ID: 1084179322

View in Genome Browser
Species Human (GRCh38)
Location 11:67438650-67438672
Sequence GGGTATGCACGCGCAGGCAG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 78}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084179322_1084179340 25 Left 1084179322 11:67438650-67438672 CCCCTGCCTGCGCGTGCATACCC 0: 1
1: 0
2: 0
3: 2
4: 78
Right 1084179340 11:67438698-67438720 GGTGGCATCAGCAGCAGTGGTGG 0: 1
1: 0
2: 17
3: 70
4: 538
1084179322_1084179334 3 Left 1084179322 11:67438650-67438672 CCCCTGCCTGCGCGTGCATACCC 0: 1
1: 0
2: 0
3: 2
4: 78
Right 1084179334 11:67438676-67438698 CTCTGGCCAGGCTGCCGCTGGGG 0: 1
1: 0
2: 6
3: 44
4: 354
1084179322_1084179333 2 Left 1084179322 11:67438650-67438672 CCCCTGCCTGCGCGTGCATACCC 0: 1
1: 0
2: 0
3: 2
4: 78
Right 1084179333 11:67438675-67438697 GCTCTGGCCAGGCTGCCGCTGGG 0: 1
1: 0
2: 3
3: 26
4: 254
1084179322_1084179335 4 Left 1084179322 11:67438650-67438672 CCCCTGCCTGCGCGTGCATACCC 0: 1
1: 0
2: 0
3: 2
4: 78
Right 1084179335 11:67438677-67438699 TCTGGCCAGGCTGCCGCTGGGGG 0: 1
1: 0
2: 2
3: 34
4: 266
1084179322_1084179339 22 Left 1084179322 11:67438650-67438672 CCCCTGCCTGCGCGTGCATACCC 0: 1
1: 0
2: 0
3: 2
4: 78
Right 1084179339 11:67438695-67438717 GGGGGTGGCATCAGCAGCAGTGG 0: 1
1: 0
2: 5
3: 68
4: 504
1084179322_1084179332 1 Left 1084179322 11:67438650-67438672 CCCCTGCCTGCGCGTGCATACCC 0: 1
1: 0
2: 0
3: 2
4: 78
Right 1084179332 11:67438674-67438696 GGCTCTGGCCAGGCTGCCGCTGG 0: 1
1: 0
2: 6
3: 45
4: 500
1084179322_1084179341 28 Left 1084179322 11:67438650-67438672 CCCCTGCCTGCGCGTGCATACCC 0: 1
1: 0
2: 0
3: 2
4: 78
Right 1084179341 11:67438701-67438723 GGCATCAGCAGCAGTGGTGGTGG 0: 1
1: 0
2: 15
3: 93
4: 693
1084179322_1084179328 -9 Left 1084179322 11:67438650-67438672 CCCCTGCCTGCGCGTGCATACCC 0: 1
1: 0
2: 0
3: 2
4: 78
Right 1084179328 11:67438664-67438686 TGCATACCCCGGCTCTGGCCAGG 0: 1
1: 0
2: 0
3: 13
4: 120
1084179322_1084179336 7 Left 1084179322 11:67438650-67438672 CCCCTGCCTGCGCGTGCATACCC 0: 1
1: 0
2: 0
3: 2
4: 78
Right 1084179336 11:67438680-67438702 GGCCAGGCTGCCGCTGGGGGTGG 0: 1
1: 0
2: 8
3: 74
4: 609

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084179322 Original CRISPR GGGTATGCACGCGCAGGCAG GGG (reversed) Exonic
900294968 1:1944180-1944202 GCGTGTGCACAGGCAGGCAGCGG + Intronic
900294986 1:1944256-1944278 GCGTGTGCACAGGCAGGCAGCGG + Intronic
900384115 1:2401519-2401541 GTGTCTGCACGGGTAGGCAGAGG + Intronic
900956768 1:5890933-5890955 GGGTCTGCACGGCCAGGTAGCGG + Exonic
901815539 1:11791426-11791448 GGGAGTGGAGGCGCAGGCAGAGG - Intronic
904374046 1:30068626-30068648 GGGTCTGCAGGCAGAGGCAGAGG + Intergenic
904883051 1:33714988-33715010 GGGGAAGCACGGGGAGGCAGAGG + Intronic
905300872 1:36985485-36985507 GGGGCTGCAAGAGCAGGCAGTGG + Intronic
906938699 1:50236840-50236862 GGGGATGCTGGCCCAGGCAGAGG - Intergenic
908702846 1:66920667-66920689 GAGTGTGCAGGCGCTGGCAGGGG - Intronic
917713392 1:177710024-177710046 GAGTATGTATGGGCAGGCAGTGG - Intergenic
1067432491 10:46253252-46253274 GGATATGCAGGGACAGGCAGGGG + Intergenic
1068378252 10:56212986-56213008 GGGTATGCATGCTCTAGCAGTGG + Intergenic
1077349654 11:2086568-2086590 GGGACTGCACTGGCAGGCAGTGG + Intergenic
1084179322 11:67438650-67438672 GGGTATGCACGCGCAGGCAGGGG - Exonic
1084599645 11:70137330-70137352 GGGCAGGCAGGGGCAGGCAGGGG - Intronic
1084599649 11:70137340-70137362 GGGCAGGCAGGGGCAGGCAGGGG - Intronic
1090912132 11:131130265-131130287 GGGAATGTAGGGGCAGGCAGTGG + Intergenic
1091301503 11:134510781-134510803 GGGTGAGCAGGGGCAGGCAGGGG - Intergenic
1092341373 12:7679265-7679287 GGCTGTGCACGCCCAGGCTGGGG - Intergenic
1100158242 12:91827174-91827196 TGGCATGCACACACAGGCAGAGG - Intergenic
1104831566 12:131755898-131755920 GGGCGTGCAGGCACAGGCAGAGG - Intronic
1108228876 13:48317811-48317833 GCGTGTGCACGCGGAGTCAGTGG - Intronic
1117424372 14:55580095-55580117 GGGCAGGCGCGCGGAGGCAGAGG + Intronic
1121325607 14:93018023-93018045 GGGGTTGCAGGGGCAGGCAGCGG - Intronic
1123842877 15:24267166-24267188 GGATATGCAGGAGCATGCAGAGG - Intergenic
1123852435 15:24373153-24373175 GGATATGCAGGAGCATGCAGAGG - Intergenic
1123857914 15:24433192-24433214 GGATATGCAGGAGCATGCAGAGG - Intergenic
1123862547 15:24483737-24483759 GGATATGCAGGAGCATGCAGAGG - Intergenic
1132318633 15:100909038-100909060 GGGTTTGCACGCGCATGGAGGGG - Intronic
1132318644 15:100909101-100909123 GGGTTTGCACACGCACGGAGGGG - Intronic
1133825837 16:9277634-9277656 GGGTATGCAAGCAGAGGCTGAGG - Intergenic
1136238791 16:28931942-28931964 GGGGATGCTGGGGCAGGCAGGGG - Exonic
1144787666 17:17840782-17840804 GGATATGCAGGGCCAGGCAGGGG - Intergenic
1148775153 17:50091069-50091091 GGGGAGGGACGAGCAGGCAGAGG + Intergenic
1152512789 17:80801863-80801885 GGCTGTGCTCGGGCAGGCAGGGG - Intronic
1155779382 18:29811764-29811786 GGGTATGCGCTCACTGGCAGGGG - Intergenic
1161579557 19:5073341-5073363 GGGGATGCAGGCGCAGCCTGGGG + Intronic
1163504774 19:17699125-17699147 GGGAATGAACAAGCAGGCAGAGG + Intergenic
1163821753 19:19500032-19500054 GCGGATGCCCGCACAGGCAGGGG - Intronic
927000873 2:18792942-18792964 GTGTGTGCACGCGCGCGCAGTGG - Intergenic
929795572 2:45055996-45056018 GGGGAGGCAGGGGCAGGCAGAGG + Intergenic
936125699 2:109787644-109787666 GGGTCTGCATGCGAGGGCAGGGG + Intergenic
936218994 2:110583824-110583846 GGGTCTGCATGCGAGGGCAGGGG - Intergenic
945100372 2:206257615-206257637 GGACATGCACGCTTAGGCAGCGG + Intergenic
948827480 2:240579639-240579661 GGGTGTCCACTCCCAGGCAGGGG - Exonic
1177894450 21:26843797-26843819 CAGGATGCACGCACAGGCAGCGG + Intronic
1179116200 21:38494817-38494839 GTGCATGCACACACAGGCAGAGG + Intronic
1180048902 21:45322409-45322431 GGGTAGGCAGGTGCAGGAAGGGG - Intergenic
1180089610 21:45527287-45527309 GGGTATGCCCGGGCAGGCCCTGG + Intronic
1183272145 22:36868842-36868864 GGGTATGCAAGCACAGGATGGGG - Intronic
1183740449 22:39665901-39665923 GGGTGTCCACGCCCAGACAGTGG - Exonic
1184347773 22:43923989-43924011 GGGCGTGCTCGCTCAGGCAGCGG - Exonic
1185198810 22:49489961-49489983 GGGGAGTCACGCCCAGGCAGTGG - Intronic
950495893 3:13334427-13334449 GTGTGTGCATGTGCAGGCAGGGG + Intronic
954187697 3:48931463-48931485 GGGTGTGAACCCGCGGGCAGAGG + Intronic
954426693 3:50447151-50447173 GGGGATCCACTAGCAGGCAGGGG + Intronic
961684196 3:128618104-128618126 GGGTATGCACCCTCCCGCAGGGG + Intergenic
969276956 4:6142310-6142332 ATGTATGCCCGCACAGGCAGGGG + Intronic
972773756 4:42222650-42222672 GGGGATGCAAGCCCAGGGAGGGG + Intergenic
982395417 4:154910526-154910548 GGGTATGCACGCCTAGGCTGAGG - Intergenic
991178481 5:63719996-63720018 AGCTATGCACGTGAAGGCAGGGG - Intergenic
991994404 5:72372967-72372989 GGGTATGCATAGGAAGGCAGTGG + Intergenic
992162503 5:74016665-74016687 GGGTGAGCAGGAGCAGGCAGAGG - Intergenic
994670286 5:102755225-102755247 GGCTGAGCACGCGGAGGCAGCGG - Intronic
995402553 5:111758204-111758226 GTGTGTGCACGCGCAGCCACAGG - Intronic
1002193997 5:177492483-177492505 GGGTGCGCCCGCGCTGGCAGTGG - Intronic
1003427511 6:6007466-6007488 GGGTAGGCAAGCGCAGGGGGCGG - Intronic
1011129080 6:84035651-84035673 GGGTATGAACACTCACGCAGAGG - Intronic
1019731002 7:2629671-2629693 GGGTACACACATGCAGGCAGGGG - Intergenic
1019778607 7:2926840-2926862 GTGTGTGCACACGCAGGCAAGGG + Intronic
1022633712 7:32110949-32110971 GGGAATGCAAGGGGAGGCAGTGG + Intronic
1024623813 7:51187552-51187574 AGGTAAGCATGGGCAGGCAGAGG + Intronic
1029022402 7:97378486-97378508 GGGTCTGCACGGGGAGGCCGAGG - Intergenic
1029409192 7:100397943-100397965 GGGGGTGCATGTGCAGGCAGTGG + Intronic
1039968156 8:42298900-42298922 GCGAATGCAGGGGCAGGCAGTGG - Intronic
1042184636 8:66124436-66124458 GGGCATGCACAGGCATGCAGGGG - Intergenic
1049470799 8:142774253-142774275 GGGGATGCGCGCACAGGCTGGGG - Intronic
1061139363 9:128755172-128755194 GGGTGTGCACGTGAAGGCATGGG - Intronic
1062009918 9:134261415-134261437 GGGTTTGCAGCCCCAGGCAGGGG - Intergenic
1062232041 9:135487170-135487192 GCGTGTGCACACGCAGCCAGAGG + Exonic