTGCTCAGG - Intergenic
1135762939 16:25152133-25152155 CAGAACCACTCCCTGTTCTGTGG + Intronic
1136543525 16:30942432-30942454 CAGCCCCACTGCCAGCCCTGCGG + Exonic
1137384897 16:48032361-48032383 CAGGCTCAGTGCCAGTTCTGTGG - Intergenic
1139214001 16:65109695-65109717 AAGGGACACATCCAGTTCTGTGG - Intronic
1139435493 16:66934424-66934446 CACGCCCCCTTCCCGTTCTCCGG - Intronic
1139600849 16:67986018-67986040 CTGAACCTCTTCCAGTTCTGGGG - Intergenic
1139921534 16:70463617-70463639 CTGCCGCACTTCCAGTTCTAGGG - Exonic
1140489515 16:75322892-75322914 CAGAGCAACTTCCAGTCCTGCGG - Intronic
1142130502 16:88429709-88429731 CTGGCCCACCGGCAGTTCTGTGG + Exonic
1145765358 17:27455539-27455561 CAGGGCCACATTCAGATCTGAGG + Intergenic
1145900649 17:28488499-28488521 CAGGTCCCCTTCCAGGCCTGAGG + Intronic
1148774383 17:50087508-50087530 CAGGCCACCTCCCAGATCTGAGG + Intronic
1149445636 17:56711266-56711288 CAGGCCCCCTTCCAGTGCGGAGG + Intergenic
1149514099 17:57267002-57267024 CACGCACACCTCCTGTTCTGGGG + Intronic
1149581812 17:57755948-57755970 CAGACACACTTCCAGCTCTTGGG + Intergenic
1149642976 17:58216777-58216799 CAGCACCACTTCTTGTTCTGTGG + Intronic
1150470075 17:65429818-65429840 CTGGCCCACTTCCTGTTGGGTGG + Intergenic
1151270042 17:72986996-72987018 CAGGCCCTCCTCCAGCACTGGGG - Intronic
1152737421 17:82004329-82004351 CCGGCCCCCTTCCAGTTTCGGGG + Intronic
1153975375 18:10264127-10264149 CATGACCACGTCCAGATCTGAGG - Intergenic
1156007463 18:32460489-32460511 CAAGCTCCTTTCCAGTTCTGTGG - Intronic
1156483308 18:37449510-37449532 CAGGCCCTGTTCCAGATCCGGGG + Intronic
1157365608 18:47061502-47061524 CAGGCCCACCTCCAACACTGGGG + Intronic
1158954578 18:62525536-62525558 CATGCCCAATTTTAGTTCTGGGG - Intronic
1160415185 18:78705121-78705143 CAGGGCCTCTTTCAGTCCTGTGG + Intergenic
1160853736 19:1206609-1206631 CGGGCCGTCTCCCAGTTCTGAGG + Exonic
1160931147 19:1569947-1569969 CAGCCCCACTTCCCCTCCTGGGG + Intergenic
1161282604 19:3453980-3454002 CAGCCCCACTGCCAGGTCAGAGG + Intronic
1161722467 19:5910761-5910783 CAGGGCCACTTCCAATTCTGGGG + Exonic
1162444109 19:10712113-10712135 CAGGCGCATTTCCTCTTCTGTGG + Intronic
1164799325 19:31063014-31063036 GAAGCCAGCTTCCAGTTCTGTGG - Intergenic
1165987319 19:39781474-39781496 CAGGCCCACCTCCAACACTGGGG - Intronic
1166333693 19:42092612-42092634 CAGGCACACTGCCACATCTGAGG + Intronic
1166356294 19:42229467-42229489 CAGGCCCCCTTCCACCTCTGGGG + Intergenic
1167645866 19:50704429-50704451 CAGACCCCCTTCCAGGTCTGGGG - Exonic
1167719599 19:51169290-51169312 CAGGCCCACCTGCAGTTATCTGG - Intergenic
1167796843 19:51715015-51715037 CAGGCCTCCTTCCTGTTTTGTGG + Intronic
1167919255 19:52769238-52769260 CAGGCCCACCTGCAGTTATCCGG + Intronic
1168444002 19:56396134-56396156 CAGGCCCACCTGCAGTTATCCGG - Intergenic
1202666495 1_KI270708v1_random:125472-125494 CAGGCCCACCTGCAGTTATCTGG + Intergenic
925091901 2:1163079-1163101 AAAGCCCACTTCCAGTTGGGAGG - Intronic
925091985 2:1163473-1163495 CATGCCCACTTCCTGTTGGGAGG - Intronic
925879525 2:8340533-8340555 CAGGCCTAATTCCAGCTCTTTGG + Intergenic
926344032 2:11929393-11929415 CATCCCTACTTCTAGTTCTGGGG - Intergenic
927131514 2:20064345-20064367 CAGGCTCACTTCCAGGTCTGAGG + Intergenic
927141404 2:20133425-20133447 ATGGCCCACATCCAGTTCTCAGG - Intergenic
927885818 2:26717914-26717936 CAAGCCCCCTTCCAGGTGTGAGG + Intronic
928196195 2:29218333-29218355 CAGGCCCCCTCCCCGTTCTGGGG + Intronic
928944480 2:36760494-36760516 CAGACCCACTGCCAGTTCACGGG - Intronic
929173009 2:38950025-38950047 CAAGCCCACTTCCAACACTGGGG + Intronic
929192580 2:39153259-39153281 GAGGCACACATCAAGTTCTGTGG - Intergenic
933616559 2:84487773-84487795 CAGGCCCCTTTCCAGGTCAGCGG + Intergenic
934477300 2:94602196-94602218 CAGGCCCACCTGAAGTTTTGGGG - Intronic
935720385 2:105974184-105974206 CCCGCCCACTTCCAGACCTGAGG - Intergenic
940395651 2:153187499-153187521 CAGGCTTATTTCCAGTTCTGGGG + Intergenic
940498996 2:154470873-154470895 CAAGCCCAGCTCCAGTTCTAGGG + Intergenic
942104642 2:172620590-172620612 AAGTCCCACTTCCAATACTGCGG - Intergenic
942143512 2:173001868-173001890 CAGGCCCACCTCCAGCATTGAGG + Intronic
942497627 2:176556303-176556325 CAGGACCAGTTCCAGTTGAGAGG + Intergenic
943945983 2:194064926-194064948 CAGGCCCACCTCCAACACTGGGG + Intergenic
944139494 2:196439674-196439696 CAGGACTACTTCAAGTTCTGTGG - Intronic
945542226 2:211102804-211102826 CAGGACCACTTCCATATATGTGG + Intergenic
945695196 2:213093331-213093353 CAGGCCTTCTTTCAGTTCTTTGG + Intronic
946434948 2:219645119-219645141 CAGGCCCACTTCAGGCCCTGAGG + Intergenic
947575517 2:231270531-231270553 CAGTCCCACTTCCAGAATTGTGG + Intronic
947855455 2:233320759-233320781 CAGGCTCTCTTGCAGTTTTGTGG - Exonic
948377255 2:237529709-237529731 CAGCCCCACTTCCCCTTCTCTGG - Intronic
949010202 2:241673993-241674015 CAGGCCCCCTGCCAGGGCTGGGG - Intergenic
1169830056 20:9815198-9815220 CAGGCCCACCTCCAACACTGAGG + Intronic
1170645089 20:18190655-18190677 CATGGCCATTCCCAGTTCTGAGG - Intergenic
1171396443 20:24836952-24836974 CAGGCCCACTTCCAACACTGGGG + Intergenic
1171415571 20:24978247-24978269 CAGACCCAATTCTAGTTCTGAGG + Intronic
1171421996 20:25023826-25023848 CAGGCCTTTGTCCAGTTCTGAGG + Intronic
1173134302 20:40425767-40425789 CAAGCCCACTGCCAGGTGTGAGG + Intergenic
1175993393 20:62801149-62801171 CAAACGCACTGCCAGTTCTGGGG + Exonic
1177675430 21:24292297-24292319 CAGGCTCTCTTCCAGTTCCCAGG + Intergenic
1177735311 21:25081795-25081817 CAGCCCCACGTCCAGCACTGGGG + Intergenic
1177843248 21:26258233-26258255 CAGGCCCACCTCCAGCACTGGGG - Intergenic
1180955268 22:19738607-19738629 CAGGCCCACTCCCTGCCCTGTGG + Intergenic
1181661586 22:24354187-24354209 CAGGCCCACCTCCAACACTGGGG + Intronic
1182248856 22:28983449-28983471 CAGGCCCACTTCCACCTCACTGG + Intronic
1182410710 22:30183108-30183130 CATGCTCACTCCCATTTCTGGGG - Intergenic
1182500179 22:30741044-30741066 CAGGGCCTCTCCCAGCTCTGAGG + Intronic
1184277682 22:43419520-43419542 CAGCCCCACTCCCACTTCTCAGG - Intronic
1184409238 22:44317134-44317156 CTGGACCAGTTCCACTTCTGGGG + Intergenic
950630480 3:14278713-14278735 CAAGCCCACTTAAACTTCTGGGG - Intergenic
953607950 3:44424174-44424196 CAGGCACACTTCCAGTTTTGGGG - Intergenic
954044383 3:47916879-47916901 CAGGGCCACTTCTTTTTCTGTGG + Exonic
954453479 3:50584288-50584310 CAGTCCCAAATCCAGTTCAGGGG - Exonic
954536224 3:51361369-51361391 CAGGCCTCCTTCCACATCTGTGG - Intronic
954788551 3:53113468-53113490 TGGGCCCACTTCCAGAGCTGTGG - Intronic
955524707 3:59808339-59808361 CAAGCCCACTTCTTGTTCAGAGG - Intronic
957251022 3:77771298-77771320 GAGGCTTACTTTCAGTTCTGGGG - Intergenic
957578243 3:82036324-82036346 CAGGCCCACCTCCAATATTGGGG + Intergenic
957764029 3:84598230-84598252 CAGGCCCATCTCCAGCACTGGGG - Intergenic
958796788 3:98714407-98714429 CAGGCCCTCTTCCAGTTAGAAGG - Intergenic
960141190 3:114153054-114153076 CAAGCACACTGCCAGTGCTGGGG - Intronic
961623015 3:128239539-128239561 GAAGCCCACCTCAAGTTCTGAGG - Intronic
961626732 3:128269306-128269328 CAGGCCCCATGGCAGTTCTGTGG + Intronic
963334860 3:143963148-143963170 CAGGCTCACCTCCAGCACTGAGG + Intergenic
963931710 3:151010212-151010234 TAGGCCCACCTCCAATACTGGGG + Intergenic
964767363 3:160191677-160191699 CAGGCTCACCTGCAGTTCTAGGG - Intergenic
966667822 3:182491952-182491974 CAAGGTCCCTTCCAGTTCTGTGG + Intergenic
968655205 4:1775575-1775597 CAGCCCCACCTGCAGATCTGGGG + Intergenic
970268731 4:14319411-14319433 CAGGCCTAGTTGCAGTTCTGAGG + Intergenic
971173894 4:24262312-24262334 CAGGGCCACTTTCACTTCTGCGG - Intergenic
971181989 4:24337370-24337392 CAGGCCCTGTGCCAGTGCTGAGG + Intergenic
971793411 4:31197953-31197975 TAGGCCCACCTCCAATACTGGGG - Intergenic
974107007 4:57481114-57481136 CAGGCCCACCTCCAACACTGGGG + Intergenic
975229202 4:71910918-71910940 CAGGCCCACCTCCAACACTGGGG + Intergenic
975377478 4:73662671-73662693 CTGACCCACTTCCAGCTCAGGGG - Intergenic
976348612 4:84034065-84034087 CAGGGCCACTACCAGTGCTTTGG - Intergenic
977069996 4:92373471-92373493 CAGGCCAGCTTCCAGCTGTGAGG + Intronic
978141069 4:105318042-105318064 CAGGCCCACCTCCAATACTGGGG - Intergenic
978622408 4:110646227-110646249 CAGGACCACTTCCACTTATTAGG + Intergenic
980762096 4:137248036-137248058 CAGGACCACTTCCAGGTCTGTGG + Intergenic
981041578 4:140227813-140227835 CAGGCCCACCTCCAACACTGAGG - Intergenic
981580259 4:146243319-146243341 CAGCCCCACCGCCAGTGCTGTGG - Intergenic
984042584 4:174754013-174754035 AAGGCACATTTCCAGTTCTGTGG - Intronic
985091099 4:186363404-186363426 CAGGCCCACCTGCAGTTATCTGG + Intergenic
985904019 5:2819026-2819048 CAGGCCCACTGCCAGAGCTTGGG - Intergenic
986214139 5:5702307-5702329 CAGTCCCACCTCCAGCACTGGGG + Intergenic
987814543 5:22883400-22883422 CTGGCCATTTTCCAGTTCTGAGG - Intergenic
988319995 5:29682803-29682825 CATGCACACCTCCAGGTCTGAGG - Intergenic
988857991 5:35247635-35247657 CAGGCCCTCTTCCAGACCTGTGG + Intergenic
990674286 5:58166132-58166154 CAGCCACGCTTCCTGTTCTGGGG - Intergenic
994854442 5:105099022-105099044 CAGGCCCACTTCCAGCACTGGGG - Intergenic
996251657 5:121342488-121342510 AGGCCCCACTTCCAGTGCTGAGG + Intergenic
997305107 5:132830762-132830784 CCGGCCCAGTCCCAGGTCTGAGG + Exonic
997310053 5:132872359-132872381 CCTGCCCAATTCCAGCTCTGAGG + Exonic
998139018 5:139689668-139689690 CAGCCCCTCTTCCAGCTTTGAGG + Intergenic
998565798 5:143214832-143214854 GACGCCCACATGCAGTTCTGGGG - Intronic
1003603520 6:7540641-7540663 CAGGGCCACTCCCAGTTAAGAGG - Intergenic
1004477336 6:15986106-15986128 CAGGCTCACAGCCAGCTCTGGGG + Intergenic
1006445763 6:34078961-34078983 CAGGCGCACCCCCAGGTCTGAGG + Intronic
1006791544 6:36704380-36704402 CAGGCCTTCTTCCAGGACTGTGG + Exonic
1013432147 6:110064686-110064708 CAGGGCCCCTCCCAGTGCTGAGG + Intergenic
1014258502 6:119188418-119188440 CAGGCCCATTTCCTGTACTTTGG + Exonic
1014753226 6:125275957-125275979 CATGACCGCTTCCTGTTCTGTGG + Exonic
1016372747 6:143391818-143391840 TAGGCCCACCTCCAATACTGGGG - Intergenic
1017724230 6:157265705-157265727 CAGGTCCACTTCAAGGGCTGGGG - Intergenic
1018554178 6:165033478-165033500 CAGGCCCACTTCCAACCCTGGGG + Intergenic
1019291058 7:250493-250515 CAGGCACACCTCCAGTGATGGGG + Intronic
1019386283 7:757947-757969 CAGCCCCACCTCTCGTTCTGAGG - Intronic
1020776849 7:12464866-12464888 CAGGCTAATTCCCAGTTCTGGGG + Intergenic
1021659450 7:22905169-22905191 CAGGCCCACCTCCAACACTGGGG + Intergenic
1022109413 7:27219434-27219456 CAGGCCCCTTTCCTCTTCTGGGG - Intergenic
1022625597 7:32032797-32032819 CAGGCCCCATCCCAGCTCTGCGG + Intronic
1022768018 7:33437436-33437458 CAGACACATTTCCAATTCTGAGG + Intronic
1022792406 7:33702090-33702112 CAGGCATTCTGCCAGTTCTGGGG + Intergenic
1024708189 7:51984768-51984790 CAGGCCCAGCTCCAGTAATGGGG + Intergenic
1024896010 7:54263112-54263134 CAGGCCCACTTCCAACACTGAGG + Intergenic
1026560321 7:71443387-71443409 CAGGCCCACCTCCAACACTGCGG - Intronic
1026735339 7:72945460-72945482 CAGCCCCACTTCTGCTTCTGGGG - Intronic
1026785679 7:73300390-73300412 CAGCCCCACTTCTGCTTCTGGGG - Intergenic
1027108387 7:75419546-75419568 CAGCCCCACTTCTGCTTCTGGGG + Intronic
1027294590 7:76755771-76755793 TAGGCCCACCTCCAATACTGGGG - Intergenic
1027528603 7:79301786-79301808 CAGGCCCTATTCCAGCACTGGGG - Intronic
1028028196 7:85873695-85873717 CAGATCCACTTCCTGTTTTGTGG + Intergenic
1029232730 7:99084835-99084857 CAGGCCTACTTCCAACACTGGGG - Intronic
1029614742 7:101649260-101649282 CACCCCCACTTCCTGTGCTGTGG + Intergenic
1032145474 7:129375836-129375858 CAGCCCCACTGCCACCTCTGTGG - Intronic
1034064287 7:148121402-148121424 CAGGCCCACTTCCTTGTGTGAGG + Intronic
1034886745 7:154804130-154804152 CAGTCCGACTTCCAGAGCTGCGG + Intronic
1035556341 8:569875-569897 CAGCACCACTTCCAGGTCTCTGG + Intergenic
1035623006 8:1048705-1048727 CAGCCCCAGTTCCAGGTCTAGGG - Intergenic
1036570365 8:9975067-9975089 CAGCCCCATTTCCAGTTATTTGG + Intergenic
1036731051 8:11265164-11265186 CAGCCCCACCTCCAGCACTGGGG - Intergenic
1037108121 8:15135716-15135738 CAGGCCAAGCCCCAGTTCTGGGG - Intronic
1037172183 8:15906070-15906092 CAGGCCCACCCCCAGCACTGGGG + Intergenic
1037952477 8:23028125-23028147 CAGTCCCTCTCCCAGGTCTGGGG - Intronic
1038056890 8:23867251-23867273 CCGGCCCGTTTCCAGTTTTGAGG + Intergenic
1038657324 8:29465727-29465749 CTGGCTCACTTCCTGTTGTGTGG - Intergenic
1040326384 8:46343723-46343745 CAGGCCCATTTTCAATTGTGGGG - Intergenic
1040628833 8:49184869-49184891 CAGTCCCACTTCCAACACTGGGG - Intergenic
1041477462 8:58282217-58282239 CAGGACAACATCCAGTTCTAAGG + Intergenic
1042488820 8:69376449-69376471 CAGCCCCACCTCCAATACTGGGG - Intergenic
1042494596 8:69441934-69441956 CAAGCCCAGTGCCAGCTCTGAGG - Intergenic
1042796182 8:72665596-72665618 CAGGCCCACCTTAGGTTCTGAGG - Intronic
1045002449 8:97890080-97890102 CATGCCCACTTCCAGTCTTGGGG - Intronic
1045526832 8:102947777-102947799 CAGGCCCACCTCCAACTTTGGGG + Intronic
1045996153 8:108364564-108364586 TAGGCCCACCTCCAGCACTGGGG + Intronic
1047944308 8:129859390-129859412 CAGGCCCACCTGCAGTTATCCGG - Intronic
1049383872 8:142331196-142331218 CAGGCCCACATGCAGCTCAGGGG + Intronic
1049517241 8:143066977-143066999 CAGGCCCACCTCCACCACTGGGG - Intergenic
1051344886 9:16143014-16143036 CAGGGTGACTTCCAGTCCTGTGG + Intergenic
1051503908 9:17807299-17807321 AATGGCCAATTCCAGTTCTGGGG - Intergenic
1052852670 9:33387366-33387388 CAGGCCCACCTGAAGTTTTGGGG + Intronic
1053122952 9:35560037-35560059 CAGACCCACTACCAGCCCTGGGG + Exonic
1053525933 9:38831062-38831084 CAGGCCCTGTTCCAGTTCCTTGG + Intergenic
1053680769 9:40483917-40483939 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1053930755 9:43112229-43112251 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054198165 9:62055487-62055509 CAGGCCCTGTTCCAGTTCCTTGG + Intergenic
1054282944 9:63141018-63141040 CAGGCCCACCTGAAGTTTTGGGG - Intergenic
1054293851 9:63319432-63319454 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054391876 9:64623921-64623943 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054503853 9:65892407-65892429 CAGGCCCACCTGAAGTTTTGGGG - Intronic
1054640193 9:67532876-67532898 CAGGCCCTGTTCCAGTTCCTTGG - Intergenic
1055089455 9:72347945-72347967 CAGGCCCACCTCTAGCACTGGGG - Intergenic
1055262549 9:74454888-74454910 CTAGCCCAATTCCAGTGCTGGGG + Intergenic
1055335310 9:75227581-75227603 CAGGCCCACCTCCAGTATTGGGG + Intergenic
1057695370 9:97319108-97319130 CAGGCCAACTCCCAGCTCTCTGG - Intronic
1058535730 9:105958102-105958124 TAGGCCCCATTCCAGTACTGGGG + Intergenic
1058839999 9:108896975-108896997 CAGTACAATTTCCAGTTCTGGGG + Exonic
1059624023 9:116041438-116041460 CAGGCATACTACTAGTTCTGTGG + Intergenic
1060502441 9:124171116-124171138 CAGGCCCACCTCCAACACTGAGG + Intergenic
1061179369 9:129014681-129014703 CAGGCTCTCTTCCAGTGCTGGGG - Intronic
1061904741 9:133690843-133690865 CTGGCCCAGATGCAGTTCTGCGG + Intronic
1062219915 9:135409627-135409649 CAGGCCCACTTCCTGACCTGTGG + Intergenic
1062279061 9:135743945-135743967 CAGGCCCACTGCCAACCCTGGGG - Intronic
1185931225 X:4205563-4205585 CAGGCCCCCCTCCAATACTGGGG - Intergenic
1188467102 X:30494072-30494094 AGGGCCCACTTCCAGGTTTGCGG + Intergenic
1189374447 X:40455731-40455753 CAGGCCAACCTCCAGCTCTGGGG + Intergenic
1191881670 X:65848874-65848896 CAGCCCCACCTACAGTTCTCTGG + Intergenic
1192626099 X:72730436-72730458 CAGGCTCACTTCCAACACTGGGG - Intergenic
1192763224 X:74118377-74118399 CAGGCCTTCTTCCATTGCTGGGG + Intergenic
1194620672 X:96167168-96167190 CAGACACACTTCCTGTTCTCAGG - Intergenic
1194804979 X:98315938-98315960 AAGGGCCCCTTCCAGTTTTGTGG - Intergenic
1195803062 X:108734640-108734662 CATGCCCACCTCCAGGTCTCTGG + Exonic
1196747765 X:119086897-119086919 CAGGCAAACATCCACTTCTGGGG - Exonic
1200299910 X:154962970-154962992 CAATCCCACCTCCAGATCTGAGG + Intronic