ID: 1084171689

View in Genome Browser
Species Human (GRCh38)
Location 11:67404122-67404144
Sequence GGCCCCAGGCTGGCCGGGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 733
Summary {0: 1, 1: 0, 2: 5, 3: 74, 4: 653}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084171678_1084171689 -3 Left 1084171678 11:67404102-67404124 CCCCTCTGACCCCGCAGCCAGGC 0: 1
1: 0
2: 1
3: 35
4: 328
Right 1084171689 11:67404122-67404144 GGCCCCAGGCTGGCCGGGAGTGG 0: 1
1: 0
2: 5
3: 74
4: 653
1084171680_1084171689 -5 Left 1084171680 11:67404104-67404126 CCTCTGACCCCGCAGCCAGGCCC 0: 1
1: 0
2: 3
3: 62
4: 490
Right 1084171689 11:67404122-67404144 GGCCCCAGGCTGGCCGGGAGTGG 0: 1
1: 0
2: 5
3: 74
4: 653
1084171673_1084171689 9 Left 1084171673 11:67404090-67404112 CCTGAAACCTCCCCCCTCTGACC 0: 1
1: 0
2: 1
3: 18
4: 321
Right 1084171689 11:67404122-67404144 GGCCCCAGGCTGGCCGGGAGTGG 0: 1
1: 0
2: 5
3: 74
4: 653
1084171672_1084171689 10 Left 1084171672 11:67404089-67404111 CCCTGAAACCTCCCCCCTCTGAC 0: 1
1: 0
2: 1
3: 22
4: 234
Right 1084171689 11:67404122-67404144 GGCCCCAGGCTGGCCGGGAGTGG 0: 1
1: 0
2: 5
3: 74
4: 653
1084171674_1084171689 2 Left 1084171674 11:67404097-67404119 CCTCCCCCCTCTGACCCCGCAGC 0: 1
1: 0
2: 1
3: 62
4: 739
Right 1084171689 11:67404122-67404144 GGCCCCAGGCTGGCCGGGAGTGG 0: 1
1: 0
2: 5
3: 74
4: 653
1084171679_1084171689 -4 Left 1084171679 11:67404103-67404125 CCCTCTGACCCCGCAGCCAGGCC 0: 1
1: 0
2: 2
3: 25
4: 316
Right 1084171689 11:67404122-67404144 GGCCCCAGGCTGGCCGGGAGTGG 0: 1
1: 0
2: 5
3: 74
4: 653
1084171675_1084171689 -1 Left 1084171675 11:67404100-67404122 CCCCCCTCTGACCCCGCAGCCAG 0: 1
1: 0
2: 0
3: 39
4: 512
Right 1084171689 11:67404122-67404144 GGCCCCAGGCTGGCCGGGAGTGG 0: 1
1: 0
2: 5
3: 74
4: 653
1084171676_1084171689 -2 Left 1084171676 11:67404101-67404123 CCCCCTCTGACCCCGCAGCCAGG 0: 1
1: 0
2: 0
3: 36
4: 362
Right 1084171689 11:67404122-67404144 GGCCCCAGGCTGGCCGGGAGTGG 0: 1
1: 0
2: 5
3: 74
4: 653

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084171689 Original CRISPR GGCCCCAGGCTGGCCGGGAG TGG Intronic
900166534 1:1246283-1246305 GGCCCCCAGCTGGCCTGGGGTGG - Intronic
900188267 1:1342931-1342953 GGCCCCATGCTGGGGGGGTGGGG - Intronic
900191507 1:1354161-1354183 GTCCCCAGGAGGGCCGGGAGGGG + Intronic
900244762 1:1631883-1631905 GGCCCCAGGCAGCCCGGGAAGGG - Intergenic
900314625 1:2050646-2050668 GGCCCCAAGATGGAAGGGAGCGG + Exonic
900409051 1:2504655-2504677 AGCCCCAGGGAGGCCGGAAGGGG - Exonic
900435711 1:2629591-2629613 GGCCGGATGCTGGCTGGGAGCGG + Intronic
900496917 1:2979891-2979913 GGACCCAAGCTGGCCGAGAAGGG + Intergenic
900531073 1:3153479-3153501 GTCCCCAGGCTGGACCAGAGCGG + Intronic
900767870 1:4517558-4517580 GGCTCCAGCCTGGCAGGGACAGG - Intergenic
900786998 1:4655495-4655517 GGTGCCAGGCTGGGCGGAAGCGG + Intronic
900886007 1:5415839-5415861 GGAGCCAGGCTGGCCTGCAGAGG - Intergenic
901236455 1:7669988-7670010 AGCCCCAGGCTGGTCGGAACGGG + Intronic
901529145 1:9842787-9842809 GGCCCCAGGCTCACCTGTAGGGG - Intergenic
902090848 1:13902058-13902080 GGCCCCAGGCAGCCCCGGGGTGG + Intergenic
902164152 1:14556147-14556169 GTCCCCAGGCTGGAGGGCAGCGG + Intergenic
902408346 1:16198730-16198752 GTCCCTAGGCTGGCTGGAAGGGG - Exonic
902503626 1:16926001-16926023 GCCCCCAGGTTGGCAGGGAAGGG + Intronic
902715592 1:18270449-18270471 TGCCCGAGGCTGCCCTGGAGAGG - Intronic
903178249 1:21593101-21593123 GGCCCCAGACTGGCCGGCCCTGG + Intergenic
903276981 1:22228632-22228654 GGGCACAGGCTGCCCAGGAGTGG + Intergenic
903347728 1:22697996-22698018 TGCCCCAGGGTGGGTGGGAGTGG + Intergenic
903873795 1:26457987-26458009 GGCCCCAGCCTGTTTGGGAGTGG - Intronic
904042535 1:27592924-27592946 AGGCGCAGGCTGGACGGGAGAGG + Intronic
904044581 1:27602178-27602200 GCCCCCAAGCTGGGAGGGAGGGG + Intronic
904252203 1:29233146-29233168 GGCTCCAGTCTTGCCTGGAGGGG - Intergenic
904775118 1:32901521-32901543 GGCGCCGGGCGGGCCGGGCGGGG - Intergenic
904775180 1:32901705-32901727 GGCCCAAGGCTGGGACGGAGAGG + Intergenic
904847382 1:33430642-33430664 GGGCCGAGGCTTGCCGGGAACGG - Intronic
904902257 1:33866696-33866718 GGCCCCAGGGAGGCAGGGAGAGG - Intronic
905111908 1:35601362-35601384 TGCCACAGGTTGGCCGGGTGCGG - Intronic
905404959 1:37726440-37726462 GGTCCCAGGCTGGGCGGGCTGGG - Intronic
905774780 1:40661572-40661594 GGCCCAGGGCTGGCTGGGGGTGG - Intronic
906136904 1:43506325-43506347 AGCCCCAGCCTGGCCCGCAGGGG + Intergenic
906146946 1:43565908-43565930 GGCTACCGGCTGGCCTGGAGCGG + Intronic
906813052 1:48849016-48849038 GGCTCCAGGTGGGCTGGGAGGGG + Intronic
907268549 1:53277114-53277136 GGCCCCAGGTCGGCCGGGGAGGG - Intronic
907461788 1:54609576-54609598 GGCACCAGGCTGGCCTGAGGAGG - Exonic
908107345 1:60858647-60858669 GACCACAGGCTGGCAGTGAGCGG - Intergenic
909958017 1:81802115-81802137 GGGCCGAGGCCGGCCGCGAGCGG - Intronic
910936084 1:92485374-92485396 GGACCCACGTTGGCTGGGAGCGG + Intronic
912077174 1:105889429-105889451 GGGCAAAGGATGGCCGGGAGCGG - Intergenic
912548269 1:110466571-110466593 AGCCCCAGGCTGGCACAGAGAGG + Intergenic
912652149 1:111449119-111449141 TGCCCCCGGCGGCCCGGGAGTGG - Exonic
913163311 1:116164795-116164817 GGCCCCAGGCTGGGTGGCTGAGG - Intergenic
915227853 1:154424094-154424116 GGCCCCAGGCTGGGGGGCAGAGG - Intronic
915839244 1:159201899-159201921 GGGCACAGGGTGGCCGGGAAGGG - Exonic
916051417 1:161039201-161039223 GGCCACGGGCTGGAAGGGAGGGG - Intergenic
916828197 1:168463617-168463639 GTCCCCAGGCTGGATGGCAGAGG - Intergenic
918210144 1:182343126-182343148 GGGCCCAGACTGGCCTTGAGTGG + Intergenic
918968217 1:191378524-191378546 GGCAGCAGCCTGGCAGGGAGAGG - Intergenic
919016077 1:192038316-192038338 GGCGCCAGGCTGGAGGGCAGTGG - Intergenic
919209169 1:194456550-194456572 AGGTCCAGGCTGGCGGGGAGGGG - Intergenic
920055017 1:203185158-203185180 GGGCCAGGGCTGGCCAGGAGAGG - Intronic
921165015 1:212500574-212500596 GGCCCCAGGCTGGCAGGACGAGG + Intergenic
922056091 1:222043813-222043835 AGCCGCAGGCTGGGCAGGAGGGG + Intergenic
922505060 1:226121583-226121605 GGACCCAGGCCGGGCGGGGGAGG - Intergenic
922518251 1:226223874-226223896 GAGCCCAGGCTGGCGGGGGGCGG - Exonic
922730831 1:227948071-227948093 GGGCCCCGAGTGGCCGGGAGGGG - Intergenic
922766727 1:228159976-228159998 AGCTCCAGGCTGGCTGGGAGAGG + Intergenic
922794748 1:228334552-228334574 AGCCCCAGACAGGCAGGGAGAGG + Intronic
923119753 1:230978964-230978986 GGCCCCGGGCTGGCCGAGCTGGG - Intronic
1063104885 10:2984549-2984571 AGCCCCAGCCTGGCAGAGAGTGG + Intergenic
1063195724 10:3741119-3741141 TGCCCCAGGCTGGACTGCAGTGG + Intergenic
1063392836 10:5661326-5661348 GGCCCCAGGCTCGGCGGGGCGGG - Intronic
1063466340 10:6247566-6247588 GGCTCTGGGCTGGCGGGGAGAGG - Intergenic
1065099538 10:22320644-22320666 GGCCGCGGGCTGGCGGGCAGGGG + Intronic
1067055054 10:43045318-43045340 GGCCCCAGGTCGGCCGGGGGAGG + Intergenic
1067068534 10:43116794-43116816 GGTCCCATGCTGGGCAGGAGGGG - Intronic
1067083395 10:43225922-43225944 GGCCCAAGGCTGGGCAGGGGTGG + Intronic
1067432103 10:46251606-46251628 GGCCCCATGCTGGGCTGGTGAGG - Intergenic
1067439624 10:46301302-46301324 GACCCCAGGCTTGCCCTGAGGGG + Intronic
1067577775 10:47419001-47419023 GGCCCCATGCTGGGCTGGGGAGG + Intergenic
1067738596 10:48878314-48878336 GGCCCCAGGGTGAATGGGAGTGG + Intronic
1069695222 10:70381413-70381435 GGACTCAGGCTGGCTGGGGGAGG + Intronic
1069992844 10:72325625-72325647 GCAGCCAGGCTGGCAGGGAGTGG + Intergenic
1070332390 10:75427534-75427556 GGTCCCAGGCTGGAGGGTAGTGG - Intergenic
1070351539 10:75597443-75597465 GGCCCCAGGTGAGCCAGGAGGGG + Intronic
1070600684 10:77864333-77864355 AGGCCCTGGCTGCCCGGGAGAGG + Intronic
1070846186 10:79524141-79524163 GGCCCCAGGAAGGCCGGGGCAGG - Intergenic
1070927612 10:80236169-80236191 GGCCCCAGGAAGGCCGGGGCAGG + Intergenic
1071334596 10:84590343-84590365 GTCCCCAGGCTGACCCGGAGGGG + Intergenic
1072107068 10:92284325-92284347 GACCCCATTCTGGCCGGGCGTGG - Intronic
1072346485 10:94512956-94512978 GTCCCCAGGCATGCCGGGCGTGG + Intronic
1073015325 10:100394517-100394539 GGCCCCAGGCTGGAGTGTAGTGG + Intergenic
1073042027 10:100614395-100614417 GGTACCAGGCTGGCTGTGAGGGG + Intergenic
1073136421 10:101222986-101223008 GGTTCCGGGCTGGCCAGGAGAGG - Intergenic
1074157630 10:110812386-110812408 TGCCCCAGTCAGCCCGGGAGGGG - Exonic
1074183333 10:111081749-111081771 GGCTCCAGGCTGCCCGGGTTAGG + Intergenic
1074877088 10:117621982-117622004 GGCGCCAGGCTTGCTGTGAGTGG + Intergenic
1075401218 10:122163070-122163092 AGCCCCGGGCTGGCTGTGAGGGG + Intronic
1075715440 10:124552603-124552625 GGCCCCAGCCTGGGGGGCAGTGG - Intronic
1076707000 10:132307699-132307721 GGCCCGGGGCTGGCCAGCAGCGG + Exonic
1076793387 10:132787849-132787871 GACCCTGGGCGGGCCGGGAGGGG + Intergenic
1076851271 10:133094511-133094533 AGCCCCAGGGAGGCCGTGAGAGG + Intronic
1077014096 11:392392-392414 GGCCCCAGGTGGGCCTGGGGTGG + Intergenic
1077021670 11:419793-419815 GGCCCCGTGTTGGCCGGGGGTGG - Intronic
1077151388 11:1074579-1074601 GAGCCCAGGGTGGCCGGGGGAGG - Intergenic
1077189968 11:1251871-1251893 GGACCCAGTGTGGCCGGGAGGGG - Intronic
1077213092 11:1382548-1382570 GGCGCCAGGCTGGCGGGGCGTGG + Intergenic
1077229308 11:1451454-1451476 GACACCAGGCTGGCCGGGAGAGG + Intronic
1077247501 11:1546752-1546774 GGCCCCAGCCTCGGCGGGCGCGG + Intergenic
1078057561 11:8019719-8019741 GGCCCCTGGCGGGCGGGGCGAGG + Intronic
1078662053 11:13295572-13295594 GGCCCCAGGCTGGTCCAGACTGG - Intronic
1079255240 11:18822240-18822262 GTCCCCAGGCTGGACTGCAGTGG + Intergenic
1080536534 11:33227180-33227202 GTCCCCAGGCTGGCGTGCAGTGG - Intergenic
1080919505 11:36694728-36694750 GGCCCCAGGCTGGAGTGCAGTGG - Intergenic
1081931283 11:46873209-46873231 GGCCCCAGTCTGTCCAGAAGAGG + Exonic
1082983585 11:59146122-59146144 GGCCTCAGGCTGGAGGGCAGTGG + Intronic
1083035911 11:59637285-59637307 GGCCCCTGGCTGCCTGGGAACGG + Exonic
1083196854 11:61093345-61093367 GGGCCAGGCCTGGCCGGGAGGGG + Intergenic
1083198218 11:61103434-61103456 GCTTCCAGGCTGGCAGGGAGAGG + Intronic
1083260095 11:61518175-61518197 GGCCCCGGCCTGGCCAGGAGAGG - Exonic
1083264036 11:61537928-61537950 GGTCCCAGGATGGCCGCAAGTGG + Intronic
1083299841 11:61734602-61734624 GGCCCCAGCCAGGTGGGGAGAGG + Intronic
1083363687 11:62128695-62128717 GGGGCCAGGCTGGGTGGGAGAGG + Intronic
1083483984 11:62971391-62971413 GGCCCCAGGCTGGAGTGCAGTGG - Intronic
1083936628 11:65872911-65872933 GGCCTGTGGCTGGCCGGGGGCGG - Intronic
1084001359 11:66296813-66296835 GGCCCCAGGCTAGGCAGGGGAGG - Intergenic
1084047869 11:66580595-66580617 GGCCCCAGGCTGGAGTGCAGTGG + Intergenic
1084083158 11:66842518-66842540 GGACAGAGGCTGGCAGGGAGGGG + Intronic
1084145200 11:67261574-67261596 GGCTCCTGGCGGGCCGGGCGGGG + Intergenic
1084168828 11:67390576-67390598 GACCCCAGACTGGCCGGGTACGG - Intronic
1084171689 11:67404122-67404144 GGCCCCAGGCTGGCCGGGAGTGG + Intronic
1084184313 11:67463680-67463702 GACCCCAGGATGGCCGGGCACGG - Exonic
1084272485 11:68036682-68036704 GGCCTCAGGCAGGCCGGGAACGG - Intergenic
1084785174 11:71437968-71437990 GGCCCCAGGAGGGCCGGGGGTGG - Intronic
1084973082 11:72781815-72781837 GCCCCCAGCCTAGCCGGGAGGGG - Intronic
1085108016 11:73862557-73862579 GGCCCCAGGCTGGAGTGAAGTGG - Intronic
1085522210 11:77145536-77145558 GGCCCCAGTGTGGACAGGAGGGG - Intronic
1086095793 11:83048875-83048897 GGCCCCAGCATGGCCCTGAGTGG + Intronic
1087107020 11:94420740-94420762 GTTCCCATGCTGGCCGGGCGCGG + Intronic
1089691078 11:120186957-120186979 GGGCCCCGACTGGCTGGGAGTGG + Intergenic
1090225978 11:125072531-125072553 GGCCCCAGGGTGGCTGTGACGGG - Intronic
1090269488 11:125376151-125376173 GGCCCCACACTTGCCGGGAATGG + Intronic
1090612545 11:128484341-128484363 GATCCCAGGCTGGCCAGCAGAGG + Intronic
1091383488 12:77804-77826 TTCCCCAGGCTGGCCCGGCGAGG - Intronic
1091455478 12:604345-604367 GGCCACAGCCTGGCCGGGTGCGG + Intronic
1091563256 12:1630149-1630171 GTCCCCAGGCTCCCCGGGAGGGG - Intronic
1091718532 12:2795884-2795906 GGCCCCGGGGAGGCCGGGCGCGG + Intronic
1091727074 12:2853779-2853801 GTTCCCAGGGTGGCCGGGAGGGG + Intronic
1091971152 12:4788155-4788177 GGCCGGGGGCTGGCGGGGAGGGG + Intronic
1092153747 12:6268785-6268807 GAGGCCAGGCTGGCCTGGAGAGG - Intergenic
1092627233 12:10339629-10339651 GGGGCCAAGCTGGCCGGGCGTGG - Intergenic
1094847528 12:34367877-34367899 GGCCCCAGGCATGCGTGGAGGGG + Intergenic
1095970820 12:47901058-47901080 ACCCCAAGGCTGGCTGGGAGAGG - Intronic
1096466124 12:51848511-51848533 GGCCGCGGGCGGGCCGGGATGGG - Intergenic
1096496418 12:52041840-52041862 GGAGCCAGGCTGCCTGGGAGGGG - Exonic
1096527195 12:52217427-52217449 GGCCCGAGGCTGGCCTGGGAGGG - Intergenic
1096647765 12:53047702-53047724 GGCCCCGGCCTGGCAGGGTGCGG + Intronic
1096669529 12:53190290-53190312 GGCCCCATGCTGGCCAGCAGGGG - Exonic
1096776255 12:53966184-53966206 GGTCCCCAGCTGGCGGGGAGCGG - Intergenic
1097190355 12:57216675-57216697 TGCCCCCAGCTGGGCGGGAGGGG + Intergenic
1097242063 12:57582329-57582351 GGTCTCAGGCTGCCTGGGAGTGG + Intronic
1097364001 12:58691046-58691068 GGCCCCAGGCTGGAGTGCAGTGG - Intronic
1098189725 12:67935409-67935431 GTCCCAAGGTTGGCCGGGTGTGG + Intergenic
1100811060 12:98338828-98338850 GGCACCAGGCTGGTAGGGATGGG - Intergenic
1100883739 12:99046507-99046529 GACCCAAGTCTGGCCGGGTGCGG + Intronic
1101745393 12:107537863-107537885 GGCCACAGCCTGGCAGGAAGTGG - Intronic
1101955154 12:109206392-109206414 GTCCCCAGGCTGGACTGCAGTGG - Intronic
1102537651 12:113593100-113593122 TGCCCCAGGCTGGAGGGCAGTGG - Intergenic
1102860827 12:116335135-116335157 TGCCCCAGGCTGGAGGGCAGTGG + Intergenic
1103494845 12:121353728-121353750 GGCACAAGGCAGGCCGGGCGCGG - Intronic
1103597933 12:122035450-122035472 GGCCCCGGGCTGGGCAGGAGAGG - Intronic
1103928696 12:124437725-124437747 GGCCCCAGGGTGGGTGGGGGTGG - Intronic
1103944002 12:124516321-124516343 GGCCCAGGGCTGGCACGGAGGGG + Intronic
1103944799 12:124520054-124520076 GGGCCCAGACTGGCCACGAGGGG + Intronic
1104001608 12:124863918-124863940 AGCCCAAGGCTGCCCGGGGGCGG - Intronic
1104041054 12:125131249-125131271 GGCCCCAGGCTGGAGTGCAGTGG + Intronic
1104668674 12:130666042-130666064 GACCCAAGGCTGGCAGTGAGTGG + Intronic
1104729616 12:131097744-131097766 GGAGCCAGCCTGGCCGGGACAGG + Intronic
1104858714 12:131913845-131913867 GGCCCCAGGCTGGGTGGATGGGG + Intronic
1105000576 12:132687611-132687633 CACCTCAGGCTGGCCGGGCGCGG - Exonic
1105274523 13:18906828-18906850 GGGCCCAGCCTGGCCTGAAGTGG + Intergenic
1105505670 13:21007797-21007819 GGCCCCAGGCTGGAGTGCAGTGG + Intronic
1106092976 13:26615346-26615368 GTCACCAGGCTGGCAGGCAGTGG + Intronic
1106246583 13:27954696-27954718 GGCCCCGCGGCGGCCGGGAGTGG + Intergenic
1106732850 13:32559784-32559806 TGCCCCAGGCTGGAGGGCAGTGG - Intergenic
1107818678 13:44266960-44266982 GGACTCAGACTGGCCAGGAGGGG + Intergenic
1109267914 13:60221803-60221825 GGCCCCAGGCTGGCTGCAGGAGG - Intergenic
1111131632 13:83984185-83984207 TGTCCTAGGCTGGCCGGGCGCGG - Intergenic
1112255263 13:97824846-97824868 TGGACCAGGCTGGCGGGGAGGGG + Intergenic
1112293711 13:98167880-98167902 GGTGCCATGCTGGCCGGGTGCGG + Intronic
1113378997 13:109786299-109786321 GGCCGCAGGCAGCCGGGGAGGGG - Exonic
1113379145 13:109786820-109786842 GGCCCCGGCCCGGCCGGGCGGGG + Intergenic
1113444479 13:110355208-110355230 GGCTCCAGGCAGGCTGGCAGAGG + Intronic
1113871486 13:113562492-113562514 GGCACCAGGACTGCCGGGAGGGG - Intergenic
1113882475 13:113635397-113635419 AGACCCAGGGTGGCCGGGAGAGG + Intronic
1114459919 14:22879781-22879803 AGCCCCAAGCTAGCCGGGATAGG + Exonic
1114485942 14:23061681-23061703 GGAGCCAGGATGGCCGGGCGCGG + Intronic
1115217342 14:31026271-31026293 GGGCGGAGGCCGGCCGGGAGAGG + Exonic
1117315431 14:54567204-54567226 CACCCCAGGCGGGCCGTGAGGGG + Intronic
1118696663 14:68392814-68392836 GGCACCAGGCTGGAGGGGAAAGG - Intronic
1119290374 14:73490975-73490997 CGCCCCCGGCCGGCCGGGCGGGG + Exonic
1119539214 14:75427967-75427989 GGCCCCTGGGCGGCGGGGAGGGG - Intronic
1119764662 14:77181050-77181072 GGCCCCTGCCTGGGAGGGAGAGG + Intronic
1119806475 14:77485436-77485458 GGCCCCAGGCAGGCAGGCGGAGG - Intronic
1121873938 14:97433987-97434009 GTCCCTAGGGCGGCCGGGAGTGG + Intergenic
1122249328 14:100427076-100427098 GGCCCCAAGGTGGCAGGGACAGG - Intronic
1122399771 14:101459488-101459510 GGCCTCAGCCCGGCCAGGAGAGG + Intergenic
1122429200 14:101629279-101629301 GAACCCAGTCTGGCCTGGAGTGG - Intergenic
1122822739 14:104355342-104355364 GGGCCCAGCTTGGCTGGGAGAGG - Intergenic
1122930808 14:104932383-104932405 GGCCCCAGGGTGGCCAGGCACGG + Intronic
1123037174 14:105476203-105476225 AGCCCCAGGCTGGCCTGGCCCGG - Intronic
1124170455 15:27368048-27368070 GGCCCCAGAATGGCCAGGAATGG + Intronic
1124371490 15:29107020-29107042 GGACCCGGGCTGGCCTGGGGTGG + Intronic
1124427099 15:29571097-29571119 GGCCCCAGCTGGGGCGGGAGCGG + Intergenic
1125226799 15:37405038-37405060 GGCCCCAGCGAGGCTGGGAGAGG - Intergenic
1125474728 15:40039265-40039287 GGCGCTAGGCGGGCGGGGAGGGG - Intergenic
1125794610 15:42395039-42395061 GGGCCCAGGCTGCCTGGGTGCGG - Intronic
1125887910 15:43242632-43242654 GTCCCCACCCTGGCCTGGAGAGG - Intronic
1125970084 15:43904406-43904428 TGGCCCAGGCTGGCATGGAGTGG + Intronic
1127106667 15:55623618-55623640 GGCCCCAGGCTAGCCTGGGTGGG + Intronic
1127288263 15:57549048-57549070 AGCAGCAGGCTGGCAGGGAGTGG + Exonic
1128111659 15:65079980-65080002 GGCCCAAGGTAGGTCGGGAGGGG - Intergenic
1128322155 15:66701598-66701620 GGCTCCAGGCTCGCCCGGAGTGG - Intergenic
1128742933 15:70096120-70096142 GCCCCGGGGCTGGCGGGGAGGGG - Intronic
1129164759 15:73770215-73770237 GGGCCCAGCCTAGCAGGGAGGGG - Intergenic
1129387087 15:75202151-75202173 GTCCCCGGGCCGGCCGGTAGGGG - Intronic
1129488880 15:75904156-75904178 TGTCCCAGGCTGGCGGGGTGGGG + Intronic
1129540118 15:76341842-76341864 GTCCGCGGGCTGGCAGGGAGGGG - Exonic
1129706317 15:77796594-77796616 GGCCCCAGGCTGACCCCGAGAGG + Intronic
1129712335 15:77826690-77826712 GGCCCCAGGCTGGCTGGAGGTGG + Intergenic
1130949389 15:88573529-88573551 GAGCCAAGGCTGGCCGGGTGTGG - Intergenic
1131589265 15:93730924-93730946 GGCTGCAGGCTGGCAGGGGGAGG - Intergenic
1131961246 15:97792355-97792377 GCCCCCACGCTGGCTGGGAAGGG + Intergenic
1132025105 15:98398745-98398767 AGCCACAGGCTGGACGGGAGTGG - Intergenic
1132514934 16:361842-361864 GGCCCCGGACAGGCCAGGAGAGG - Intergenic
1132644375 16:992030-992052 GGCCCCAGACAGGCTGGAAGAGG + Intergenic
1132663485 16:1071607-1071629 GGCCGCAGGCTGGGGAGGAGGGG + Intergenic
1132759659 16:1502518-1502540 GGCCGCAGGCCCCCCGGGAGAGG - Intronic
1132851442 16:2026744-2026766 CGCCTCGGGCTGGCCGGGCGCGG + Intronic
1132853314 16:2034387-2034409 GCCCCCAGGCTGGCCTGGGACGG - Intronic
1132853340 16:2034460-2034482 GCCCCCAGGCTGGCCTGGGACGG - Intronic
1132853366 16:2034533-2034555 GCCCCCAGGCTGGCCTGGGACGG - Intronic
1132853393 16:2034606-2034628 GCCCCCAGGCTGGCCTGGGACGG - Intronic
1132853419 16:2034679-2034701 GCCCCCAGGCTGGCCTGGGACGG - Intronic
1132853446 16:2034752-2034774 GCCCCCAGGCTGGCCTGGGACGG - Intronic
1132913289 16:2326946-2326968 GCCCCCAGGCTGGAGGGCAGTGG - Intronic
1132978242 16:2721072-2721094 GGCACCAGGCGGGGCGGAAGCGG + Intergenic
1133003120 16:2861051-2861073 GAGGCCAGGCTGGCAGGGAGTGG - Intergenic
1133108771 16:3533201-3533223 GGCCCCTGGCTGGCCCCGGGAGG - Intronic
1133215688 16:4290992-4291014 GGCCCCAGGCTGGGTGTCAGGGG - Intergenic
1133246819 16:4454715-4454737 GGCCCCTGGGTGGCCAGGCGGGG + Intronic
1133784447 16:8963629-8963651 GGCCGCGGGCCGGCCGGGGGCGG + Intronic
1133949457 16:10378650-10378672 GTCCCCAGGCTGGCATGCAGTGG - Intronic
1135303410 16:21349755-21349777 GGCCCCAGTGTGGCCGAGATGGG + Intergenic
1135856263 16:26013717-26013739 GCACCCACTCTGGCCGGGAGCGG + Intronic
1135865025 16:26093017-26093039 GGCGGCAGCCTGGCCGGGAGAGG + Intronic
1136109265 16:28054325-28054347 GGCCCCAAGCTTGCCTGGAGGGG - Intronic
1136153624 16:28367992-28368014 GGGCCCAGGCTGGCCCGGGGCGG + Intergenic
1136209463 16:28747275-28747297 GGGCCCAGGCTGGCCCGGGGCGG - Intergenic
1136300158 16:29328949-29328971 GGCCCCAGTGTGGCCGAGATGGG + Intergenic
1136363734 16:29798752-29798774 GGCCCCGTGCTGGTTGGGAGAGG + Intronic
1136551625 16:30985256-30985278 GTGCCCAGACTGGCCTGGAGGGG - Exonic
1136785313 16:32930690-32930712 ATCCCCAGGCTGGCCAGCAGAGG - Intergenic
1138104848 16:54282496-54282518 GGCTCCAGGCGGGCCTGGGGTGG - Intergenic
1138137925 16:54539657-54539679 GACACCTGGCTGGCCTGGAGTGG - Intergenic
1138591581 16:58001968-58001990 GACCCCAGCCTGGCAGGGAGTGG - Intronic
1139713053 16:68791083-68791105 GGCCCCCGGGTGGGCAGGAGTGG + Intronic
1139959992 16:70711995-70712017 GGCCACAGCATGGCTGGGAGGGG + Intronic
1140442504 16:74998882-74998904 GGTCACAGGCCGGCCGGGGGCGG + Intronic
1141178866 16:81738975-81738997 TGCCCCAGCCTGGCAGGGGGAGG + Intergenic
1141602818 16:85136777-85136799 GGCTCCTGGCCGGCTGGGAGGGG - Intergenic
1142120283 16:88383495-88383517 GGCCGCAGCCTTGCCCGGAGCGG + Intergenic
1142335963 16:89489984-89490006 GGGCCCGGGGTGGCCGTGAGGGG - Intronic
1142525623 17:538236-538258 TGCCCCGGGCTGGCAGGGAAGGG + Intronic
1142580396 17:938389-938411 GTCCCCAGCCCGGCCGGGCGCGG + Intronic
1142659624 17:1418893-1418915 TGCCCCAGGCTGGAGGGCAGTGG - Intergenic
1142672878 17:1495426-1495448 GGCCTCAGGCTGTCTGGGAGGGG - Exonic
1142685522 17:1575127-1575149 AGCCTCAGGCTGGCCGGGGAGGG + Exonic
1142720064 17:1770071-1770093 AGCCCCAGGCAGACCTGGAGAGG + Intronic
1142784231 17:2207971-2207993 GGCCCCACACTTGCCGGGTGCGG + Intronic
1143002105 17:3800924-3800946 GGCCCCAGGCTTGTTGGGAAGGG - Intronic
1143053484 17:4145074-4145096 AGCACTAGGCTGGCCGGGTGTGG - Intronic
1143366824 17:6414028-6414050 GTCTCCAGGCTGGGCAGGAGTGG + Intronic
1144096540 17:11905192-11905214 GTCCCCAGGCTGGACTGCAGTGG - Intronic
1144490446 17:15704330-15704352 GGCCCCAGGGGGCCTGGGAGGGG - Intronic
1144639682 17:16930592-16930614 AGCTCGAGGCTGGCCTGGAGGGG + Intronic
1144847056 17:18225575-18225597 GGCGCCAGGCGGCCCGGGCGCGG - Exonic
1145013905 17:19384754-19384776 AGCCCCGAGCTGGCCGGGAGAGG + Intronic
1145272363 17:21411507-21411529 GGTCCCAGGGTCGCCGGGAGGGG - Intronic
1145310569 17:21698972-21698994 GGTCCCAGGGTCGCCGGGAGGGG - Intronic
1146286972 17:31580836-31580858 GGGTCCAGGCTGGCTGGCAGGGG - Intergenic
1146492525 17:33292693-33292715 GGCTCCTGGCTGGGCGGGCGGGG + Exonic
1147044366 17:37742660-37742682 GGCCCCAGCAGGGCAGGGAGAGG - Intronic
1147165702 17:38592086-38592108 GGCCCCAGGCTTGGAAGGAGAGG + Intronic
1147383728 17:40070219-40070241 GGCCCCAGCCTGGCAGGCATGGG - Intronic
1147970824 17:44218649-44218671 GGCCCCAGGCTGGAGGGCGGGGG + Intronic
1147983156 17:44287782-44287804 GGACTCAGGGTGGCAGGGAGTGG - Intergenic
1148106893 17:45123776-45123798 GGCCACAGGCTGGCCCCAAGGGG - Intronic
1148126928 17:45241960-45241982 GGCTCCGGGCTGCCAGGGAGAGG - Exonic
1148153642 17:45410722-45410744 GGGCCTGGGCTGGCCTGGAGTGG + Intronic
1148238872 17:45986794-45986816 GGCAGCAGGCTGGCCGAGGGTGG - Intronic
1148581000 17:48743672-48743694 AGCCCCAGATTGGCCGGGCGCGG - Intergenic
1148594762 17:48844806-48844828 GGCCCCAGATTGGCCGGGCGCGG - Intronic
1148663180 17:49353219-49353241 GTCACCAGGCTGGCATGGAGTGG + Intronic
1148783732 17:50135232-50135254 GTCCCCAGGCTGGAAGGGGGAGG + Exonic
1148854596 17:50571830-50571852 GACACCAGGCTGGCCGGGCTAGG - Intronic
1148950330 17:51305347-51305369 GGCTGCAGGCTGGTGGGGAGAGG + Intergenic
1149088699 17:52751529-52751551 GGCCACGGGCTGGCAGGAAGAGG - Intergenic
1149614438 17:57987272-57987294 GGCCCGGGGCAGGCGGGGAGCGG - Intronic
1149780439 17:59393166-59393188 GGCCCCTGGCTGGACTGCAGTGG + Intronic
1149864691 17:60144768-60144790 GGCCCCAGGCTGGAGTGCAGTGG + Intergenic
1150268703 17:63848740-63848762 GTCGCCAGGCTGGCCTGCAGTGG - Intergenic
1151191268 17:72399802-72399824 ACCCCCAGGGTGGCTGGGAGGGG - Intergenic
1151296800 17:73192318-73192340 GGCGGCGGGCTGGGCGGGAGAGG - Intergenic
1151457075 17:74232645-74232667 GGCAGCAGGATGGCAGGGAGGGG - Intronic
1151522717 17:74641646-74641668 GGACCCAGGATGTCCAGGAGGGG + Intergenic
1151672256 17:75577624-75577646 GTCCCCAGGCTGGAATGGAGTGG - Intergenic
1151681874 17:75626674-75626696 GGCCCCAGGCCGTCCTGGAGAGG - Intergenic
1151682183 17:75628084-75628106 GGCCCCAGGGAGGACGGGCGTGG + Intronic
1151696694 17:75721590-75721612 CAGCCGAGGCTGGCCGGGAGAGG + Exonic
1151765876 17:76132862-76132884 GGACCCAGACTTGCCGGAAGAGG - Intergenic
1151781022 17:76245509-76245531 GGCCCCAGGCTGGAGTGCAGTGG - Intergenic
1151787198 17:76280802-76280824 GGCCGCAGGGTGGCTGGGATGGG - Intronic
1152095479 17:78269474-78269496 GGCCCCAGGCTGGAGAGGAGAGG + Intergenic
1152142455 17:78544759-78544781 TGCCCCAGGCTGGAGTGGAGTGG - Intronic
1152258730 17:79255149-79255171 AGCACCAGACTGGCTGGGAGGGG - Intronic
1152277946 17:79369069-79369091 GCCCCCAGGCTGTCCAGGGGTGG - Intronic
1152357911 17:79815488-79815510 AGCCCCAGGCCGGCCTCGAGGGG + Intergenic
1152577684 17:81149997-81150019 GGCACCAGGCTGGTCCGCAGTGG - Intronic
1152580433 17:81163367-81163389 GGGTCCAGGCTGGCAGGAAGGGG - Intronic
1152637125 17:81434791-81434813 GGCGCAGGGCTGGCCTGGAGAGG + Intronic
1152720725 17:81922678-81922700 GGCCCCAGGCCGGCGGCAAGGGG + Exonic
1152750041 17:82058461-82058483 GGGGCCAGGCTGGCCAGCAGGGG + Intronic
1152809503 17:82374915-82374937 GGCCCCAGGCGGGCAGGCACAGG - Exonic
1153238842 18:3013098-3013120 AGCCGCCCGCTGGCCGGGAGCGG - Intronic
1154154654 18:11934426-11934448 AGAAACAGGCTGGCCGGGAGTGG - Intergenic
1154466208 18:14644077-14644099 GGGCCCAGCCTGGCCTGAAGTGG + Intergenic
1154951190 18:21211558-21211580 GGCCCCAGGCTGGAATGCAGTGG - Intergenic
1156764318 18:40632785-40632807 GTCCCCAGGCTGGAGTGGAGTGG - Intergenic
1157229165 18:45898067-45898089 GAACACAGGCTGGCCGGGTGCGG + Intronic
1157276667 18:46315476-46315498 GTCCCCAGGGTGGCCTGGAGTGG + Intergenic
1157418586 18:47526394-47526416 GAGCCCAGGCTAGCGGGGAGCGG + Intergenic
1157438603 18:47692376-47692398 GTCCCCAGGTTGGCTGGGAAAGG - Intergenic
1157483986 18:48073950-48073972 GGCCCCAGCCAGGCCTGCAGTGG + Intronic
1157535203 18:48452655-48452677 GTCCCCAGGCTGGCAGTGTGGGG - Intergenic
1157666834 18:49494327-49494349 GGCCCCAGGCTGGAGTGCAGTGG + Intergenic
1158391969 18:57051535-57051557 GGCCCCAGCCTGCCAGGGAAGGG + Intergenic
1159887667 18:73924448-73924470 GACCACTGGCTGGCAGGGAGCGG + Intergenic
1160178661 18:76615941-76615963 GGCCCAAGGCTGTGGGGGAGAGG + Intergenic
1160698157 19:494476-494498 GGCACCAGCCTGGGCAGGAGGGG + Intronic
1160725561 19:616494-616516 GGGCCCAGGCGGGCCGGGGGCGG + Exonic
1160774179 19:847646-847668 GGCCCCAGGCAGCCAGGAAGGGG - Intronic
1160843084 19:1155099-1155121 GGACCCAGGCTGGCCCGTGGTGG + Intronic
1160903536 19:1441063-1441085 AGCCCCAGGCTGGGCGGATGGGG - Intergenic
1160906004 19:1452000-1452022 GGGCTCAGGCTGGCAGGGGGAGG + Exonic
1161111765 19:2474859-2474881 GACCCCAGGCTGGCGGGGGAGGG + Intergenic
1161221845 19:3121547-3121569 GGCCCCATGCTGGCTGGCGGGGG - Exonic
1161303928 19:3556778-3556800 GGTCCCAGGCAGGCAGAGAGAGG + Intronic
1161310895 19:3593332-3593354 GGCCCCAGGCTGGAAGGGACAGG - Exonic
1161461484 19:4400268-4400290 GGCCCCGGGCTGCCCGGATGAGG - Intronic
1161468592 19:4445421-4445443 GGCCCTGGGGTGGCGGGGAGAGG + Exonic
1161563904 19:4988896-4988918 AGACCCAGGCTGGACGGGAGGGG - Intronic
1161644922 19:5447274-5447296 AGCCCCAGGCAGGCAGGGACTGG + Intergenic
1162055279 19:8059797-8059819 GAGCCCAGGATGGCCGGGCGCGG + Intronic
1162439956 19:10686727-10686749 AGCCCCAGCCTGGCTGGCAGAGG - Intronic
1162581869 19:11536220-11536242 GCCCCCTGGCGGCCCGGGAGGGG - Intergenic
1162761058 19:12888334-12888356 TGCCCCAGGCTGGACTGCAGTGG - Intergenic
1162909858 19:13842864-13842886 GGCCCGAGACCGGCCGGGGGCGG + Intergenic
1163390329 19:17026794-17026816 TGCCCCAGCTTGGCCGGGCGCGG - Exonic
1163435429 19:17292506-17292528 GCCCCCAGGCTGCCTGGGCGGGG - Exonic
1163446800 19:17351713-17351735 GGCCCAGGGCTGTGCGGGAGGGG + Exonic
1163466726 19:17472102-17472124 GACGCCATACTGGCCGGGAGCGG + Intronic
1163495332 19:17643300-17643322 TGCCCATGGCTGGCCGGGCGCGG - Intronic
1163501866 19:17680937-17680959 GGCTCCAGGCTGGAGGGCAGTGG + Intronic
1163548402 19:17952196-17952218 GGGCCCAGGTCGGCGGGGAGGGG + Intronic
1163892324 19:20027872-20027894 GGCCCCAGGCTGGAGTGCAGTGG - Intronic
1165353079 19:35287315-35287337 AGGCCCAGGCTGGGCGGGAGAGG + Intergenic
1165562076 19:36688515-36688537 GGGCCCATGCGGGCCGGGCGCGG + Intronic
1165959433 19:39522042-39522064 GCCCCCAGGCTGGAGGGCAGTGG + Intergenic
1166212949 19:41318923-41318945 GGCCCTAGTCTGGCTGGCAGTGG - Intronic
1166245375 19:41522070-41522092 GGGCCCGGGCGGGCCGGGAAAGG - Intergenic
1166269011 19:41702036-41702058 AGCCCCAGGGAGGCCGGGGGAGG + Intronic
1166335742 19:42105851-42105873 GCCCCCAGGCAGGCAGAGAGGGG + Intronic
1166366748 19:42281732-42281754 GGGCCTAGCCTGGCAGGGAGGGG - Intronic
1166367170 19:42283823-42283845 GGCCCCGAGCCGGCCGGGGGCGG - Intronic
1166531273 19:43544936-43544958 GGCTCCAGGCAGGCCAGGCGTGG - Intronic
1166673648 19:44726145-44726167 GGCCCCAGGCTGGAATGCAGTGG + Intergenic
1166677477 19:44748626-44748648 GGCCCCGGGGGGGCCGGGGGCGG + Exonic
1166932468 19:46309268-46309290 GGCTCCAGGCTGCCTGGGTGGGG - Exonic
1166947201 19:46404537-46404559 GGCCCCAGGAGGGCCGGGGCAGG + Intergenic
1167037962 19:47005380-47005402 GGCCTCAGGCCGGAGGGGAGTGG - Intergenic
1167050586 19:47075473-47075495 GGCCCCAGGATGTGCGGCAGTGG - Intronic
1167246772 19:48377707-48377729 AACCCCAGGCTGGCCAGGCGTGG - Intergenic
1167249749 19:48393596-48393618 GTCCCCAGGGAGGCCAGGAGGGG + Intergenic
1167269177 19:48498391-48498413 GGACCCAGGAAGGCGGGGAGAGG - Exonic
1167463416 19:49638206-49638228 GGACCCAGGCAGGAAGGGAGGGG - Intronic
1167748785 19:51367849-51367871 CGCCCCAGGCGGGCAGGCAGGGG - Intronic
1168076769 19:53984658-53984680 GGTACCAGGGTGGCCGGGCGCGG + Exonic
1168097653 19:54124679-54124701 GGCTCCAGGGGGGCCGGGGGAGG - Intronic
1168245300 19:55110124-55110146 GACCCCAGGGAGGCCGGGAATGG - Intronic
1168292598 19:55363836-55363858 GACTCCAGGCTGGCTGGGCGCGG - Intergenic
1168300363 19:55401534-55401556 GGCCCCAGGGGGCCCGGGAGGGG - Exonic
1168316204 19:55485793-55485815 GGCCCCAGGGGGCCTGGGAGTGG + Intronic
1168316419 19:55486621-55486643 GGCCCCTGGGTGGCCGTGCGGGG + Exonic
925198762 2:1949377-1949399 TGGCCCAGGCTGGCTTGGAGGGG - Intronic
926086135 2:10021495-10021517 GTCCCCAGGCTGGACTGCAGTGG - Intergenic
926091398 2:10052411-10052433 GATCCCAGGCTGGCAGGCAGAGG + Exonic
926243220 2:11103714-11103736 GGCCCCAGGCTTGCCCGCAGAGG + Intergenic
926292167 2:11539883-11539905 GGCCCCTGCCCGGCAGGGAGAGG - Intronic
926311171 2:11677316-11677338 GCCCCGCGGCTGGCCGGCAGGGG + Intergenic
927592328 2:24367109-24367131 GACCCCAGGGAGGCCGGGCGCGG - Intergenic
928186551 2:29115695-29115717 GGCCGCGGGCTGGCCGGCGGCGG + Intronic
928435772 2:31253657-31253679 GGCCCCAGGCTGGACTAGGGCGG + Intronic
928527875 2:32161101-32161123 TGCCCCAGGCTGGACAGCAGTGG + Intergenic
929453519 2:42051343-42051365 GGCCCCAGGATGACTGGGGGAGG - Intronic
929818698 2:45256866-45256888 GGCCCTAGGCTGGCCAGTGGGGG + Intergenic
930762249 2:55049843-55049865 GGGCTCACGCTGGCCGGGGGAGG + Exonic
932137300 2:69242542-69242564 GCCACCAGGCTGGCCGAGAGGGG - Intronic
932215107 2:69961423-69961445 AGCAGCAGGATGGCCGGGAGCGG - Exonic
932305209 2:70697106-70697128 GTCCCCAGGCTGGCGTGCAGTGG - Intronic
932699753 2:73984790-73984812 GGCCCCGGGCCGGGCGAGAGGGG - Intergenic
932702736 2:74002505-74002527 TGCCCCAGCCTGCCGGGGAGCGG + Intronic
933876832 2:86628324-86628346 GGAGCCAGGCTGACCTGGAGTGG - Intronic
934561898 2:95317837-95317859 GGCCCAAGGATGGCAGGGTGCGG + Intronic
934882425 2:97995658-97995680 GGCCCCCGGCCGGCAGGGATGGG - Exonic
934985375 2:98881254-98881276 GGCCCCAGGCTGCACTTGAGGGG - Intronic
935692959 2:105746226-105746248 GGCCCCAGTGTGGGCAGGAGGGG + Intronic
936514557 2:113173711-113173733 GGCCCCTGCATGGCAGGGAGAGG + Intronic
936550776 2:113437767-113437789 GGCCCCGGGCAGGCCGGGAGTGG + Exonic
937265834 2:120614126-120614148 GGCCCCGGGCTGGAAGGGAAAGG + Intergenic
937271303 2:120654684-120654706 GGCCAGTGGCTGGCCTGGAGCGG - Intergenic
938179222 2:129164470-129164492 TGCCCCAGGCCAGCCGGGAGAGG + Intergenic
938464060 2:131515466-131515488 GGCACGAGCCAGGCCGGGAGTGG - Intergenic
938620388 2:133046416-133046438 GTCCCCAGGCTGGAGTGGAGTGG + Intronic
941013954 2:160333429-160333451 GGTCCCAGGCTGGCCTGGTGGGG - Intronic
942681395 2:178480769-178480791 GGGCCCGGGCGGGCCGGGAGGGG + Exonic
944854862 2:203758259-203758281 GGCCCCAGGCTGGAGTGCAGTGG + Intergenic
945119371 2:206442911-206442933 CGCCGCAGGCTGGCGCGGAGTGG - Intergenic
946409806 2:219510348-219510370 AGAGACAGGCTGGCCGGGAGGGG - Intergenic
947622230 2:231598041-231598063 GAACTCAGGCTGGCAGGGAGGGG + Intergenic
947920644 2:233868277-233868299 GGCACCAGGCTGCACGGCAGGGG + Intergenic
947968602 2:234302803-234302825 GGCACCAGGCTGGCTGGTGGAGG + Intergenic
948393488 2:237628063-237628085 TGGCCCGGGCTGGCCGGGTGGGG + Intronic
948823892 2:240565066-240565088 GGCCACAGGATGTCCAGGAGAGG - Intronic
1169120926 20:3095132-3095154 GGCCCCAGGCTGGAAGGCATTGG + Intergenic
1169136907 20:3203183-3203205 GGGCCCAGCCTGGTGGGGAGAGG - Intronic
1169182356 20:3580726-3580748 GGCTGCAGGCTGGATGGGAGGGG + Intronic
1171455756 20:25271215-25271237 GGCCCCAGGCTCTCATGGAGAGG + Intronic
1172432789 20:34906411-34906433 GGCCCCTGGCTGGTTGGGAAAGG - Intronic
1172502342 20:35436392-35436414 GGTCCTAGGCTGGCAGGGTGGGG - Intronic
1172507462 20:35474022-35474044 TGCACCTGGCTGTCCGGGAGAGG + Exonic
1172870181 20:38130943-38130965 AGCCCCAGGGTGTCTGGGAGTGG + Intronic
1173253613 20:41377428-41377450 GGACCCAGGCTGGAGGGAAGAGG + Intergenic
1173339589 20:42141447-42141469 GGCCCCAGCCTGTGAGGGAGGGG - Intronic
1173570052 20:44070187-44070209 GTCCCGAGCCTGGCTGGGAGCGG - Intergenic
1173814307 20:45975286-45975308 GCCCCCAGGCTGGCCTGGGTGGG - Intergenic
1174287631 20:49483820-49483842 AGCTCCAGGCTGGAGGGGAGCGG - Intergenic
1174420386 20:50395587-50395609 GGCCCCAGGCTGGCCCAGGGTGG + Intergenic
1174570350 20:51496962-51496984 GGCCCCAGGCAGGGTGGCAGGGG + Intronic
1175229067 20:57461967-57461989 GTCCCCAGGGAGGCCAGGAGGGG - Intergenic
1175382080 20:58570315-58570337 GAGCCCACGCTGGGCGGGAGAGG - Intergenic
1175465835 20:59191075-59191097 GGCCCCTGGAGGGCCAGGAGTGG - Exonic
1175890262 20:62312851-62312873 GGGACCAGGGTGGCAGGGAGAGG - Intronic
1175997681 20:62818785-62818807 AGCGCCAGGCAGGCCGGGACCGG + Intronic
1176281690 20:64316983-64317005 TTCCCCAGGCTGGCCCGGCGAGG + Intergenic
1176377247 21:6092729-6092751 GGGCCCAGGCTGGAAGTGAGAGG - Intergenic
1176808379 21:13514519-13514541 GGGCCCAGCCTGGCCTGAAGTGG - Intergenic
1176939182 21:14902982-14903004 GTCCCCAGGCTGGCGTGCAGTGG - Intergenic
1177142265 21:17370070-17370092 GTCCCCAGGCTGGACTGCAGTGG + Intergenic
1179381486 21:40903329-40903351 GGACCCAGGCTGGAGTGGAGTGG - Intergenic
1179746228 21:43445515-43445537 GGGCCCAGGCTGGAAGTGAGAGG + Intergenic
1179817478 21:43917066-43917088 GCCCGCAGGGTGCCCGGGAGTGG - Intronic
1179836345 21:44036426-44036448 GGCCCCCGGCTGGCCGTGTGGGG + Intronic
1179882549 21:44299685-44299707 GGCCCCTGGGGGGCAGGGAGGGG + Intergenic
1179995126 21:44970732-44970754 AGCTCCAGGCTGGGAGGGAGAGG - Intronic
1180145176 21:45914734-45914756 GGCCACAGACTGGCCCTGAGTGG - Intronic
1180206899 21:46266307-46266329 GGCTCCAGGGTGGGCGGCAGTGG - Intronic
1180226224 21:46393938-46393960 GGCGCCTGGCATGCCGGGAGTGG + Intronic
1181042090 22:20197042-20197064 GGCCCCAGGCCCCCCGCGAGGGG + Intergenic
1181066106 22:20306842-20306864 GCCCCAAGGCAGGCAGGGAGGGG - Intergenic
1181567924 22:23751019-23751041 GGCCGCAGGCGGGCGGGGCGGGG + Exonic
1181571987 22:23772786-23772808 GGGCCGAGGCGGGCCGGGGGTGG + Intronic
1181592618 22:23894575-23894597 CCCCCCAGGTTTGCCGGGAGGGG + Exonic
1181955814 22:26587217-26587239 GGCTCCAGGCTGGCCCGGGATGG + Intronic
1182101787 22:27662817-27662839 GGCCCCAGCCAGGCCGGGGAAGG + Intergenic
1182260583 22:29071179-29071201 GGACCGAGGCTGGCTGGGTGAGG + Intergenic
1182452021 22:30427325-30427347 GGCCCCTGGCTGTCCGCAAGTGG + Exonic
1182559365 22:31147726-31147748 TGCCCAAGGCTGCCCAGGAGGGG - Intergenic
1182620907 22:31618075-31618097 GGACCCAGCCTGGCAGGCAGTGG + Intronic
1182624501 22:31635935-31635957 GGCCCCATGCTGGCAGGGAGTGG - Intronic
1183069864 22:35388495-35388517 GGCTCTTGGCTGGCCGGGCGTGG + Intronic
1183293873 22:37018943-37018965 GCCCCCGGGCCGGCTGGGAGGGG - Exonic
1183317742 22:37146187-37146209 GGCACGAGGCTGGCCTGGTGAGG - Intronic
1183465821 22:37979962-37979984 CTCCCCAGGCTGGGCGGGGGTGG + Intronic
1183486224 22:38089054-38089076 GGCGGCAGGAGGGCCGGGAGAGG - Intronic
1183639726 22:39085459-39085481 CGCCCCAGGCCTGCAGGGAGGGG - Intronic
1183650593 22:39151520-39151542 GGCTCCAGGCCGACTGGGAGGGG - Intronic
1183702022 22:39456477-39456499 GGGCCTAGGGTGGCCGGGTGAGG + Intergenic
1183836527 22:40458785-40458807 CACCTCAGGCTGGCCGGGCGTGG + Intronic
1184089245 22:42283709-42283731 GGCCCGAGGCTCCCCGGGGGCGG - Intronic
1184220356 22:43096025-43096047 AGCCCCAGCCGGGCCGGGTGCGG + Intergenic
1184222629 22:43110682-43110704 GGACCCGGGCGGGGCGGGAGGGG + Intergenic
1184391785 22:44207257-44207279 GGGCTGGGGCTGGCCGGGAGGGG + Exonic
1184478203 22:44732627-44732649 AGCCCCAGGCTGGCCGACACAGG - Intronic
1184481158 22:44748222-44748244 TGACCCAAGCTGGCCGGGCGTGG - Intronic
1184959956 22:47921621-47921643 GGCCCCGGGCTGGAGGGCAGAGG - Intergenic
1185161103 22:49230315-49230337 GGCCACAGGATGGCAGGGTGGGG + Intergenic
1185272194 22:49934781-49934803 AGCCCCAGGGAGGCGGGGAGGGG - Intergenic
1185285844 22:49999651-49999673 GGCCCAGGCCTGGCCGGGGGCGG + Intronic
1185301154 22:50081802-50081824 GGGCCAAGGCTGGGCGGGGGTGG + Intronic
1185395002 22:50582418-50582440 GGGGCCGGCCTGGCCGGGAGGGG - Intronic
950237241 3:11334037-11334059 TTCCCGAAGCTGGCCGGGAGCGG - Intronic
950720142 3:14876909-14876931 GGACCCGGGCAGGTCGGGAGGGG - Intronic
951217840 3:20040880-20040902 GGCCCCAGGCGGGAGGCGAGAGG - Intronic
952404927 3:32997290-32997312 GGCCCCGGGCTGGCCAATAGCGG + Exonic
953151585 3:40330066-40330088 GGCTGCAGGCAGGCCTGGAGGGG + Intergenic
953701299 3:45198084-45198106 GATCCCATGCAGGCCGGGAGCGG - Intergenic
953962023 3:47273717-47273739 GGCACCAGGCATGCTGGGAGAGG - Intronic
954222000 3:49160626-49160648 TGCCCCTGTCTGGCCGGGCGCGG - Intergenic
954413067 3:50379616-50379638 GGCCTCAGGCTGGCCGGGGTAGG + Intronic
955387191 3:58489204-58489226 GGGGCCAGGCTGACCTGGAGGGG - Intergenic
956136817 3:66107642-66107664 CGCCCCAGGCTGGACTGCAGTGG + Intergenic
956691010 3:71877594-71877616 GGACCCAGGCTTGCTGGGAAGGG + Intergenic
956855578 3:73271792-73271814 GGCCCCAGGCTGGAGTGCAGTGG + Intergenic
957932498 3:86899182-86899204 GTCCCCAGGCTGGAGGGCAGTGG - Intergenic
959327094 3:104950867-104950889 GGACCCAGGCTGGACTGCAGTGG - Intergenic
960942308 3:122943047-122943069 GGCCGCCGGCTGGCCGGCAGGGG + Intronic
961035289 3:123637785-123637807 GGCCCCAGGCTGGCCAGCCTTGG + Intronic
961448514 3:126992105-126992127 GGCCCCACGGTGGCAGGGGGAGG + Intronic
961448556 3:126992259-126992281 GGCACCAGGCTGGCCTGGTGTGG + Intronic
961479184 3:127168551-127168573 GGCCCCAGGCTGACCTGGAAGGG - Intergenic
961817969 3:129561114-129561136 GGCCCCAGGCAGGCGGGGGTGGG + Intronic
962478108 3:135774659-135774681 GGCCCCAGACTGGGCTGGAATGG + Intergenic
963451149 3:145482902-145482924 GCCCCCTGGCTGGCCGGGCGGGG - Intergenic
964451382 3:156816562-156816584 GGCTCCAGGCAGGCGGGGTGAGG + Intergenic
966868616 3:184276202-184276224 GGCCCCGGGCTCCACGGGAGGGG + Intronic
967880350 3:194297241-194297263 GGCCCGGGGCTGGAGGGGAGGGG - Intergenic
968089678 3:195892424-195892446 CGCCGCAGTCTGGCCAGGAGAGG + Intronic
968599815 4:1503629-1503651 GGCCGCAGGCTTGCAGGCAGCGG - Intergenic
968643405 4:1726425-1726447 GGCCCCAGGATGGCCAGCAGGGG - Intronic
968769076 4:2492157-2492179 GCCCCCAGGCTGGACTGCAGTGG - Intronic
968916095 4:3497668-3497690 GGGTCCAGGCAGGCCTGGAGAGG + Intronic
968916112 4:3497709-3497731 GCGCCCAGGCAGGCCTGGAGGGG + Intronic
969453404 4:7287464-7287486 GCCCCCAGGCTGGATGGGTGGGG + Intronic
969873125 4:10116774-10116796 GGCACCGGGCGTGCCGGGAGTGG + Exonic
975216295 4:71760081-71760103 CGCCCCAGGCTGGAGGGCAGTGG + Intronic
975736787 4:77389051-77389073 GGCATCAGACTGGCAGGGAGTGG + Intronic
976180141 4:82391089-82391111 TGCCAAAGGCTGGCCGGGCGCGG - Intergenic
976188365 4:82465790-82465812 GGCCCCAGGCTGGAGTGCAGTGG + Intergenic
976356720 4:84127202-84127224 GGCCCCAGGAGGGCTGGGGGAGG + Intergenic
976404956 4:84652908-84652930 TGCCCCAGGCTGGCGTGCAGTGG + Intergenic
976524927 4:86075982-86076004 GGCCCCAGGAGGGCTGGGGGAGG - Intronic
978620938 4:110633884-110633906 TGCCACAGGCAAGCCGGGAGAGG + Intronic
978964553 4:114725503-114725525 AGCCACAGGCTGGCGGGAAGAGG + Intergenic
979510693 4:121550395-121550417 GGCACCAGCCTGGCAGGGAGAGG - Intergenic
980123840 4:128754551-128754573 GTCCCCAGGCTGGCGTGCAGTGG + Intergenic
981079273 4:140622640-140622662 GGGGCCAGGCTGGCCGGCAGGGG + Exonic
982745674 4:159102920-159102942 GGCCGCTGGCGGGCGGGGAGCGG + Intergenic
983632109 4:169859963-169859985 GGACCCAGGAGGGCCAGGAGAGG + Intergenic
985257488 4:188084536-188084558 GTCCCCAGGCTGGCGTGCAGTGG - Intergenic
985393637 4:189517495-189517517 GGCCCCAGAGTGGCAGGGAAAGG + Intergenic
985630759 5:1012791-1012813 GGCTCCTGGGTGGCCAGGAGGGG - Intronic
985631988 5:1018608-1018630 GTCCCCAGGGTGACAGGGAGAGG + Intronic
985747692 5:1656416-1656438 AGCCCCAGGGTGGACCGGAGGGG - Intergenic
985866299 5:2517093-2517115 GGCCCCAGGAAAGCGGGGAGGGG + Intergenic
986169361 5:5303368-5303390 GGGCACAGGCTGGCCGGGACTGG - Exonic
986687710 5:10288875-10288897 CTCCCCAGGCTGGCTGAGAGGGG - Intronic
994748006 5:103702710-103702732 AGCCACAGGCTGGCCAGGCGCGG - Intergenic
995596678 5:113755112-113755134 GTCCCCAGGCTGGAGGGCAGTGG + Intergenic
997570137 5:134921057-134921079 AGCCCCAGGCTGGCTGGGCCAGG + Intronic
998069691 5:139187475-139187497 TGCCCCAGGCTGGAGTGGAGTGG - Intronic
998438081 5:142130992-142131014 TGCCCCAGGCTGGAGGGCAGTGG + Intronic
999287294 5:150401831-150401853 GGCCAAAGGCTGGAGGGGAGAGG + Intronic
999462925 5:151772221-151772243 CGCCCCAGCCGGGACGGGAGCGG - Intronic
999772029 5:154783010-154783032 GTCCCCAGGCTGGCCTGGGAGGG + Intronic
999963506 5:156783217-156783239 TGCCCCAGCTTGGCCGGGGGAGG + Intergenic
999971225 5:156865556-156865578 GTCCCCAGGCTGGCAGGCAGTGG + Intergenic
1000014638 5:157266289-157266311 CGCCCCCCGCGGGCCGGGAGAGG - Intronic
1001309625 5:170601735-170601757 GCCCACAGGCCGGCAGGGAGAGG + Intronic
1001495919 5:172187799-172187821 GGAGCCAGGCTGGCCGGGTCCGG + Intronic
1001919273 5:175587683-175587705 GCACCCAGGTTGGCCGGGTGCGG - Intergenic
1002071199 5:176679829-176679851 AGCCCCAGGGTGACAGGGAGAGG - Intergenic
1002137510 5:177117048-177117070 GGCCCGCGTGTGGCCGGGAGCGG + Intergenic
1002409099 5:179060349-179060371 GGCCGGAGGCATGCCGGGAGTGG + Intergenic
1002568826 5:180128783-180128805 GGCCCCACCCTGGCCGGGATTGG - Intronic
1002641127 5:180631075-180631097 GCTCCCAGGGTGGCTGGGAGTGG + Intronic
1003080148 6:3015258-3015280 GGCCCTGGGCAGGCAGGGAGGGG - Intronic
1003169939 6:3713143-3713165 AGTCCCAGGGTGGCCGTGAGAGG - Intergenic
1003219135 6:4141857-4141879 GGCCCCAGGCTGGAGTGCAGTGG + Intergenic
1003611852 6:7621163-7621185 AGGCCCTGGCTGGCAGGGAGGGG + Intergenic
1003645427 6:7910278-7910300 GGGCTCCGGCTGGCGGGGAGCGG - Intronic
1003955892 6:11164799-11164821 GGCTCCTGAGTGGCCGGGAGGGG + Intergenic
1003987558 6:11452207-11452229 GGCAGCAGCCTGGCAGGGAGAGG + Intergenic
1006148091 6:31971125-31971147 GGGTCCAGGCTGGCTGGCAGAGG - Exonic
1007400570 6:41600181-41600203 TCCCCCAGGCTGGGCAGGAGCGG - Exonic
1007410056 6:41656413-41656435 AGCCTCAGGCTGGCCAGGGGTGG - Intergenic
1007504599 6:42325833-42325855 GGCCCCAGGCTGGAGTGCAGTGG - Intronic
1010033059 6:71289367-71289389 GGCCCCAGGCCGGCAGTGGGAGG - Intronic
1010747260 6:79578048-79578070 GGCGGCAGCCTGGCTGGGAGAGG + Intergenic
1013155460 6:107489010-107489032 GGCCCCAGGCGTGGCAGGAGAGG + Intergenic
1013601580 6:111710120-111710142 TTTCCCAGGCTGGGCGGGAGAGG - Intronic
1017210026 6:151845527-151845549 GTCACCAGGCTGGACGGCAGTGG - Intronic
1017235234 6:152111678-152111700 GACCACAGGCTGGAAGGGAGGGG + Intronic
1018736606 6:166691363-166691385 GGTCTCAGGCTGGACTGGAGTGG - Intronic
1018750471 6:166799977-166799999 GGCCCCAGGCCTGCCTGGTGGGG + Intronic
1018774014 6:166998206-166998228 CGCCTCAGGGTGGGCGGGAGGGG - Intergenic
1018956540 6:168413946-168413968 GGCCCCGGTCTGGCAGGGATCGG + Intergenic
1019165699 6:170096295-170096317 GGCCCAGGGCTGGGAGGGAGAGG - Intergenic
1019528986 7:1494355-1494377 AGCCCCAGGCGGGGCTGGAGGGG + Intronic
1019667077 7:2257302-2257324 GGTCCCACCATGGCCGGGAGGGG + Intronic
1019736633 7:2653112-2653134 GGCACCAGGCTGGCCGAGTGGGG + Intronic
1020014846 7:4824980-4825002 GGCCCCAGGTTGGCAGGTGGGGG - Intronic
1020049509 7:5072506-5072528 CGCCCCATGCTGGAGGGGAGGGG + Intronic
1020093021 7:5351947-5351969 GGCCCCAAGCTGACCAAGAGGGG - Exonic
1020129732 7:5553012-5553034 GGCCCCTGGATGACAGGGAGAGG - Intronic
1020191744 7:6005242-6005264 GTCCCCAGGCTGGCATGCAGTGG + Intronic
1020224933 7:6272521-6272543 GGCCCCCGGCTCGCCGGCTGCGG - Exonic
1020560521 7:9726067-9726089 TGCCCCAGCTTGGCCGGGCGAGG + Intergenic
1021565457 7:22012154-22012176 TCCCCCAGGCCGGCCGGGCGCGG - Intergenic
1021870549 7:25001988-25002010 GGCTGCAGCCTGGCAGGGAGAGG - Intergenic
1022473265 7:30694574-30694596 GGGCCCAGGCTGCCAGGGACCGG + Intronic
1023725973 7:43142911-43142933 GGTCCCAGGCTGGCTCAGAGTGG + Intronic
1023984236 7:45085830-45085852 GGCTCCAGGGTGGCCGGGAGAGG + Exonic
1025611251 7:63077300-63077322 GGACCCATGCAGGCCAGGAGTGG - Intergenic
1025976904 7:66377172-66377194 GGCCGCAGCTGGGCCGGGAGAGG + Intronic
1026745725 7:73010219-73010241 GTCCCCAGGCTGGCGTGCAGTGG - Intergenic
1026749378 7:73038161-73038183 GTCCCCAGGCTGGCGTGCAGTGG - Intergenic
1026753026 7:73066306-73066328 GTCCCCAGGCTGGCGTGCAGTGG - Intergenic
1026756677 7:73094432-73094454 GTCCCCAGGCTGGCGTGCAGTGG - Intergenic
1027031830 7:74894893-74894915 GTCCCCAGGCTGGCGTGCAGTGG - Intergenic
1027090729 7:75298996-75299018 GTCCCCAGGCTGGCGTGCAGTGG + Intergenic
1027094374 7:75326966-75326988 GTCCCCAGGCTGGCGTGCAGTGG + Intergenic
1027098017 7:75354891-75354913 GTCCCCAGGCTGGCGTGCAGTGG + Intergenic
1027198619 7:76048309-76048331 CGGTCCAGGCTGGCCTGGAGAGG - Intronic
1027321331 7:77012655-77012677 GTCCCCAGGCTGGCGTGCAGTGG - Intergenic
1027324964 7:77040720-77040742 GTCCCCAGGCTGGCGTGCAGTGG - Intergenic
1029154107 7:98502812-98502834 GGCCCCATGCAGGCTGGGTGTGG + Intergenic
1029189595 7:98762211-98762233 GCCCCCACGCTGGGAGGGAGGGG - Intergenic
1029276155 7:99405650-99405672 TGCCCCTGGCTGGCTGGGCGCGG - Intronic
1029419595 7:100466031-100466053 GAGCCCAGGCTGCCAGGGAGGGG + Intronic
1029734956 7:102460485-102460507 TGCCCCAGGCTGACCGGGGAAGG + Intronic
1030310575 7:108064943-108064965 GGCCCCAGGCTGGAGTGTAGTGG + Intronic
1031814913 7:126421834-126421856 GGCCCCAGGCTGGAGTGCAGTGG + Intergenic
1032160046 7:129502876-129502898 AGCCCCAGGCTGTCCCGGAGAGG + Intronic
1032162663 7:129522750-129522772 GCCACCAGGCTGGCCTGAAGGGG - Intergenic
1032736688 7:134698865-134698887 GGCTGAAGGCTGGACGGGAGAGG - Intergenic
1033159182 7:138981520-138981542 GGCGTCCGGCCGGCCGGGAGGGG - Intergenic
1034441163 7:151086703-151086725 GGCCCGAGGCGGGCCCGGGGCGG - Intronic
1034458983 7:151187614-151187636 GCTCCCAGGCTGGGCGGGAGTGG + Intronic
1035266385 7:157692254-157692276 GGCCCCGGAGGGGCCGGGAGCGG - Intronic
1035473800 7:159128457-159128479 GGCCCAAGGCAGGAGGGGAGTGG - Intronic
1036704359 8:11035504-11035526 AGCCCCAGGGTGGCCTGGGGAGG + Intronic
1036733286 8:11284732-11284754 CGCCCCAGGCTGGGTGGGCGCGG - Exonic
1037802718 8:22044108-22044130 GCCCCCAGCCTGGCTGGGAGGGG + Intronic
1037806311 8:22059577-22059599 GGCCTCAGGCAGGCCGGGGTAGG + Intronic
1037877513 8:22555202-22555224 GGCACCAGGCTGGAGGGCAGGGG - Intronic
1038229697 8:25688688-25688710 GGCCCCAGCATGGCGGGGTGGGG + Intergenic
1038425624 8:27462192-27462214 GACCCCAGGCAGGCTGGGGGTGG + Intronic
1039106211 8:33992736-33992758 AGACCCAGGCTGGCTGGAAGTGG + Intergenic
1039589516 8:38734834-38734856 TGACGCAGGCTGGCGGGGAGTGG + Intronic
1041051565 8:53939644-53939666 CGCCCCAGGCCAGCCCGGAGCGG + Exonic
1041969988 8:63729501-63729523 GGCCTCAGCCTGCCTGGGAGTGG - Intergenic
1042031462 8:64480374-64480396 GACCCTAGGCTGGCAGGCAGTGG - Intergenic
1042859066 8:73295104-73295126 GGCCCCGCGCAGGCAGGGAGCGG + Exonic
1042875292 8:73435759-73435781 GACCCCAGACTGGCCTGAAGAGG - Intronic
1042889790 8:73596070-73596092 GGCCCCAGGCTGGAGTGCAGTGG - Intronic
1043401852 8:79891932-79891954 GGCCACAGGCGCCCCGGGAGGGG - Intergenic
1043401876 8:79891989-79892011 GGCCACAGGCGCCCCGGGAGGGG - Intergenic
1044035435 8:87297136-87297158 GGACCCAGGCTGGACTGCAGTGG - Intronic
1044576958 8:93780091-93780113 GGCAGCAGGCTGGCAGGGGGAGG - Intronic
1044719781 8:95134060-95134082 GGCTCCTGACGGGCCGGGAGGGG + Intronic
1045654819 8:104375995-104376017 GGCGTCAGGCGGGCCTGGAGAGG - Intronic
1046243192 8:111526222-111526244 GGTCCCAGGTTGGCCCTGAGGGG - Intergenic
1047140206 8:122130064-122130086 GTCCCCAGGCTGGAGGGCAGTGG + Intergenic
1047274551 8:123395984-123396006 GAGCTGAGGCTGGCCGGGAGAGG - Intronic
1049063438 8:140294334-140294356 GGCCCCGGGCAGGCTGGGTGAGG - Intronic
1049146241 8:141002645-141002667 GGCCTGAGGCTGGCATGGAGAGG - Intergenic
1049219283 8:141421533-141421555 GGCCCCAGGCTGGGCAGCAGAGG - Exonic
1049465439 8:142749302-142749324 GGCCCCAGCCTGGCTAGGAGAGG - Intergenic
1049531699 8:143158563-143158585 GGCCCCGAGCTGACCCGGAGGGG - Intronic
1049542189 8:143213692-143213714 GGCCCCAGGGTGGCTGGGGAGGG - Intergenic
1049560821 8:143309301-143309323 GTCCCCAGGCCGGCCGGGCACGG - Intronic
1049677749 8:143900032-143900054 GGTCCCATCATGGCCGGGAGGGG - Intergenic
1049690562 8:143957119-143957141 GGTCCCAGGCTGGCAGCGAAGGG + Intronic
1049761300 8:144333027-144333049 GGCCCCTGGCGGGCGGGGCGGGG + Exonic
1049831740 8:144705226-144705248 GGCTCCAGGCTGAGGGGGAGAGG - Intergenic
1049902157 9:179049-179071 GGCCCCGGGCAGGCCGGGAGTGG - Exonic
1049998125 9:1050433-1050455 TGACCCAGGCTGGGCGGGAAAGG - Exonic
1050745983 9:8876964-8876986 GTCCCCAGGCTGGACTGCAGTGG + Intronic
1052086063 9:24267231-24267253 GGCCCCAGGCTGGAGTGCAGTGG - Intergenic
1052765524 9:32636044-32636066 CGCCCCAGGCTGGCGTGCAGTGG + Intergenic
1052774520 9:32720013-32720035 GGCCTCAGGCTGGTTGTGAGGGG + Intergenic
1052784418 9:32815430-32815452 GGACACAGTCTGGCCGGGCGCGG + Intergenic
1053073421 9:35114503-35114525 GCCCCTGGGCTGGCTGGGAGAGG - Intronic
1053150219 9:35738511-35738533 GGCCCCAGGTTAGCGGGTAGGGG - Exonic
1053297775 9:36927225-36927247 GGCCCCAGGGTGGGCTGGGGAGG - Intronic
1053352833 9:37424732-37424754 GGCCTCAGGCTGCCCGGGGCTGG - Intronic
1053745189 9:41189338-41189360 GGCCCCGGCCAGGCCGGGAGTGG - Exonic
1054261837 9:62874434-62874456 GTCCCCAGGCTGGACTGCAGTGG - Intergenic
1054482083 9:65675875-65675897 GGCCCCGGCCAGGCCGGGAGTGG + Intronic
1054683158 9:68241930-68241952 GGCCCCGGCCAGGCCGGGAGTGG + Exonic
1057276590 9:93679269-93679291 GGCCCGAGACTGGGTGGGAGAGG + Exonic
1057293204 9:93820141-93820163 GCCCCCAAGCTGGTGGGGAGAGG + Intergenic
1058693549 9:107539629-107539651 GTCCCCAAACTGGCCGGGCGTGG + Intergenic
1058852019 9:109021761-109021783 TTGCCCAGGCTGGCCTGGAGTGG - Intronic
1059016108 9:110517701-110517723 GGCCCCAGGCTGGATTGCAGTGG - Intronic
1060106431 9:120876311-120876333 GGCCCCTGGCCGGGCGGGCGGGG - Intronic
1061160671 9:128892250-128892272 TGCCCCAGCCTGGCAGGGCGAGG + Intronic
1061194869 9:129102234-129102256 GGGCCCAGGGAGGCCAGGAGGGG - Intronic
1062268818 9:135699623-135699645 GGCCCCGGGCTGGCTGCGTGGGG - Intergenic
1062441910 9:136573989-136574011 GTCCCCAGGCTGGAGGGCAGTGG + Intergenic
1062442282 9:136576193-136576215 GGCCCCAGGCTGGGCAGGCTGGG - Intergenic
1062561538 9:137144362-137144384 GTCCCCAGGTTGGCCGGGCGCGG + Intronic
1062561660 9:137144837-137144859 GTCCCCAGGGTGGCAGGGATGGG + Intronic
1062561869 9:137145412-137145434 GTCCCCAGGGTGGCAGGGATGGG + Intronic
1062565549 9:137162523-137162545 GGGACCAGGCGGGCCGGGCGGGG - Intronic
1062612863 9:137382881-137382903 GGCAGGAGGCTGGGCGGGAGAGG - Intronic
1202781317 9_KI270718v1_random:122-144 GGCCCCGGCCAGGCCGGGAGTGG - Intergenic
1186466230 X:9786340-9786362 GGGCCGGGGCTGGCGGGGAGGGG - Intergenic
1188237460 X:27747613-27747635 GGCACCCGGCTGGCCAGTAGCGG + Exonic
1189446688 X:41086384-41086406 GGCCCCAGACAGGACGGGAAGGG - Intronic
1189821418 X:44873124-44873146 GGCGCCAGCCGGGCGGGGAGGGG + Intergenic
1190927536 X:54922587-54922609 AGCCCCAGGCTCCCCGGGGGAGG - Exonic
1191942040 X:66490933-66490955 GTCGCCAGGCTGGCCTGCAGTGG - Intergenic
1192654746 X:72981113-72981135 GGCACCAGCCTGGCTGGCAGAGG + Intergenic
1193115611 X:77772514-77772536 GTCTCCAGGCTGGCGGGCAGTGG + Intronic
1195413712 X:104597302-104597324 TGCCCCAGGCTGGCGTGCAGTGG - Intronic
1195915082 X:109927986-109928008 GGCCCCAGGCTGCTGGGGAGGGG - Intergenic
1196459064 X:115911461-115911483 GGCCCAAGGCTGGCTGGAAATGG + Intergenic
1196782876 X:119399239-119399261 GGCCCGAGGCTGGTCGGGGGTGG - Exonic
1196825584 X:119737906-119737928 CGCCCCAGGCTGGAGTGGAGTGG + Intergenic
1197768191 X:130072446-130072468 GGGCCCAGGCAGGGCTGGAGCGG + Intronic
1199097195 X:143757480-143757502 GGCGCCAGCCTGGCCGAGTGCGG + Intergenic
1199643929 X:149887035-149887057 GGCCTCAGGCTGGCAGGAATGGG - Intergenic
1199925395 X:152457553-152457575 GGTCACAGGTTGGCCGGGTGCGG - Intergenic
1199939607 X:152612313-152612335 GGCCACAGCCTGGCTGGGGGAGG - Intergenic
1200066020 X:153504438-153504460 GGCTCCAGGCAGGAAGGGAGTGG - Intronic
1200737383 Y:6814256-6814278 GGCTCCAGCCTGGCTGGGAGAGG + Intergenic
1202388619 Y:24347993-24348015 GGGCCCAGGCTGGGTGGGGGCGG - Intergenic
1202482168 Y:25322135-25322157 GGGCCCAGGCTGGGTGGGGGCGG + Intergenic