ID: 1084177582

View in Genome Browser
Species Human (GRCh38)
Location 11:67431468-67431490
Sequence GAGTTTGCCACCAGTCTGGA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 251
Summary {0: 1, 1: 0, 2: 3, 3: 15, 4: 232}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084177582_1084177588 15 Left 1084177582 11:67431468-67431490 CCTTCCAGACTGGTGGCAAACTC 0: 1
1: 0
2: 3
3: 15
4: 232
Right 1084177588 11:67431506-67431528 TGCCTCAGTGGTATGAGTGCGGG 0: 1
1: 0
2: 1
3: 10
4: 138
1084177582_1084177585 3 Left 1084177582 11:67431468-67431490 CCTTCCAGACTGGTGGCAAACTC 0: 1
1: 0
2: 3
3: 15
4: 232
Right 1084177585 11:67431494-67431516 CTCATCCTTGAGTGCCTCAGTGG 0: 1
1: 0
2: 3
3: 16
4: 147
1084177582_1084177593 27 Left 1084177582 11:67431468-67431490 CCTTCCAGACTGGTGGCAAACTC 0: 1
1: 0
2: 3
3: 15
4: 232
Right 1084177593 11:67431518-67431540 ATGAGTGCGGGCCCAGGCAGGGG 0: 1
1: 0
2: 0
3: 14
4: 256
1084177582_1084177587 14 Left 1084177582 11:67431468-67431490 CCTTCCAGACTGGTGGCAAACTC 0: 1
1: 0
2: 3
3: 15
4: 232
Right 1084177587 11:67431505-67431527 GTGCCTCAGTGGTATGAGTGCGG 0: 1
1: 0
2: 2
3: 13
4: 177
1084177582_1084177590 21 Left 1084177582 11:67431468-67431490 CCTTCCAGACTGGTGGCAAACTC 0: 1
1: 0
2: 3
3: 15
4: 232
Right 1084177590 11:67431512-67431534 AGTGGTATGAGTGCGGGCCCAGG 0: 1
1: 0
2: 0
3: 8
4: 90
1084177582_1084177592 26 Left 1084177582 11:67431468-67431490 CCTTCCAGACTGGTGGCAAACTC 0: 1
1: 0
2: 3
3: 15
4: 232
Right 1084177592 11:67431517-67431539 TATGAGTGCGGGCCCAGGCAGGG 0: 1
1: 0
2: 3
3: 9
4: 138
1084177582_1084177591 25 Left 1084177582 11:67431468-67431490 CCTTCCAGACTGGTGGCAAACTC 0: 1
1: 0
2: 3
3: 15
4: 232
Right 1084177591 11:67431516-67431538 GTATGAGTGCGGGCCCAGGCAGG 0: 1
1: 0
2: 0
3: 6
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084177582 Original CRISPR GAGTTTGCCACCAGTCTGGA AGG (reversed) Exonic
900230683 1:1555527-1555549 GAGTGTGCCACAAGCGTGGACGG + Intronic
900824543 1:4915730-4915752 GAGTTCTCCCCCAGGCTGGAGGG + Intergenic
902135368 1:14300439-14300461 GAGTTTGAGACCAGCCTGGCTGG - Intergenic
902390117 1:16098870-16098892 GAGTTTGAGAACAGTCTGGCTGG - Intergenic
903150983 1:21408601-21408623 GAGTTTAAGACCAGTTTGGATGG + Intergenic
903215343 1:21840695-21840717 GAGTTTGAGACCAGCCTGGGAGG - Intronic
903590698 1:24453661-24453683 GAGTTTGCCTCCGGTCAGCAGGG - Intronic
903887907 1:26551644-26551666 GAGCTTGCCCTCGGTCTGGAAGG - Exonic
904067274 1:27763478-27763500 GAGTTGGAGACCAGCCTGGATGG - Intergenic
904708014 1:32406368-32406390 GGTTTTGCCACCACTCTAGAAGG + Intergenic
905321616 1:37121223-37121245 CAGTCTGCCTCCAGGCTGGAGGG - Intergenic
905904648 1:41609768-41609790 GAGTTTGCCACATGTCTAGGAGG - Intronic
908981396 1:69963406-69963428 GAGTTTTCCTTCAGGCTGGAGGG + Intronic
911635247 1:100228053-100228075 GAGTTTGAGACCAGCCTGGCTGG - Intronic
912528710 1:110304601-110304623 GAGTTTTCTCCCAGTCTTGAAGG - Intergenic
913552937 1:119934728-119934750 GAATTTCTCACCAGTGTGGATGG + Intronic
916139519 1:161682364-161682386 GAGTTTGAGACCAGCCTGGCTGG - Intergenic
916775600 1:167960507-167960529 GAGTTTGAGACCAGCCTGGCTGG - Intronic
917459923 1:175221078-175221100 GGATTTCCCACCAGACTGGAGGG + Intergenic
917565805 1:176210391-176210413 GAGTTTGAGACCAGCCTGGCTGG + Intergenic
921081318 1:211740603-211740625 GAGTTTGACACCAGGCTGACAGG - Intergenic
921121948 1:212144919-212144941 GAGTTTGAGACCAGCCTGGCTGG + Intergenic
921694360 1:218190627-218190649 GATTTTGCCACAAGGATGGATGG + Intergenic
923009279 1:230075324-230075346 GAGTTTGAGACCAGCCTGGGTGG - Intronic
1064135026 10:12743135-12743157 GAGTTTGAGACCAGCCTGGCTGG + Intronic
1065334319 10:24640564-24640586 TAGTTTTCCACCTTTCTGGAGGG - Intronic
1071661631 10:87509063-87509085 AAGTGTCCCACCAGTTTGGATGG - Intronic
1074436664 10:113440209-113440231 GAGTTGGTCACCCTTCTGGAAGG - Intergenic
1074723920 10:116288231-116288253 GACATTGCCACCAGCCTGAAAGG - Intergenic
1075397792 10:122140612-122140634 GGGTTTGGCAGCTGTCTGGAAGG + Intronic
1075492338 10:122882212-122882234 GAGTTTGAGACCAGCCTGGGTGG + Intergenic
1076121912 10:127943387-127943409 GTCTCTGCCACCAGCCTGGAAGG + Intronic
1076250138 10:128978805-128978827 GCGTTGGCCACCATGCTGGACGG - Intergenic
1077992050 11:7420805-7420827 GTGCTTCCCACCAGTCTGGTAGG + Intronic
1078422222 11:11221930-11221952 GAATTTGCCATCCTTCTGGAAGG + Intergenic
1083458830 11:62797492-62797514 GAGTTTGAGACCAGCCTGGCTGG + Intronic
1084177582 11:67431468-67431490 GAGTTTGCCACCAGTCTGGAAGG - Exonic
1084758530 11:71253416-71253438 GAGTTTTCCAGTATTCTGGAAGG + Intergenic
1086037408 11:82433311-82433333 AAGGTTGCCACCTGTCAGGATGG + Intergenic
1089318976 11:117612344-117612366 ATGTTTCCCATCAGTCTGGAAGG + Intronic
1089507547 11:118973901-118973923 GAGTTTGAGACCAGCCTGGCTGG - Intronic
1089547308 11:119238622-119238644 GAGTTTGAGACCAGCCTGGCCGG + Intronic
1090088055 11:123668667-123668689 CAGTTTGCAACCATTCTTGAAGG + Intergenic
1090364540 11:126194858-126194880 GAGTTTGAGACCAGCCTGCATGG + Intergenic
1091265924 11:134270953-134270975 GAGTCTTCCACCAGACTTGAAGG + Intergenic
1092658390 12:10712394-10712416 GAGTTTGTCACAAATCTGGCTGG - Intronic
1093035906 12:14332444-14332466 GAGGTTGCCACTACTCAGGATGG - Intergenic
1094350665 12:29521312-29521334 GAAGTAGCCACCAGTCTGGTGGG - Intronic
1097214446 12:57399194-57399216 GAGTTTGAGACCAGCCTGGCTGG + Intronic
1098910759 12:76205926-76205948 GAGTTTGGGATGAGTCTGGATGG + Intergenic
1100694523 12:97077563-97077585 GAGTTGGCCAGCAACCTGGAAGG + Intergenic
1101697275 12:107138594-107138616 GAGTCTTGCACCAGGCTGGAGGG + Intergenic
1101953299 12:109192869-109192891 GAGTTTGAGACCAGCCTGGGGGG - Intronic
1102122265 12:110450644-110450666 GAGTTCGAGACCAGCCTGGATGG + Intergenic
1102688112 12:114739947-114739969 GAGTTTGAGACCAGCCTGGCTGG + Intergenic
1103023522 12:117555389-117555411 GAATTGTCCTCCAGTCTGGAGGG - Intronic
1103879690 12:124156578-124156600 GAGTTTGAGACCAGCCTGGCCGG - Intronic
1105879610 13:24592525-24592547 GAGTTTGAGACCAGCCTTGAAGG - Intergenic
1105885186 13:24636057-24636079 GAGTTTGAGACCAGCCTGGGTGG - Intergenic
1105920229 13:24956529-24956551 GAGTTTGAGACCAGCCTTGAAGG + Intergenic
1107248787 13:38331546-38331568 GAGTTCGAGACCAGTCTGGGTGG - Intergenic
1107295280 13:38901108-38901130 GAGTTTGACACCAGCCTTGGAGG - Intergenic
1109198408 13:59404714-59404736 TAATTTGCAAACAGTCTGGAAGG + Intergenic
1110443602 13:75551228-75551250 GAGTTCGAGACCAGTCTGGCTGG + Intronic
1113113832 13:106853667-106853689 GTGTCTGGCAGCAGTCTGGATGG - Intergenic
1113127586 13:106997422-106997444 TAGTTTGCTGCCAATCTGGATGG - Intergenic
1113149692 13:107249568-107249590 GAGTTTGCCACCCTTCAGGGTGG - Intronic
1113921735 13:113917223-113917245 GACGTTGCCACCAGTGTGGAGGG + Intergenic
1114338261 14:21715196-21715218 GAGTTTGACACCAGCCTGGTCGG + Intergenic
1115155289 14:30332072-30332094 GAGTTTGAGACCAGCCTGGCCGG - Intergenic
1115345783 14:32342053-32342075 GAGTCTGGTACCAGACTGGAAGG + Intronic
1116888085 14:50239958-50239980 GAGTTCGAGACCAGCCTGGATGG - Intronic
1118185647 14:63535217-63535239 GAGTTTGAGACCAGCCTGGCTGG + Intronic
1119342907 14:73895757-73895779 GAGTTTGAGACCAGCCTGGCTGG + Intronic
1120154634 14:81079644-81079666 GAGTTTGAGACCAGCCTGGGCGG + Intronic
1121652193 14:95566741-95566763 GAGTTTGAGACCAGCCTGGCTGG + Intergenic
1121763789 14:96468029-96468051 GAGTTTGAGACCAGCCTGGGTGG + Intronic
1122682835 14:103479236-103479258 GAGTTTGAGACCAGCCTGGCTGG - Intronic
1123043926 14:105502354-105502376 GAGTTTGGGACCAGCCTGGGCGG - Intergenic
1123878802 15:24654419-24654441 GAATTTGCCCACAGTGTGGAGGG + Intergenic
1124384738 15:29197379-29197401 GAGTTTGAGACCAGCCTGGCTGG + Intronic
1124607552 15:31181546-31181568 GAGTTCGAGATCAGTCTGGACGG - Intergenic
1125985832 15:44050861-44050883 GAGTTTGAGACCAGCCTGGCCGG - Intronic
1128165911 15:65464474-65464496 GAGTTTGTGACCAGCCTGGGTGG + Intronic
1128372726 15:67052199-67052221 GAGTTTGAGACCAGCCTGGCCGG + Intergenic
1130348852 15:83072697-83072719 GAGTTTGAGACCAGCCTGGCCGG + Intergenic
1130686844 15:86045450-86045472 GAGTTTGCAAACTTTCTGGAAGG + Intergenic
1131431389 15:92392133-92392155 GAGTTTCCCATCAGTGTGGCTGG - Intergenic
1131726487 15:95231426-95231448 GATTTTGCCACATTTCTGGAAGG + Intergenic
1134899846 16:17927589-17927611 GATTTGGCCATCAGTCTGGAGGG + Intergenic
1136843421 16:33557047-33557069 GAGTTTGAGACCAGCCTGGGCGG + Intergenic
1139460338 16:67117254-67117276 GAGTTTGAGACCAGCCTGGCCGG - Intronic
1141356999 16:83356348-83356370 GAGGTTACCACCAGTAAGGATGG - Intronic
1141993802 16:87624541-87624563 GAATCTGCCACCACTCAGGATGG + Intronic
1142426631 16:90005079-90005101 GGGTTTGCCAGCAGTGCGGAGGG + Exonic
1203148582 16_KI270728v1_random:1819164-1819186 GAGTTTGAGACCAGCCTGGGCGG + Intergenic
1203153586 16_KI270728v1_random:1857345-1857367 GAGTTTGAGACCAGCCTGGGCGG + Intergenic
1142590983 17:1006018-1006040 GAGTTGGACCCCAGGCTGGAGGG + Exonic
1142628025 17:1204237-1204259 GAGTTCGAGACCAGCCTGGACGG + Intronic
1142768920 17:2082621-2082643 GAATGTGCCACCAGCCTGGCAGG - Intronic
1142872760 17:2831683-2831705 GAGTTTGAGACCAGCCTGGTGGG + Intronic
1142995893 17:3760260-3760282 GAGATTGCCATCATCCTGGATGG - Exonic
1143280679 17:5752036-5752058 GGTTTGGCCACCAGTCTTGATGG + Intergenic
1144088197 17:11829676-11829698 GAGTTTGAGACCAGCCTGGCCGG - Intronic
1144571431 17:16402127-16402149 GAGTTAGACATCAGTCTGGGTGG + Intergenic
1144595248 17:16564406-16564428 GAGTTTGAGACCAGCCTGGGTGG - Intronic
1144812887 17:18012032-18012054 GAGTTTGAGACCAGCCTGGCCGG - Intronic
1146176953 17:30671252-30671274 GAGTTCGAGACCAGCCTGGAGGG + Intergenic
1146222601 17:31037766-31037788 GAGTTCGAGACCAGCCTGGAGGG + Intergenic
1146342392 17:32032243-32032265 GAGTTCGAGACCAGCCTGGAGGG - Intronic
1146350415 17:32087353-32087375 GAGTTCGAGACCAGCCTGGAGGG + Intergenic
1147913134 17:43869724-43869746 GAGTTTGAGACCAGCCTGGCCGG + Intergenic
1148070038 17:44903433-44903455 GACTTTTCCACCAGGCTGGCAGG + Exonic
1148172912 17:45538347-45538369 GAGTTTGAGACCAGCCTGGAGGG + Intergenic
1148276355 17:46307103-46307125 GAGTTCGAGACCAGCCTGGAGGG - Intronic
1148298472 17:46524678-46524700 GAGTTCGAGACCAGCCTGGAGGG - Intronic
1148363010 17:47029154-47029176 GAGTTCGAGACCAGCCTGGAGGG - Intronic
1149206584 17:54254591-54254613 GAGTTTGGGACCAGCCTGGCCGG - Intergenic
1149489142 17:57069505-57069527 GAGTTTGAGACCAGGCTGGCTGG - Intergenic
1149837493 17:59926535-59926557 GAGTTTTCCACCAGTCTGAAAGG - Exonic
1150081853 17:62247031-62247053 GAGTTTTCCACCAGTCTGAAAGG + Intergenic
1150404118 17:64885270-64885292 GAGTTCGAGACCAGCCTGGAGGG + Intronic
1150783602 17:68143970-68143992 GAGTTCGAGACCAGCCTGGAGGG + Intergenic
1152192817 17:78898941-78898963 GAGTTTGAGACCAGCCTGGCCGG - Intronic
1153140285 18:1964483-1964505 GACTTTTGCACCATTCTGGAGGG - Intergenic
1156250812 18:35351071-35351093 GAGTTTGAGACCAGCCTGGCTGG - Intergenic
1157125446 18:44951831-44951853 GAGTTGGCCATCAGTCTGGGTGG - Exonic
1157907516 18:51582809-51582831 GAGTTTGAGACCAGCCTGGGTGG + Intergenic
1161985253 19:7649839-7649861 GAGTTTGAGACCAGCCTGGGCGG + Intergenic
1162068764 19:8141471-8141493 GGTTTTGCCAGCAGCCTGGATGG - Intronic
1162073563 19:8169593-8169615 GAGTTTGAGACCAGCCTGGGTGG + Intronic
1162559834 19:11410474-11410496 GAGTTTGAGACCAGCCTGGGCGG + Intronic
1163119391 19:15207871-15207893 GAGTTTGAGACCAGCCTGGACGG - Intergenic
1163613029 19:18310755-18310777 GACCTTGCCCCCAGGCTGGAGGG - Intronic
1163731029 19:18949253-18949275 CAGTTAGCCCCCAGTCTGGGAGG - Intergenic
1163808537 19:19415649-19415671 CACTTTGTCACCAGGCTGGAGGG + Intronic
1165386080 19:35511386-35511408 GAGTTTGGCACCTCTGTGGAAGG - Intronic
1167496083 19:49819268-49819290 GAGTTTGTCACCTGGCTCGATGG + Exonic
1167642863 19:50691377-50691399 GAGGTTGCCTCCAGTGAGGAAGG - Intronic
927768920 2:25841090-25841112 GAGTTTGAGACCGGCCTGGATGG + Intronic
928674771 2:33639541-33639563 GAGTTTGAGACCAGCCTGGGTGG + Intergenic
930376239 2:50570681-50570703 TTGTTTTCCTCCAGTCTGGATGG - Intronic
931734313 2:65180162-65180184 GAGTTTGAGACCAGCCTGGCAGG - Intergenic
932000296 2:67878741-67878763 GAGCTTCCCAACAGTATGGAGGG - Intergenic
933770581 2:85741633-85741655 CAGTTGGCCACCAATCTGGCTGG - Intergenic
934934805 2:98457350-98457372 GAGTTTGATACCAGCCTGGTCGG + Intronic
935195743 2:100814694-100814716 GACTTTGGCAACAGACTGGATGG - Intergenic
936331892 2:111554178-111554200 GGGTTTGAGACCAGCCTGGAGGG - Intergenic
937111739 2:119371918-119371940 CAGTTTCCTACCTGTCTGGAGGG + Intronic
940361697 2:152803102-152803124 GTGTGTTCTACCAGTCTGGAAGG + Intergenic
942106511 2:172639069-172639091 GAGTTTGAGACCAGTCTGCACGG - Intergenic
944438634 2:199718739-199718761 GCGTCTTACACCAGTCTGGATGG - Intergenic
946171951 2:217900785-217900807 GAGTGTGCCCTCAGTGTGGATGG - Intronic
946438657 2:219676619-219676641 GGGTTTGCCAACCATCTGGAAGG + Intergenic
946448664 2:219761364-219761386 AAGTTTCTCAGCAGTCTGGAGGG + Intergenic
947587989 2:231368828-231368850 GAGTTCGCGACCAGCCTGGCCGG - Intronic
948177232 2:235953722-235953744 GAGTTTGAGACCAGCCTGGGAGG + Intronic
1169056699 20:2627960-2627982 GAGTTTGAGACCAGCCTGGCCGG + Intronic
1169706685 20:8514135-8514157 GAGTTTGAAACCAGCCTGGGTGG + Intronic
1172634382 20:36400233-36400255 GAGTTGGTCACCATTTTGGAAGG + Intronic
1174815904 20:53686728-53686750 GAGTTTGAGACCAGCCTGGTTGG + Intergenic
1178884678 21:36475875-36475897 GAGTTTGAGACCAGCCTAGACGG - Intronic
1178945985 21:36948082-36948104 GAGTTCGAAACCAGCCTGGATGG + Exonic
1182460237 22:30478383-30478405 GAGTTTGAGACCAGCCTGGGCGG + Intergenic
1182518469 22:30871985-30872007 GAGTTTCCCAGCAGTCGGGAAGG - Intronic
1184179461 22:42810260-42810282 GAGTTTGAGACCAGCCTGGCTGG + Intronic
1184863767 22:47191473-47191495 GTGTTTGCCTCCAGTTTGGCTGG + Intergenic
951661130 3:25067929-25067951 GAGTTTGAGACCAGGCTGGCCGG + Intergenic
954265029 3:49465219-49465241 GAGTTTGAGACCAGCCTGGCTGG + Intergenic
955375226 3:58389614-58389636 GAGTTTGAGACCAGCCTGGGTGG + Intronic
960819026 3:121707191-121707213 CACTTTGTCACCAGGCTGGAGGG - Intronic
961265688 3:125640456-125640478 GAGTTTGAGACCAGCCTGGCCGG + Intergenic
961992198 3:131204156-131204178 GAGTTTGCCCAGATTCTGGATGG + Intronic
962588915 3:136869030-136869052 GAGTTTGAGACCAGCCTGGCCGG + Intronic
962876215 3:139538023-139538045 GAGTTTCCCACCCTTGTGGAAGG + Intronic
963288755 3:143465074-143465096 GACTTGGCCACCAGCCAGGAGGG - Intronic
963384371 3:144571981-144572003 GAATTTGCAACGATTCTGGAAGG + Intergenic
965822823 3:172701669-172701691 GAGTTTGAGACCAGCCTGGCCGG - Intronic
968550315 4:1219738-1219760 GAGTTAGAAACCAGCCTGGATGG - Intronic
968558129 4:1260840-1260862 GAGTTTGACACGAGTCTAGCCGG - Intergenic
969870724 4:10102963-10102985 GAGTGGGCCACCATTCTAGAAGG + Intronic
971414149 4:26408078-26408100 GAGTTTGAGATCAGCCTGGACGG - Intronic
971529274 4:27663925-27663947 GAGTTTGAGACCAGCCTGGCTGG + Intergenic
971883814 4:32415648-32415670 GAGTTTGAGACCAGCCTGGCTGG - Intergenic
972523611 4:39885707-39885729 GAGTTCGAGACCAGCCTGGACGG + Intronic
975392580 4:73836615-73836637 GAGTTTCCTGCCAGTCGGGAGGG + Exonic
976446937 4:85140779-85140801 GAGTCTCCCACACGTCTGGATGG + Intergenic
977291284 4:95167592-95167614 GAATTTGCAACCAGTCAGGAAGG + Exonic
978513230 4:109544060-109544082 GAGTTTGAGACCAGCCTGGGCGG + Intergenic
982379727 4:154736742-154736764 CACTCTGCCACCAGGCTGGAGGG - Intronic
983494667 4:168429353-168429375 GAGTTCGACACCAGCCTGGCTGG - Intronic
986711272 5:10489567-10489589 GAGTTTGAGACCAGCCTGGGCGG + Intergenic
991562189 5:67965552-67965574 GAATTTTGCCCCAGTCTGGAGGG - Intergenic
992632176 5:78692192-78692214 GAGTTTGAGACCAGCCTGGCTGG + Intronic
994466695 5:100143497-100143519 AAGTTTGCTAACAGTCTGCATGG + Intergenic
998805907 5:145917811-145917833 CACTTTGTCACCAGGCTGGAGGG + Intergenic
998890663 5:146742339-146742361 GAGACTGCCAACACTCTGGATGG + Intronic
1000118123 5:158172288-158172310 GATTTTGCCACAAGTCTTCAAGG - Intergenic
1002963228 6:1937160-1937182 GAGTGTTCCACAAGCCTGGATGG - Intronic
1004491182 6:16117795-16117817 GAATTTGGCATCAGTCAGGAAGG + Intergenic
1005155657 6:22803151-22803173 GAATTTTCCACCAGTCTGGATGG + Intergenic
1005589794 6:27311873-27311895 AACTTTCCCACCAGTCTGAAGGG + Exonic
1006126852 6:31844465-31844487 GAGTTTGAGACCAGTCTGCCTGG + Intergenic
1008709257 6:54203789-54203811 GAGTTTGAGACCAGCCTGGCCGG - Intronic
1009474078 6:64066054-64066076 GAGTTTGAGACCAGCCTGGCCGG + Intronic
1009814338 6:68711282-68711304 CAGTTTTCCAGCATTCTGGAAGG - Intronic
1010051363 6:71508015-71508037 GAGTTTGAGACCAGCCTGGGCGG + Intergenic
1013229018 6:108144627-108144649 GAGTTTGAGACCAGCCTGGGTGG - Intronic
1014492155 6:122075825-122075847 GAATTTGCCAGCACTTTGGAAGG - Intergenic
1014682678 6:124451987-124452009 GAGTTTGAGACCAGCCTGGGAGG + Intronic
1016371020 6:143374235-143374257 GAGTTTGCCACCTGTCCTGCAGG - Intergenic
1017429800 6:154359829-154359851 GAGTTTGAGACCAGTCTGGCCGG - Intronic
1018998275 6:168726608-168726630 GAGTTTGCTCCCAGTCTGTTTGG + Intergenic
1022014690 7:26339298-26339320 AAGTTTGAGACCAGTCTGGGCGG - Intronic
1022424139 7:30251911-30251933 GAGGTTGTCACTAGGCTGGATGG + Intergenic
1022722065 7:32950319-32950341 CACTCTGCCACCAGGCTGGATGG - Intergenic
1025005749 7:55353322-55353344 GAGTTTGAGACCAGCCTGGCTGG + Intergenic
1028848351 7:95508523-95508545 GGGTTTCCGAGCAGTCTGGAGGG + Intronic
1030055920 7:105583461-105583483 GCGCTGGCCACCAGTCAGGAAGG + Intronic
1030655377 7:112161926-112161948 GAAGTTGAAACCAGTCTGGATGG - Intronic
1036925963 8:12906188-12906210 GAGTTTGAGACCAGCCTGGGTGG + Intergenic
1038752411 8:30307789-30307811 GTGGTTGCCAGCAGTCTGGGAGG - Intergenic
1039304643 8:36248331-36248353 GAGTTTGAGACCAGCCTGGATGG + Intergenic
1040016210 8:42702338-42702360 GAGTTTGAGACCAGCCTGGGTGG - Intronic
1045106781 8:98900284-98900306 GAGTTTGAGACCAGCCTGGCTGG - Intronic
1045135189 8:99209247-99209269 CAGTCTGTCACCAGGCTGGATGG - Intronic
1047410897 8:124623847-124623869 GAGTTTGAGACCAGCCTGGCTGG - Intronic
1048338000 8:133517300-133517322 GAGTTATCCACCAGTTTGGTGGG - Intronic
1049491601 8:142906511-142906533 GGGTTGGCCACCAGACTGGGGGG + Intronic
1050531040 9:6589630-6589652 GAGTTTGTGACCAGCCTGGGCGG - Intronic
1050857098 9:10373036-10373058 GAGTTTGAGACCAGTCTGGTTGG - Intronic
1054783000 9:69183291-69183313 GAATTTTCCATCACTCTGGAAGG + Intronic
1057371176 9:94474565-94474587 GAGTTTGAGACCAGCCTGGGCGG - Intergenic
1057730225 9:97602102-97602124 GTGTTTGCCACCAGGGTAGAAGG + Exonic
1058763128 9:108155678-108155700 TAGTTTTTCACCAGTATGGAAGG - Intergenic
1059353201 9:113680333-113680355 GAGTTTGCAACCAATCTCGAGGG + Intergenic
1060170673 9:121458591-121458613 CATTCTGCCACCAGGCTGGAGGG - Intergenic
1060841388 9:126795909-126795931 AAAAGTGCCACCAGTCTGGATGG + Intergenic
1060883912 9:127137265-127137287 GAGTGGGCCACTAGTCTGGAGGG - Intronic
1061184774 9:129046416-129046438 GAGTTTGAGACCAGCCTGGGTGG + Intronic
1061553919 9:131354502-131354524 GAGTTTGAGACCAGCCTGGTGGG - Intergenic
1189184453 X:39041222-39041244 GAGATTGCCAGCCTTCTGGAAGG + Intergenic
1190327060 X:49212980-49213002 AAGGTGGCCACCATTCTGGAGGG + Exonic
1192443542 X:71193100-71193122 GAGTTTGAGACCAGCCTGGCTGG - Intergenic
1193116689 X:77782541-77782563 GAGTTTGAGACCAGCCTGGCTGG + Intronic
1195035090 X:100965143-100965165 GTGTGGGCCACCACTCTGGAAGG + Intergenic
1196726885 X:118903651-118903673 GAGCTTGAGACCAGTCTGGGGGG + Intergenic
1197012764 X:121587286-121587308 GAGTTTGAGACCAGCCTGGCTGG - Intergenic
1198949689 X:142056545-142056567 AAGTTTTCCAGCAGTGTGGATGG + Intergenic
1200069098 X:153518989-153519011 GACTTGGGCACCAGTCTGGCAGG + Intronic
1201621418 Y:15962862-15962884 GAGTTTACCACCATTCAGGAGGG + Intergenic