ID: 1084182280

View in Genome Browser
Species Human (GRCh38)
Location 11:67452733-67452755
Sequence TCCGTGTCCAGCAGGACTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 138}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084182280_1084182288 22 Left 1084182280 11:67452733-67452755 CCCAGAGTCCTGCTGGACACGGA 0: 1
1: 0
2: 0
3: 9
4: 138
Right 1084182288 11:67452778-67452800 ATGGTGTGAATGACCGAGTATGG 0: 1
1: 0
2: 0
3: 2
4: 63
1084182280_1084182286 3 Left 1084182280 11:67452733-67452755 CCCAGAGTCCTGCTGGACACGGA 0: 1
1: 0
2: 0
3: 9
4: 138
Right 1084182286 11:67452759-67452781 GGTGCCTGGTGAATCAATGATGG 0: 1
1: 0
2: 1
3: 19
4: 121
1084182280_1084182289 23 Left 1084182280 11:67452733-67452755 CCCAGAGTCCTGCTGGACACGGA 0: 1
1: 0
2: 0
3: 9
4: 138
Right 1084182289 11:67452779-67452801 TGGTGTGAATGACCGAGTATGGG 0: 1
1: 0
2: 0
3: 6
4: 43

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084182280 Original CRISPR TCCGTGTCCAGCAGGACTCT GGG (reversed) Intronic