ID: 1084181828

View in Genome Browser
Species Human (GRCh38)
Location 11:67450776-67450798
Sequence GGCCCTGGTGAACCACAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084181828_1084181833 -5 Left 1084181828 11:67450776-67450798 CCAGCTTGTGGTTCACCAGGGCC No data
Right 1084181833 11:67450794-67450816 GGGCCTTAGGCTCCTGCTTGGGG No data
1084181828_1084181832 -6 Left 1084181828 11:67450776-67450798 CCAGCTTGTGGTTCACCAGGGCC No data
Right 1084181832 11:67450793-67450815 AGGGCCTTAGGCTCCTGCTTGGG No data
1084181828_1084181842 29 Left 1084181828 11:67450776-67450798 CCAGCTTGTGGTTCACCAGGGCC No data
Right 1084181842 11:67450828-67450850 TGGGAGGCCCCCTTCTCTTCAGG No data
1084181828_1084181840 13 Left 1084181828 11:67450776-67450798 CCAGCTTGTGGTTCACCAGGGCC No data
Right 1084181840 11:67450812-67450834 TGGGGCTGGTGGCTCCTGGGAGG No data
1084181828_1084181838 9 Left 1084181828 11:67450776-67450798 CCAGCTTGTGGTTCACCAGGGCC No data
Right 1084181838 11:67450808-67450830 TGCTTGGGGCTGGTGGCTCCTGG No data
1084181828_1084181836 2 Left 1084181828 11:67450776-67450798 CCAGCTTGTGGTTCACCAGGGCC No data
Right 1084181836 11:67450801-67450823 AGGCTCCTGCTTGGGGCTGGTGG No data
1084181828_1084181835 -1 Left 1084181828 11:67450776-67450798 CCAGCTTGTGGTTCACCAGGGCC No data
Right 1084181835 11:67450798-67450820 CTTAGGCTCCTGCTTGGGGCTGG No data
1084181828_1084181831 -7 Left 1084181828 11:67450776-67450798 CCAGCTTGTGGTTCACCAGGGCC No data
Right 1084181831 11:67450792-67450814 CAGGGCCTTAGGCTCCTGCTTGG No data
1084181828_1084181839 10 Left 1084181828 11:67450776-67450798 CCAGCTTGTGGTTCACCAGGGCC No data
Right 1084181839 11:67450809-67450831 GCTTGGGGCTGGTGGCTCCTGGG No data
1084181828_1084181843 30 Left 1084181828 11:67450776-67450798 CCAGCTTGTGGTTCACCAGGGCC No data
Right 1084181843 11:67450829-67450851 GGGAGGCCCCCTTCTCTTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084181828 Original CRISPR GGCCCTGGTGAACCACAAGC TGG (reversed) Intergenic
No off target data available for this crispr