ID: 1084182280

View in Genome Browser
Species Human (GRCh38)
Location 11:67452733-67452755
Sequence TCCGTGTCCAGCAGGACTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 138}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084182280_1084182289 23 Left 1084182280 11:67452733-67452755 CCCAGAGTCCTGCTGGACACGGA 0: 1
1: 0
2: 0
3: 9
4: 138
Right 1084182289 11:67452779-67452801 TGGTGTGAATGACCGAGTATGGG 0: 1
1: 0
2: 0
3: 6
4: 43
1084182280_1084182288 22 Left 1084182280 11:67452733-67452755 CCCAGAGTCCTGCTGGACACGGA 0: 1
1: 0
2: 0
3: 9
4: 138
Right 1084182288 11:67452778-67452800 ATGGTGTGAATGACCGAGTATGG 0: 1
1: 0
2: 0
3: 2
4: 63
1084182280_1084182286 3 Left 1084182280 11:67452733-67452755 CCCAGAGTCCTGCTGGACACGGA 0: 1
1: 0
2: 0
3: 9
4: 138
Right 1084182286 11:67452759-67452781 GGTGCCTGGTGAATCAATGATGG 0: 1
1: 0
2: 1
3: 19
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084182280 Original CRISPR TCCGTGTCCAGCAGGACTCT GGG (reversed) Intronic
900032353 1:380902-380924 TCCGTTTCCAGAATCACTCTTGG - Intergenic
900052904 1:609088-609110 TCCGTTTCCAGAATCACTCTTGG - Intergenic
900220567 1:1507078-1507100 CCCGCGCCCAGCAGGATTCTAGG + Intergenic
900234690 1:1582537-1582559 TCCCTTTCCCCCAGGACTCTTGG + Intergenic
901221399 1:7585929-7585951 TCTGTGTCCCCCAGGACCCTGGG + Intronic
904407209 1:30300146-30300168 CCAGGGTCCATCAGGACTCTGGG + Intergenic
910028028 1:82681717-82681739 TCCGTGTACAACAGGTCTTTTGG - Intergenic
910072076 1:83228948-83228970 TATGTGTCCATCAGAACTCTTGG - Intergenic
910531448 1:88240907-88240929 TCTGTCTTCACCAGGACTCTAGG + Intergenic
913113899 1:115679522-115679544 TCTGTCTCCAGCAGGGCTCCCGG - Intronic
913710089 1:121474029-121474051 TCTGTGTCCTGCAAGTCTCTAGG + Intergenic
919103475 1:193121871-193121893 TCCGTGCCCAGCTGAAGTCTGGG + Intergenic
919200008 1:194344079-194344101 TCCGTGTTCATCAGAGCTCTTGG + Intergenic
920081349 1:203375679-203375701 TGCGTCTCCATCAGAACTCTTGG + Intergenic
920198099 1:204242963-204242985 CCCCTGCCCAGCTGGACTCTGGG - Intronic
1068840919 10:61613033-61613055 TCGGAGTTGAGCAGGACTCTAGG - Intergenic
1071099914 10:82023778-82023800 TCCATGTCCATCAGGAGTATTGG + Intronic
1071439200 10:85675708-85675730 TCAATGTCCAGCAGGACCCCTGG + Intronic
1073117403 10:101099321-101099343 TGGGTCTCCAGCAGGACTCTGGG - Intronic
1075655747 10:124160022-124160044 TCTGTGTCCAGCAGGCTTCTTGG - Intergenic
1078162957 11:8857677-8857699 TCAGAATCCAGGAGGACTCTGGG - Intronic
1078643174 11:13114768-13114790 TCTGAGTCCAGCTGCACTCTAGG + Intergenic
1084182280 11:67452733-67452755 TCCGTGTCCAGCAGGACTCTGGG - Intronic
1085738507 11:79060007-79060029 TCAGTGTGCAGCATGATTCTAGG - Intronic
1091315403 11:134610747-134610769 TCCGTGTGCACCAGGCCTCGAGG - Intergenic
1101410768 12:104466147-104466169 ACCGTGTCCAGCACCAGTCTAGG + Intronic
1101824061 12:108207125-108207147 TCCCTGTTCACCAGGCCTCTGGG - Intronic
1104418096 12:128612204-128612226 TCTGTGTCCACCTGGACCCTGGG - Intronic
1104665428 12:130644081-130644103 TTCATGTCCATCAGGACTGTTGG - Intronic
1108519530 13:51233955-51233977 TCTGTGTCCAGCAGGGTCCTGGG + Intronic
1112570168 13:100586945-100586967 TTCCTGTTCAGCAGGACACTGGG + Intronic
1113719812 13:112546691-112546713 TCTGTGTCCAGCGGGCCCCTGGG - Intronic
1113846454 13:113394286-113394308 TCCGCGGGCAGCAGGTCTCTGGG - Intergenic
1119779099 14:77266362-77266384 TCCTTCTGCAGCTGGACTCTAGG + Exonic
1119796891 14:77406716-77406738 GCCGTGACCAGCAGGACTGTAGG + Exonic
1120558834 14:85964185-85964207 TCTGTATCGAGCAGTACTCTTGG + Intergenic
1120995912 14:90418768-90418790 TCCCTGCCCAGCAGGGCTCAGGG - Intergenic
1121406033 14:93719919-93719941 TCCGTGGGCACTAGGACTCTGGG + Exonic
1123206205 14:106715607-106715629 TGAGTGTCCAGCAGGACCCATGG + Intergenic
1123211288 14:106763017-106763039 TGAGTGTCCAGCAGGACCCATGG + Intergenic
1124251978 15:28112981-28113003 TCCATGTGCTGCAGGACTGTGGG + Intronic
1132544544 16:527343-527365 TCCGTGTCCCGCGGGGCTCTGGG - Intergenic
1135611415 16:23870990-23871012 TCCTTTTCCAGCAGGCCACTTGG + Intronic
1139182505 16:64764854-64764876 TCCCTGTCCTCCAGGACTCAAGG - Intergenic
1139443032 16:66978471-66978493 TGTGTGTCAAGCACGACTCTAGG - Intergenic
1141425203 16:83940372-83940394 TCCTTGTCCTGCTGGGCTCTGGG + Intronic
1141694371 16:85612784-85612806 TCCGTGTCCTGGAGGCCTTTTGG - Intronic
1144638362 17:16924809-16924831 CCCATGTCCAGCTGAACTCTTGG + Intergenic
1144966378 17:19079175-19079197 CCCGTGCCCAGCTGGACTCCAGG - Intergenic
1144981540 17:19172882-19172904 CCCGTGCCCAGCTGGACTCCAGG + Intergenic
1144986684 17:19205357-19205379 CCCGTGCCCAGCTGGACTCCAGG - Intergenic
1145004863 17:19332116-19332138 TGGGTGTGCAGCAGGCCTCTTGG + Intronic
1146356833 17:32141839-32141861 TCCGTGTCTAGCATTACGCTGGG + Exonic
1146482932 17:33219627-33219649 ACTGTGTCCTGCGGGACTCTGGG + Intronic
1146631344 17:34472120-34472142 TCCATTTCCAACAGGAATCTAGG + Intergenic
1151507738 17:74540567-74540589 TCCTTGACCAGGAGGACTCATGG + Intergenic
1151782014 17:76253119-76253141 ACCGCGCCCAGCCGGACTCTGGG + Intergenic
1151887437 17:76931551-76931573 GTTGTGTCCAGCAGGGCTCTGGG + Intronic
1152371421 17:79890990-79891012 TCCCTCGCCAGCACGACTCTGGG + Intergenic
1152696586 17:81800684-81800706 TCGGTGTCCAGCAAGACTTATGG - Intergenic
1152904407 17:82962469-82962491 TCCGTGTCCACCAGCACCCGCGG - Intronic
1152904422 17:82962523-82962545 TCCGTGTCCACCAGCACCCGCGG - Intronic
1152904452 17:82962631-82962653 TCCGTGTCCACCAGCACCCGCGG - Intronic
1166304317 19:41928882-41928904 TGCGTGTCCAGCAGGGGTCCTGG - Intronic
1166776022 19:45313159-45313181 TCTTTGTCCAGCAGGTCTATTGG + Intronic
1168017094 19:53582257-53582279 TGTGTGTCAGGCAGGACTCTTGG + Intergenic
925095367 2:1194289-1194311 TCCGTGTCCTGCTGGATGCTGGG + Intronic
927885509 2:26715821-26715843 TCAGTGCCCACCAGGACTGTCGG + Intronic
928170320 2:28999198-28999220 TCGTTGTTCAGCAGGGCTCTTGG - Exonic
928455856 2:31420982-31421004 TCTGTGTCCAGAAGGCCTCAGGG - Intergenic
930775404 2:55165639-55165661 TCCATGGCCATCAGCACTCTTGG + Intergenic
931721764 2:65072073-65072095 ACCCTGTCCTGCAGGACTCCGGG + Exonic
933201302 2:79452856-79452878 TCTATTTTCAGCAGGACTCTGGG + Intronic
935349417 2:102140910-102140932 TGCATGTCTAGCAGGACACTGGG + Intronic
935655848 2:105422100-105422122 TGCATGTCCAGCAGCAATCTTGG + Intronic
939663813 2:144924602-144924624 TCTGTGTCCAGCAAGTCTATTGG + Intergenic
1169440116 20:5626885-5626907 TCCGTCCCCAGCTGGACTCCAGG + Intergenic
1170704868 20:18736332-18736354 TTTGTGTCCAGTTGGACTCTAGG - Intronic
1171256309 20:23691229-23691251 TCCGAGCCCAGGATGACTCTTGG - Intergenic
1173798772 20:45881360-45881382 TCCGGCTCCAGCTGGACTCTGGG + Intronic
1174189080 20:48727517-48727539 CATGTGTCCAGCAGGCCTCTAGG + Intronic
1175445843 20:59018883-59018905 GCAGTGTCCTGCAGGTCTCTTGG - Intergenic
1175663985 20:60842893-60842915 TTCCTGCCCAGCAGCACTCTGGG - Intergenic
1175736653 20:61391881-61391903 TCCGGGGCCTGCAGGGCTCTGGG + Intronic
1179460087 21:41528765-41528787 TCCATCTCCGGCAGGAGTCTGGG + Intronic
1179654212 21:42835089-42835111 GCCGCCTCCAGCAGGGCTCTGGG - Intergenic
1181175405 22:21032214-21032236 TCCGGGTCCGGCTCGACTCTGGG - Intronic
1181426793 22:22848995-22849017 TCCGTGTCCAGCAGCATCCTGGG + Intronic
1181580682 22:23826459-23826481 TCCCGGCTCAGCAGGACTCTAGG + Intronic
1181745066 22:24950481-24950503 TCCAGGTTCAGGAGGACTCTGGG + Intergenic
1182433655 22:30316159-30316181 TCGGTGTCCCTCAGGACTTTGGG - Intronic
1183579100 22:38712697-38712719 ACCTTGTCCATCAGGGCTCTCGG - Intronic
1184040563 22:41940666-41940688 ACCGTGCCCAGCAGGAAGCTGGG + Intronic
1184707626 22:46225174-46225196 TCTGTGTCCATCTGGACACTGGG + Intronic
950678014 3:14566192-14566214 TCGGAGTCCAGCAGGAAACTAGG + Intergenic
952507524 3:34020903-34020925 TTCCTGTTCAGCAGGATTCTGGG + Intergenic
955364094 3:58297166-58297188 TTCCTGTCCAGCAGGAGGCTGGG - Intergenic
957484097 3:80834923-80834945 TCCTTTTCCAGAAAGACTCTGGG + Intergenic
958971944 3:100620869-100620891 TCTGTGTCAAGCAGGTCTGTTGG + Intronic
959592494 3:108095497-108095519 TCCTTGGCCATCAGAACTCTAGG - Intergenic
965102185 3:164311785-164311807 TCTGTGTCCATCAGGAATATTGG - Intergenic
968428209 4:536845-536867 TCCGTCTCCAGCTGGCCACTGGG - Intronic
968830612 4:2931496-2931518 CCCGTGCCCTGCAGGACTCAGGG + Intronic
969315695 4:6380382-6380404 TTGTTGTCCAGCAGAACTCTGGG - Intronic
969840290 4:9876653-9876675 TCCAGGTCCAGCAGGAATCAGGG - Intronic
970270983 4:14347386-14347408 TCAGAGTCCAGCAGGACTGTGGG - Intergenic
979132819 4:117069526-117069548 CCTGTGTCCAGCAGCACTGTGGG + Intergenic
980445666 4:132904126-132904148 TCCTTGTCCACCAAGATTCTAGG - Intergenic
981057143 4:140374247-140374269 AACTTGTTCAGCAGGACTCTGGG - Intronic
981471613 4:145141768-145141790 TTGGTGTCCAGGAGGGCTCTTGG - Intronic
989550179 5:42726060-42726082 TCAGTGGCCAGCAGCACACTTGG - Intergenic
989966777 5:50474427-50474449 TCTGTGTCCTGCAAGTCTCTAGG - Intergenic
994649777 5:102512045-102512067 TCCTAATCCAGCAGGACTTTTGG - Intergenic
994971129 5:106739476-106739498 TCTGAAACCAGCAGGACTCTTGG + Intergenic
998007848 5:138668904-138668926 TCAGTGTCAAGCAGGAGGCTGGG + Intronic
998217243 5:140246502-140246524 GCCCTGTCCAGCAGGAATATGGG + Intronic
998499712 5:142621703-142621725 GCTGTGGCCTGCAGGACTCTGGG + Intronic
1002741467 5:181437966-181437988 TCCGTTTCCAGAATCACTCTTGG + Intergenic
1003341337 6:5224096-5224118 TCCTTTTCCAGCTGGATTCTTGG + Intronic
1006580915 6:35077492-35077514 TCTGTGCCCAGCGGGGCTCTGGG + Intronic
1013814371 6:114080188-114080210 TACATCTCCATCAGGACTCTTGG + Intronic
1014899240 6:126943133-126943155 TACGTGTCCAGCACTATTCTAGG - Intergenic
1016833649 6:148456037-148456059 TGCGTGGCCAGCAGGCCTCGGGG + Intronic
1017132404 6:151118926-151118948 TCCGTGTCCTCTTGGACTCTTGG - Intergenic
1018284095 6:162218434-162218456 GCCATGCTCAGCAGGACTCTAGG - Intronic
1018933812 6:168260455-168260477 CGCGTGTGCAGCAGGACCCTCGG + Intergenic
1019246601 6:170713731-170713753 TCCGTTTCCAGAATCACTCTTGG + Intergenic
1024407731 7:49001894-49001916 TCAGTGACCAGCAAGACTCTGGG - Intergenic
1025144849 7:56494009-56494031 TCGGTTTCCAGGAGGACTCATGG + Intergenic
1025260435 7:57414464-57414486 TCAGTTTCCAGGAGGACTCATGG + Intergenic
1026878391 7:73893089-73893111 TCGGAGTCCACCAAGACTCTGGG - Intergenic
1033468800 7:141624121-141624143 TACATGTCCATCAGGGCTCTCGG - Intronic
1034474651 7:151275476-151275498 TCTTTGTCCCGCAGGACCCTGGG - Intronic
1035501538 8:94230-94252 TCCGTTTCCAGAATCACTCTTGG - Intergenic
1036812102 8:11874338-11874360 TCCCTGTTAAGAAGGACTCTTGG + Intergenic
1038267650 8:26048630-26048652 TTCCTGTCCGGCAGGACACTGGG + Intergenic
1039878687 8:41609617-41609639 TCCCTGTCAAGCAGCACGCTGGG - Intronic
1040017772 8:42713840-42713862 TCCTCATCCAGCAGGAATCTGGG + Intronic
1041131206 8:54703346-54703368 TACGTGTCCATCAGAGCTCTTGG + Intergenic
1051696153 9:19769747-19769769 GCAGTGTCCACCAGGACTCATGG - Intronic
1054770229 9:69076749-69076771 TCCGTGTCCAGTTGGATTCTTGG + Intronic
1056220546 9:84447145-84447167 TCTGTTTCCAGCAGGAAGCTGGG + Intergenic
1056791905 9:89631445-89631467 TCCCTGTCCTGCAGGAAGCTGGG - Intergenic
1061487463 9:130927583-130927605 GCCGTGACCAGCAGGCCTCAGGG + Intronic
1203607378 Un_KI270748v1:69182-69204 TCCGTTTCCAGAATCACTCTTGG + Intergenic
1189564296 X:42224560-42224582 TCCGTGTTCATCAGGAATATTGG + Intergenic
1190640918 X:52482294-52482316 TCAGTTTCCAGAAGGACTCACGG - Intergenic
1190646754 X:52530571-52530593 TCAGTTTCCAGAAGGACTCACGG + Intergenic