ID: 1084172040

View in Genome Browser
Species Human (GRCh38)
Location 11:67405491-67405513
Sequence CCCTGGCACCTATCAGGTGA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 225
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 208}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084172031_1084172040 14 Left 1084172031 11:67405454-67405476 CCCTGTTGTGTGGGGCCCATGTG 0: 1
1: 0
2: 1
3: 13
4: 170
Right 1084172040 11:67405491-67405513 CCCTGGCACCTATCAGGTGAGGG 0: 1
1: 0
2: 0
3: 16
4: 208
1084172032_1084172040 13 Left 1084172032 11:67405455-67405477 CCTGTTGTGTGGGGCCCATGTGT 0: 1
1: 0
2: 0
3: 9
4: 137
Right 1084172040 11:67405491-67405513 CCCTGGCACCTATCAGGTGAGGG 0: 1
1: 0
2: 0
3: 16
4: 208
1084172026_1084172040 25 Left 1084172026 11:67405443-67405465 CCGATGCTGGCCCCTGTTGTGTG 0: 1
1: 0
2: 1
3: 16
4: 181
Right 1084172040 11:67405491-67405513 CCCTGGCACCTATCAGGTGAGGG 0: 1
1: 0
2: 0
3: 16
4: 208
1084172025_1084172040 26 Left 1084172025 11:67405442-67405464 CCCGATGCTGGCCCCTGTTGTGT 0: 1
1: 0
2: 0
3: 12
4: 149
Right 1084172040 11:67405491-67405513 CCCTGGCACCTATCAGGTGAGGG 0: 1
1: 0
2: 0
3: 16
4: 208
1084172033_1084172040 -1 Left 1084172033 11:67405469-67405491 CCCATGTGTGCCAGAAGAACAGC 0: 1
1: 0
2: 1
3: 11
4: 124
Right 1084172040 11:67405491-67405513 CCCTGGCACCTATCAGGTGAGGG 0: 1
1: 0
2: 0
3: 16
4: 208
1084172030_1084172040 15 Left 1084172030 11:67405453-67405475 CCCCTGTTGTGTGGGGCCCATGT 0: 1
1: 0
2: 1
3: 13
4: 131
Right 1084172040 11:67405491-67405513 CCCTGGCACCTATCAGGTGAGGG 0: 1
1: 0
2: 0
3: 16
4: 208
1084172034_1084172040 -2 Left 1084172034 11:67405470-67405492 CCATGTGTGCCAGAAGAACAGCC 0: 1
1: 0
2: 1
3: 15
4: 165
Right 1084172040 11:67405491-67405513 CCCTGGCACCTATCAGGTGAGGG 0: 1
1: 0
2: 0
3: 16
4: 208

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084172040 Original CRISPR CCCTGGCACCTATCAGGTGA GGG Exonic
900203483 1:1421411-1421433 CCCTGGCAGCCAGCAGGGGAGGG - Exonic
900428179 1:2589937-2589959 CCCTGGAGACTCTCAGGTGATGG + Exonic
901557601 1:10044120-10044142 ACCTGGCACCTGGCAGGTGGAGG - Intronic
901841224 1:11955203-11955225 CCCTCCCACCTTCCAGGTGAAGG + Intronic
902543240 1:17169318-17169340 CCCTGGAACCTAGGAGGTGGAGG - Intergenic
903181806 1:21608604-21608626 CCTTGGGACCTGTCAGGTGGGGG - Intronic
904055385 1:27666689-27666711 CCATGGCAGACATCAGGTGAAGG - Intronic
904357277 1:29948463-29948485 CCCAGGCACATAGCAGGTGAGGG - Intergenic
904700552 1:32355440-32355462 CCCTGGCCCCTGTCATGTAATGG + Intronic
905051362 1:35053771-35053793 GCCAGGCAACCATCAGGTGATGG + Intergenic
905239691 1:36573543-36573565 CACTGGCACCTTGCTGGTGAGGG + Intergenic
905272173 1:36794224-36794246 CCCTGGCACTTGTCAGCTGATGG + Intergenic
908948145 1:69524827-69524849 GCCAGGCAACCATCAGGTGATGG - Intergenic
909881866 1:80889803-80889825 TACTGGCACCTAGTAGGTGAAGG + Intergenic
910625292 1:89300363-89300385 ACCTGGCACCTATCAGGGGGTGG + Intergenic
910660161 1:89662978-89663000 CACTGGGACCTGTCAGGGGATGG - Intronic
915338439 1:155162283-155162305 CCCTGACACTTACCAGGTGAGGG - Intergenic
917067565 1:171113344-171113366 CAGAGGCACCAATCAGGTGAAGG - Intronic
917395216 1:174586375-174586397 CACTGGGACCTGTCAGGGGAGGG + Intronic
917570642 1:176261900-176261922 CCCTTGCACTTCCCAGGTGAGGG + Intergenic
918013994 1:180615160-180615182 CCCTGGCACCACTCAGTTGGGGG + Intergenic
919256450 1:195130602-195130624 ACCTGGGACCTAGCAGGTGCAGG + Intergenic
920604022 1:207362321-207362343 CCCTGGCATTTATCAGCTGCAGG + Intergenic
923899435 1:238309808-238309830 TCCTGGCACCTAACAGGTTGTGG - Intergenic
924118999 1:240777759-240777781 CCCTGGGACCTATCTGATAAAGG + Intronic
1063092948 10:2884346-2884368 CACTGGGACCTGTCAGGGGAGGG + Intergenic
1063102184 10:2960027-2960049 CACTGGGACCTGTCAGGGGATGG + Intergenic
1064859989 10:19816321-19816343 CGCTGGAACCTATCGGGAGAGGG - Exonic
1065278422 10:24109947-24109969 CCCTTGCACCCAGCAGGTCAAGG - Intronic
1066228743 10:33411295-33411317 CACTGGGACCTGTCAGGGGAGGG - Intergenic
1066639156 10:37538173-37538195 CCCTTGCACTTCCCAGGTGAGGG - Intergenic
1067374435 10:45714379-45714401 GCCTGGCTCCTAACAGGTCATGG - Intergenic
1071828952 10:89353102-89353124 ACCAGGCAACCATCAGGTGATGG + Intronic
1073229066 10:101951782-101951804 CCCTGGAACCCAGCAGGTGGAGG + Intronic
1074384323 10:113005103-113005125 TCCTGGCACCTAGCACGTGTTGG + Intronic
1074866928 10:117550004-117550026 CCCTGGCCCCAATCTGCTGAAGG + Intergenic
1074876238 10:117615677-117615699 CCCTGGCACATAGGAGATGATGG - Intergenic
1074983009 10:118634741-118634763 TCCTGGCATCTAGCAGGTGGAGG - Intergenic
1081143446 11:39532827-39532849 CACTGGGACCTATCATGGGATGG - Intergenic
1081583125 11:44365964-44365986 CCCGTGCACCTCTCAGGTAAGGG + Intergenic
1081943093 11:46961993-46962015 TCCTTGCTCCTATCATGTGAAGG - Intronic
1083922752 11:65789311-65789333 CGCTGGCACCATCCAGGTGAGGG + Intronic
1084172040 11:67405491-67405513 CCCTGGCACCTATCAGGTGAGGG + Exonic
1084762907 11:71285202-71285224 GCCAGGCACCTGTCAGATGAGGG - Intergenic
1086346678 11:85904103-85904125 CCCTGGCACCTCTGAACTGACGG - Intronic
1089443120 11:118532225-118532247 CCCTGCCACCCGGCAGGTGAAGG - Exonic
1091047493 11:132337396-132337418 TCCTGGTTCCTCTCAGGTGAAGG - Intergenic
1091061509 11:132467299-132467321 CCAGAGCACCTCTCAGGTGACGG - Intronic
1092171311 12:6375498-6375520 CCGCTGCACCTGTCAGGTGAGGG - Intronic
1093692182 12:22121360-22121382 CCCTGGCACATGTCCTGTGAGGG - Intronic
1095716362 12:45350759-45350781 CCTTGGATCTTATCAGGTGAGGG + Exonic
1096909217 12:54965351-54965373 CACTGGGACCTGTCAGGGGATGG - Intronic
1097319930 12:58214122-58214144 CCCTGGCTTCTATCAGGTTCTGG + Intergenic
1098477900 12:70926496-70926518 CCCTTGAACCTATGAGGTGGAGG + Intergenic
1099675266 12:85752979-85753001 CCTTAGCACCTATCAGCTGAGGG - Intergenic
1102748161 12:115268206-115268228 GGCTGGCACCTAGCAGGTGCTGG - Intergenic
1102799292 12:115717567-115717589 CCCTGTCCCCTTCCAGGTGATGG - Intergenic
1103000983 12:117385146-117385168 CCCTGGCACCTGAGAGGTGGAGG - Intronic
1103636924 12:122314582-122314604 CCCTGGGTCCTACTAGGTGATGG - Intronic
1104043062 12:125143044-125143066 CCCTAGCAACTCTCAGGTGGAGG - Exonic
1104456538 12:128918294-128918316 CACTGGGACCTGTCAGGAGAGGG + Intronic
1106145281 13:27044535-27044557 CCCTGGAACGAAACAGGTGACGG + Intergenic
1109140184 13:58704843-58704865 CCCTTGAACCTTTCAGGTGCAGG + Intergenic
1109393055 13:61718577-61718599 CACTGGGGCCTATCAGGGGAGGG - Intergenic
1110893994 13:80726344-80726366 CACTGGGACCTGTCAGGGGAAGG - Intergenic
1112818928 13:103308290-103308312 CCCTGGTAACTAACATGTGAAGG - Intergenic
1113715748 13:112505899-112505921 CCCAGGCACCGGGCAGGTGAGGG - Intronic
1113882531 13:113635620-113635642 CCATGGCACCTACAGGGTGATGG - Intronic
1114753269 14:25229499-25229521 CACTGGGACCTGTCAGGGGATGG - Intergenic
1115433823 14:33350898-33350920 CACTGGCACAAATCAGGTGAAGG + Intronic
1115493748 14:33983322-33983344 CACTGGGACCTATCAGGAGGTGG - Intronic
1116811788 14:49546579-49546601 CCCTGGCACCTATGATGTGGTGG - Intergenic
1117143451 14:52812635-52812657 CCCTGGCTACTAGCAGGTGCTGG + Intergenic
1119388270 14:74272595-74272617 CCCTGGAACCTAGGAGGTGGAGG + Intergenic
1122336816 14:100995814-100995836 CACTGGCGCCTGTCAGGGGAGGG - Intergenic
1124137849 15:27050430-27050452 CCCTGCCACCTCCCAGGTGAAGG - Intronic
1130766208 15:86874057-86874079 ACCTGACACATATGAGGTGAGGG + Intronic
1132481726 16:169626-169648 GCCTGGCACCTCTCAGGACAGGG - Intergenic
1132482592 16:173883-173905 GCCTGGCACCTCTCAGGACAGGG - Intergenic
1133174353 16:4002796-4002818 CCCTTGAACCTAGTAGGTGAAGG - Intronic
1133796177 16:9048243-9048265 GCCTGGCACTGATCAGATGAAGG - Intergenic
1134251097 16:12574760-12574782 CCCTGGCCTCTAACAGGTGGAGG - Intergenic
1135653047 16:24223751-24223773 CACTGGAGCCTATCAGGTGGTGG + Intergenic
1136184024 16:28574547-28574569 CCCTGGCACCTAGTGGGTGGGGG + Intronic
1140617924 16:76689942-76689964 CGCTGGAACCTAGCAGGTGGAGG - Intergenic
1140813747 16:78602314-78602336 CGCTGGAACCTAGGAGGTGAAGG - Intronic
1141248335 16:82331849-82331871 ACAGGGCAACTATCAGGTGATGG + Intergenic
1143623714 17:8096101-8096123 CCCTAGCACCTTTAAGGGGAGGG - Intronic
1144451593 17:15384473-15384495 CCTTGGCATCTATCAGCTGCTGG - Intergenic
1144739983 17:17576340-17576362 CCCTGGCACCCATCACGAGCTGG + Intronic
1148610137 17:48959684-48959706 CCATGGCACCTTCCTGGTGATGG - Intronic
1148881030 17:50727320-50727342 AGCTGGTACCTATCTGGTGAGGG + Intronic
1149467481 17:56891471-56891493 CCCTGGTGCCTATCAGGGCAGGG - Exonic
1149832434 17:59883849-59883871 ACCTGGTACCTACCAGGTAAAGG - Intronic
1151163886 17:72187932-72187954 CCCAGGCACCCAACATGTGAAGG - Intergenic
1151495479 17:74455538-74455560 CCCTGGTACCAAGCAGATGAGGG + Intergenic
1153603024 18:6800694-6800716 CACTGGGACCTGTCAGGGGATGG + Intronic
1158418209 18:57268584-57268606 CACTGGGGCCTGTCAGGTGATGG - Intergenic
1161219494 19:3111815-3111837 CCCTGGGGCCTTTCAGCTGAGGG + Intronic
1161455060 19:4365895-4365917 CCCTGGCACCCCCCAGATGAGGG - Intronic
1162794985 19:13082336-13082358 TCCTGGCATCTAGCAGGTGGAGG - Intronic
1162935730 19:13980564-13980586 GCCTGGCACCTCTTGGGTGACGG + Exonic
1163111251 19:15161893-15161915 CTCTGGCACTTAGTAGGTGATGG - Intronic
1164179427 19:22806681-22806703 CCCTCGCACTCATCAGGTGACGG + Intergenic
1165061156 19:33205844-33205866 CAATGCCACCTACCAGGTGAAGG + Exonic
1167138409 19:47632492-47632514 GCCTGGCACATCCCAGGTGATGG + Intronic
1167491748 19:49796515-49796537 CCCTGGCCCCTGGCAGGTGCTGG - Intronic
1167952021 19:53035561-53035583 GCCAGGCAACCATCAGGTGATGG + Intergenic
925439499 2:3872166-3872188 GCCTGGTTCCTAACAGGTGAGGG + Intergenic
928426100 2:31179227-31179249 CCCTGGGACCTGTCAGGGGGTGG - Intronic
934572531 2:95382012-95382034 CCTTGGCCCCCATCAAGTGAAGG + Intronic
934935281 2:98460781-98460803 CCCTGGCACCCATGGGGTCAGGG + Intronic
935747068 2:106197822-106197844 CCCTGCCACCTACCAAGTGTTGG - Intergenic
937320550 2:120958246-120958268 GCCTGGCATCTAGCAGGTGCTGG + Intronic
939195081 2:138961702-138961724 ATCTGGCAACCATCAGGTGATGG - Intergenic
939594200 2:144104313-144104335 CCCTTGCACTTCCCAGGTGAGGG - Intronic
941685100 2:168440146-168440168 GTCAGGCAACTATCAGGTGATGG - Intergenic
942821654 2:180122486-180122508 CCCTGCCACATATCACGTGGGGG - Intergenic
946154414 2:217797774-217797796 CTCTGGCACGTAGCAGGTGTTGG + Intergenic
947237852 2:227962591-227962613 GTCTGGCAACCATCAGGTGATGG + Intergenic
1168813126 20:719374-719396 CCCTGGCAGGTGGCAGGTGATGG - Intergenic
1168953775 20:1820074-1820096 CCCCGTCACCTCTAAGGTGAAGG + Intergenic
1171520078 20:25769083-25769105 ACCTGGCACCTAGAAGGTGTTGG + Intronic
1171556841 20:26087410-26087432 ACCTGGCACCTAGAAGGTGTTGG - Intergenic
1172504469 20:35451329-35451351 CCCTGGTCCCTGCCAGGTGAGGG - Intronic
1172705167 20:36877683-36877705 CCCTGGCCCCTGCCAGCTGAGGG - Intronic
1175767872 20:61603588-61603610 CAATGGGACCTAGCAGGTGAGGG - Intronic
1176654210 21:9575359-9575381 ACCTGGCACCTAGAAGGTGTTGG + Intergenic
1178339360 21:31772994-31773016 CCCTGGCACTTAGCAGCTGTGGG + Intergenic
1182368144 22:29792404-29792426 CCCTGGCAGGTAGCAGATGAAGG - Intronic
950141298 3:10617862-10617884 ACCTGGCCCCCACCAGGTGATGG + Intronic
950536876 3:13583872-13583894 CTCTGGCACCCAAAAGGTGAGGG - Intronic
952899777 3:38102330-38102352 CCCTGTCACCCAGCAGGGGAAGG - Intronic
955059181 3:55481906-55481928 CCCTGGCAGCTGCCAGGTGTGGG - Intronic
955077980 3:55631720-55631742 TCCAGCCACCTGTCAGGTGATGG - Intronic
955825055 3:62937197-62937219 GCCAGGCAACCATCAGGTGATGG - Intergenic
956368423 3:68531789-68531811 GCCTGGCAACCATCAGTTGATGG - Intronic
960777057 3:121268390-121268412 CACTGGGACCTGTCAGGGGATGG + Intronic
963684892 3:148420780-148420802 GTCAGGCAACTATCAGGTGATGG - Intergenic
967104479 3:186244291-186244313 CCCTGCCACCTTTCAGATGTGGG - Intronic
967751364 3:193119736-193119758 GTCAGGCAACTATCAGGTGATGG + Intergenic
968009915 3:195267570-195267592 CCCTAGCACCTGACAGATGAGGG - Intronic
968760331 4:2439539-2439561 CTCAGCCACCTAACAGGTGAAGG + Intronic
969423568 4:7110978-7111000 GTCTGGCACCTAGCAGGTGCTGG + Intergenic
970288742 4:14548932-14548954 CACTGGGGCCTATCAGGGGAGGG + Intergenic
970981581 4:22105110-22105132 CCCTGGAATGTATTAGGTGAAGG - Intergenic
971076151 4:23151959-23151981 CCCTGGCAGCAACCAGGTGGGGG - Intergenic
971990411 4:33885811-33885833 GCCAGGCAACCATCAGGTGATGG + Intergenic
973798315 4:54451073-54451095 CCCTTGCACTTCCCAGGTGAGGG - Intergenic
974615141 4:64270654-64270676 ATCAGGCAACTATCAGGTGATGG + Intergenic
974934316 4:68395116-68395138 GCCAGGCAACCATCAGGTGATGG + Intergenic
975222897 4:71833696-71833718 GTCAGGCAACTATCAGGTGATGG - Intergenic
979565805 4:122152741-122152763 CCCTGGCACCTATAAACCGAGGG + Intronic
980259673 4:130432435-130432457 GTCTGGCAACTATCAGATGATGG + Intergenic
982207613 4:153008733-153008755 TCCTGGCTCCTACCAGGTGAGGG + Intergenic
983003956 4:162459069-162459091 CACTGGCACCTATCAGAGGGTGG - Intergenic
985379229 4:189374622-189374644 ACCTGGCACCTCTCAGGAAATGG - Intergenic
985537989 5:475202-475224 CCAAGGCACCCAGCAGGTGACGG - Intronic
985841808 5:2311959-2311981 CCCTGGCACATATCAGTTTATGG - Intergenic
986045493 5:4033300-4033322 CACTGGTACCTGTCAGGGGATGG - Intergenic
986673988 5:10167827-10167849 ACCTGGCACCTTTGAGGTGGTGG - Intergenic
987438405 5:17926039-17926061 CCCTGGAACATGTCAGGAGATGG + Intergenic
989476787 5:41883422-41883444 GTCTGGCAACTATCAGGTGATGG - Intergenic
989771283 5:45149132-45149154 CCTTGGCACCAAAAAGGTGATGG - Intergenic
991128091 5:63090347-63090369 CCCTTGCGCTTCTCAGGTGAGGG - Intergenic
992759862 5:79942023-79942045 CTCAGCCACCTACCAGGTGAGGG - Intergenic
993793999 5:92244043-92244065 CCCTGCCACTTACCAGGTTAGGG - Intergenic
994174617 5:96697856-96697878 CCCTGGCATTTAGCAGGTGCTGG + Intronic
994785627 5:104158260-104158282 CACTTGAACCCATCAGGTGATGG - Intergenic
995582134 5:113613394-113613416 GCCAGGCAACCATCAGGTGATGG - Intergenic
996280911 5:121728158-121728180 ATCAGGCAACTATCAGGTGATGG + Intergenic
998604228 5:143617174-143617196 CCCTGGGGCCTGTCAGGGGAGGG + Intergenic
999277413 5:150340460-150340482 CTCTGCCACTTATCAGTTGAGGG + Intergenic
1000584430 5:163079147-163079169 CACTGGGACCTGTCGGGTGATGG + Intergenic
1001104807 5:168843994-168844016 CCCTGGCCCCTTTAAGGTCACGG + Intronic
1002105660 5:176878378-176878400 CCTTGTCAGCTACCAGGTGAGGG + Exonic
1003092345 6:3114787-3114809 CCCTGGCATCTAGTAGGTGGGGG - Exonic
1006216137 6:32444347-32444369 TCCTGGCTCCTTTCAGGTTAGGG + Intronic
1006861558 6:37174660-37174682 CCATGGCACCTTTCATATGAAGG - Exonic
1007672642 6:43568658-43568680 CCTTTGAACCTTTCAGGTGAGGG - Intronic
1011992063 6:93534142-93534164 CACTGGAGCCTGTCAGGTGATGG - Intergenic
1014292343 6:119573102-119573124 GCCTGGTTCCTAACAGGTGATGG + Intergenic
1016798526 6:148144015-148144037 CCGTGGCATCTTTCAGCTGAAGG + Intergenic
1018872158 6:167791447-167791469 CCAGGGCACCAAGCAGGTGATGG + Intronic
1024604472 7:51012778-51012800 CCATGGCACCTGTTAGGAGATGG + Intergenic
1025280562 7:57624027-57624049 ACCTGGCACCTAGAAGGTGTTGG + Intergenic
1025304168 7:57841480-57841502 ACCTGGCACCTAGAAGGTGTTGG - Intergenic
1026299533 7:69085063-69085085 CACTGGAACCTATCAGGGGATGG + Intergenic
1027181048 7:75939686-75939708 CACTTGCACCTAGGAGGTGAAGG - Intronic
1027727876 7:81829978-81830000 CCCTTGCACTTCCCAGGTGAGGG + Intergenic
1028167751 7:87558020-87558042 TCTTGGCACCAACCAGGTGAAGG + Intronic
1032118527 7:129138458-129138480 CCCTGGCACCTAGCAGAGCATGG - Intergenic
1035555259 8:562906-562928 CCCTGGCACCTGTCAGAGCACGG + Intergenic
1035588875 8:798201-798223 CCCTGGCACTGGCCAGGTGATGG + Intergenic
1035664637 8:1372063-1372085 CTCAGGCACCTGCCAGGTGATGG + Intergenic
1041299584 8:56396981-56397003 CCCTGCCACCGACCAGTTGAGGG + Intergenic
1043552626 8:81392072-81392094 CACTGGGCCCTGTCAGGTGATGG + Intergenic
1044246838 8:89958249-89958271 GCCTGGTTCCTAACAGGTGATGG + Intronic
1045883532 8:107069163-107069185 CCCCAGCACCTAACAAGTGATGG - Intergenic
1047361940 8:124177450-124177472 CCCTGGAAACTACCAAGTGAAGG - Intergenic
1047543238 8:125791056-125791078 CACTGGGACCTATCAGAGGATGG - Intergenic
1048569585 8:135640506-135640528 CCTTGACACCTATCAGGAGAGGG + Intronic
1049271589 8:141698961-141698983 CCCTGGCACCTGCGAGGTCATGG + Intergenic
1049469779 8:142770150-142770172 GCCTGGCACCAGGCAGGTGACGG + Intronic
1053008866 9:34622267-34622289 CTCTAACACCTATCAGGTGATGG + Intronic
1053575471 9:39354896-39354918 CCCTGGCACCTGTCGAGGGAGGG + Intergenic
1054097032 9:60913579-60913601 CCCTGGCACCTGTCGAGGGAGGG + Intergenic
1054118439 9:61189206-61189228 CCCTGGCACCTGTCGAGGGAGGG + Intergenic
1054589317 9:66993358-66993380 CCCTGGCACCTGTCGAGGGAGGG - Intergenic
1055405390 9:75968575-75968597 CCCTCGCACCTTCTAGGTGAGGG - Intronic
1056407789 9:86292383-86292405 CACTGGAACCTAGGAGGTGAAGG + Intronic
1057266507 9:93621262-93621284 CCCAGGCACCTAGGTGGTGAGGG + Intronic
1058686188 9:107482259-107482281 CTCTGGGACCTATCAGCTGTGGG - Intergenic
1060987316 9:127827153-127827175 CCCTGACACCCAGCATGTGATGG + Intronic
1061210057 9:129186276-129186298 CCCTGACACCTGGCAGGGGAGGG + Intergenic
1061716579 9:132522086-132522108 CCCTGGCTCCTATGAGGAGCAGG + Intronic
1203631931 Un_KI270750v1:78817-78839 ACCTGGCACCTAGAAGGTGTTGG + Intergenic
1187029028 X:15466657-15466679 ACCTGGCCCATAACAGGTGATGG + Intronic
1187886711 X:23895476-23895498 CACTGGGGCCTATCAGGGGATGG + Intronic
1188900548 X:35727773-35727795 CACTGGCACCTATCAGTGGGAGG - Intergenic
1189986079 X:46554455-46554477 CCCAGGCAACCATCAGGTGATGG - Intergenic
1193324287 X:80161507-80161529 CACTGGGGCCTGTCAGGTGAGGG - Intergenic
1194111441 X:89839251-89839273 GTCAGGCAACTATCAGGTGATGG + Intergenic
1195843733 X:109203664-109203686 CACTGGGACCTGTCAGGGGATGG - Intergenic
1200464110 Y:3494068-3494090 GTCAGGCAACTATCAGGTGATGG + Intergenic