ID: 1084179658

View in Genome Browser
Species Human (GRCh38)
Location 11:67440018-67440040
Sequence CAGGAAACCTTGCGCCAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 266
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 251}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084179658 Original CRISPR CAGGAAACCTTGCGCCAGGG AGG (reversed) Intronic