ID: 1084182573

View in Genome Browser
Species Human (GRCh38)
Location 11:67454224-67454246
Sequence CTTCCCCGCTGGCAGCGGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 159}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084182561_1084182573 4 Left 1084182561 11:67454197-67454219 CCAAGAGGCCTGCAGCCCCACCT 0: 1
1: 0
2: 4
3: 34
4: 431
Right 1084182573 11:67454224-67454246 CTTCCCCGCTGGCAGCGGGGAGG 0: 1
1: 0
2: 1
3: 6
4: 159
1084182562_1084182573 -4 Left 1084182562 11:67454205-67454227 CCTGCAGCCCCACCTCGCCCTTC 0: 1
1: 0
2: 3
3: 58
4: 628
Right 1084182573 11:67454224-67454246 CTTCCCCGCTGGCAGCGGGGAGG 0: 1
1: 0
2: 1
3: 6
4: 159
1084182559_1084182573 17 Left 1084182559 11:67454184-67454206 CCAGACCTGGGATCCAAGAGGCC 0: 1
1: 0
2: 3
3: 32
4: 234
Right 1084182573 11:67454224-67454246 CTTCCCCGCTGGCAGCGGGGAGG 0: 1
1: 0
2: 1
3: 6
4: 159
1084182560_1084182573 12 Left 1084182560 11:67454189-67454211 CCTGGGATCCAAGAGGCCTGCAG 0: 1
1: 0
2: 0
3: 26
4: 279
Right 1084182573 11:67454224-67454246 CTTCCCCGCTGGCAGCGGGGAGG 0: 1
1: 0
2: 1
3: 6
4: 159
1084182558_1084182573 18 Left 1084182558 11:67454183-67454205 CCCAGACCTGGGATCCAAGAGGC 0: 1
1: 0
2: 0
3: 17
4: 190
Right 1084182573 11:67454224-67454246 CTTCCCCGCTGGCAGCGGGGAGG 0: 1
1: 0
2: 1
3: 6
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084182573 Original CRISPR CTTCCCCGCTGGCAGCGGGG AGG Intronic
900283736 1:1889882-1889904 CTTTTCGGCTGGAAGCGGGGTGG - Intronic
900315595 1:2054682-2054704 CTTCACCGCTGGCACCGTCGAGG + Intronic
901190994 1:7409617-7409639 CTACCCCGTGGGCAGCTGGGAGG - Intronic
901441390 1:9280445-9280467 CTTGCCCGCTGCCAGCGGCGGGG - Intergenic
901643051 1:10702713-10702735 TTCCCCCGCTGGCAGGGGTGGGG - Intronic
903043641 1:20550734-20550756 TCTCCCCGCTGGCAGTGGGCTGG - Intergenic
903652589 1:24930621-24930643 CCTCCCCGCTGGCCGCGGCCGGG + Intronic
904009066 1:27379776-27379798 CTTCCCTGCTGGCAGCATGAAGG + Exonic
904052174 1:27646347-27646369 CTTCCCTGCAGGCAGAGGGATGG - Intergenic
905212675 1:36385539-36385561 CTTCCCCGGCGGCAGGGGCGAGG - Intronic
906544922 1:46613938-46613960 CCGCCCAGCTGGCAGCGGGAGGG - Intronic
912413667 1:109494191-109494213 CTGACCCGCTGGCTGCGGAGAGG + Exonic
916561201 1:165935248-165935270 ACTCCCAGCTGGCAGTGGGGAGG - Intergenic
920242521 1:204563528-204563550 CTGCACCACTGGCAGCGGGCTGG + Intergenic
920848570 1:209613150-209613172 CTGCCCCGCTGGCAGCAGGCTGG - Exonic
922565417 1:226598275-226598297 GTTCCCAGCTGGAAGCTGGGAGG + Intronic
923069583 1:230550140-230550162 CTTCCCTGCGGGCAGAGGCGGGG + Intergenic
1064373091 10:14771208-14771230 CTTTGCCGCTGGCAGTGTGGGGG - Intronic
1065974665 10:30831566-30831588 CTTCACAGCTGGCAGCAGGCAGG + Intronic
1067167915 10:43879957-43879979 GCTCCCCGCTGGCTGTGGGGCGG - Intergenic
1072511508 10:96130467-96130489 CTGCCCCGCGGGGAGCGCGGAGG - Intronic
1075119100 10:119651465-119651487 CTTCCCCTCTGGCAGCGAGGAGG + Exonic
1076631977 10:131856874-131856896 CTGCCCCGCGGGCAGCTGCGTGG + Intergenic
1077047951 11:554536-554558 CTTTCCCGCGGGCACGGGGGTGG + Exonic
1077414182 11:2416961-2416983 GTTCCCTGCAGGCAGCGGGAGGG - Intronic
1079248513 11:18770915-18770937 CTACCCCCCAGGCAGAGGGGCGG - Intronic
1081921982 11:46786837-46786859 CTTCCCCCTTGGCAGAGGGTGGG + Intronic
1084182573 11:67454224-67454246 CTTCCCCGCTGGCAGCGGGGAGG + Intronic
1084190787 11:67497819-67497841 CCTGCCTGCTGGCAGAGGGGTGG + Intronic
1084363820 11:68685084-68685106 CATCCCCGCGGGCAGGGCGGAGG - Intronic
1090709735 11:129374195-129374217 CTTCTAGGCTGGGAGCGGGGAGG + Intergenic
1091108572 11:132944277-132944299 CTTCTGCGCTGGCATCGGCGAGG - Intronic
1091184647 11:133636773-133636795 CTTCCCCGGTGGGGGTGGGGGGG - Intergenic
1091387199 12:103000-103022 CTTCCTGGCTGGCTGCTGGGAGG - Intronic
1091387732 12:105313-105335 CTTGCCCGCTGGCAGGGGCAGGG + Intronic
1091788571 12:3257923-3257945 CTTCCCCCCAGGCAGAGGTGTGG + Intronic
1091916896 12:4276153-4276175 CTTCTCCGCGGTCAGCGGGCTGG - Exonic
1094713393 12:32987165-32987187 CTCCCCGGCTGGCAGCGTAGTGG + Intergenic
1102816201 12:115868438-115868460 CTTCTCCACTGGCAGCTGGGAGG - Intergenic
1103416018 12:120741820-120741842 CTGCCCTGCTGGGAGCGGTGTGG - Intergenic
1103843748 12:123887072-123887094 CTTCCCTGCGGGCTCCGGGGTGG - Intronic
1112260700 13:97875413-97875435 TTGCCCCGTTTGCAGCGGGGAGG - Intergenic
1115850005 14:37583784-37583806 CTTCCCAGCTGGAGGCCGGGAGG + Intergenic
1118346214 14:64942953-64942975 CTTCCCAGGTTGCAGCAGGGTGG - Intronic
1123599336 15:21952109-21952131 CTTCATTGCTGACAGCGGGGTGG + Intergenic
1125082958 15:35697131-35697153 CTTCCACGCCGGCAAAGGGGAGG - Intergenic
1127931660 15:63601046-63601068 CTTCCCCGGGGGCAGCGGCGGGG - Intronic
1128637714 15:69313867-69313889 CTCCCCAGCTGGCAGAGAGGGGG - Intronic
1131002894 15:88952543-88952565 CTTCCTCTTTGGCAGTGGGGAGG - Intergenic
1131257555 15:90872035-90872057 CAGCCCCGGTGGCGGCGGGGAGG - Intronic
1132715834 16:1289426-1289448 CATCCCAGCTGGGAGTGGGGGGG + Intergenic
1135377775 16:21964265-21964287 CTTCCCCACTGGCGGCAGTGAGG + Intronic
1136599088 16:31272094-31272116 CTTCCCCACCGGCAGAGGTGGGG + Intronic
1138596017 16:58029288-58029310 CTTCCATGCTGGCTCCGGGGGGG + Intronic
1139903060 16:70343200-70343222 ATTCCTAGCTGGCAGCAGGGGGG + Intronic
1139937552 16:70582389-70582411 CTACCCCGGTGACAGCGGGCTGG - Intronic
1142360400 16:89623583-89623605 CTTCCCTGACGGGAGCGGGGCGG + Intronic
1142426042 16:90002861-90002883 CTTCCCTTCTGGCAGAGGGAGGG - Intergenic
1142851545 17:2707128-2707150 CTCCCCCGCAGGCAGCTGGCTGG + Intronic
1143084529 17:4405875-4405897 CATGCCTGCAGGCAGCGGGGTGG + Intergenic
1143402264 17:6654071-6654093 CTTCATCGTTGGCAGAGGGGAGG - Intergenic
1144100459 17:11937930-11937952 CTTCCCCACTGGCATCTGGTTGG - Intronic
1146277151 17:31523169-31523191 CTTCCCCACTGGAAGAGGAGGGG + Intronic
1148885094 17:50766743-50766765 CTACCCCACTGGCAGAGTGGCGG + Intergenic
1151378743 17:73710274-73710296 CTGCACCGCTGGAAGTGGGGCGG + Intergenic
1152376226 17:79920190-79920212 CTTCCCGGCTGGCTCTGGGGTGG - Intergenic
1152461770 17:80445551-80445573 CCTCCCCGCCGGGAGCGCGGGGG + Intergenic
1152590516 17:81209268-81209290 CTTCACCCCTGGCAGAGGGAGGG + Intronic
1152808840 17:82371767-82371789 ATTCCCAGCTGGCGGCGGGCAGG + Intergenic
1153247152 18:3083360-3083382 TTTCCCCACTGGAAGAGGGGAGG - Intronic
1153924557 18:9824696-9824718 CTTCCACTCTGGGAGTGGGGCGG - Intronic
1157464240 18:47930617-47930639 CTTCCCCGCGGGCGGCGGCCAGG - Intronic
1160810917 19:1012620-1012642 CTTGCCTGCTGGCAGTGGGCGGG - Intronic
1161249205 19:3271265-3271287 CTTCTGGGCTGGAAGCGGGGGGG - Intronic
1161256752 19:3314135-3314157 CTTCCCAGATGCCAGCCGGGAGG - Intergenic
1161719009 19:5892988-5893010 CTGCCCCTCTGGGTGCGGGGTGG + Exonic
1163514459 19:17754690-17754712 CTTCCCCTCTGGGGGAGGGGAGG + Intronic
1164207667 19:23071388-23071410 CGTCCCCGCTGTGAGCTGGGCGG - Intergenic
1167092309 19:47353075-47353097 CTTCCTCGCTGGGAGCCCGGTGG - Exonic
1167145971 19:47680991-47681013 CCTCCCCGGTGGCAGCGGCAGGG - Exonic
1167557504 19:50205387-50205409 CTGCCCGGCTGGGAACGGGGCGG - Intronic
1168675967 19:58278475-58278497 CTTAGCGGCTGGAAGCGGGGAGG - Intronic
927653558 2:24927174-24927196 ATTCCCCGCAGGCCGCAGGGAGG - Intergenic
928373423 2:30757326-30757348 TTTCCCAGCTGCCAGAGGGGTGG - Intronic
929487599 2:42368954-42368976 CTTCCCTTCTGGGAGCGGTGGGG - Exonic
935082228 2:99809371-99809393 CTGCACCTCTGGCAGTGGGGAGG + Intronic
935130968 2:100260740-100260762 CTTCCCGCCTGGCCGTGGGGAGG + Intergenic
935597320 2:104889402-104889424 CTTCCCCATTTGCAGCTGGGAGG - Intergenic
936935725 2:117836670-117836692 CTTCCCTGGGGGCAGCAGGGAGG - Intergenic
937149348 2:119675037-119675059 CTGCCCGGCTGCCAGCTGGGTGG - Intergenic
937920798 2:127128695-127128717 CCTCCACACTGGCAGCAGGGTGG - Intergenic
947685273 2:232078384-232078406 CTTCCTCCCGGGGAGCGGGGCGG - Intronic
948457737 2:238114648-238114670 CTTCCCCGGGGGCTGCTGGGAGG - Intronic
1169262423 20:4148709-4148731 CTTCCCGGCTCCCGGCGGGGCGG + Intronic
1172692954 20:36803176-36803198 TTTCCCCGCTGGCACCCAGGAGG - Intronic
1173826272 20:46049693-46049715 CTTCCCCGCCTTCAGCTGGGAGG - Exonic
1175729633 20:61345643-61345665 TTTCCCCTCTGGCAACGAGGAGG + Intronic
1176131398 20:63498261-63498283 TCTCCCCGGTGGCAGCGGGTGGG - Intronic
1176167257 20:63680747-63680769 CTTCCCTGATGGAAGCCGGGCGG + Intronic
1176247079 20:64102433-64102455 CCTCCCGGCTGGCCGCGGGGCGG + Intergenic
1177816958 21:25988107-25988129 CTTCCCAGCTGGCTGCTGGAAGG + Intronic
1178015619 21:28343093-28343115 CTGCATGGCTGGCAGCGGGGTGG + Intergenic
1182697267 22:32205816-32205838 CTACACTGCTGGCAGTGGGGAGG + Intergenic
1185222951 22:49638111-49638133 CTGCCCAGCAGGCAGCGGGTGGG - Intronic
949906430 3:8862524-8862546 CTTCCCGGCTGACAGCCGAGTGG + Intronic
950110714 3:10417054-10417076 CTTCCCAGACGGCGGCGGGGGGG + Intronic
950215257 3:11154397-11154419 CTTCCCCGCTGCTCGCGGGTGGG + Intronic
958572936 3:95911546-95911568 CTTCCCAGCTGTCAGCAGAGAGG + Intergenic
961415387 3:126753013-126753035 TTCCCCAGCTGGCAGAGGGGCGG + Intronic
964623909 3:158740834-158740856 CTTCCCCCTTGGCAGAGGTGAGG + Intronic
965757233 3:172039692-172039714 CTTCCCAGCCGGCAGCCTGGAGG - Intronic
966870988 3:184290617-184290639 CTTCCCCGCTGGCATCCTGCAGG + Exonic
967904130 3:194486892-194486914 CTACGTCGCTGGCGGCGGGGGGG - Intronic
968541729 4:1171569-1171591 GTTCCCTGCGGGCGGCGGGGAGG - Intronic
968618750 4:1594093-1594115 CTGCCCTGCTGGCAGCCTGGGGG - Intergenic
968702707 4:2064424-2064446 CTTCCCCAGTGGCGGCGGGCAGG - Exonic
968973281 4:3807557-3807579 ATTTCCCTCTGGCAGCAGGGAGG + Intergenic
969411801 4:7033456-7033478 CTCCCCAGCAGGCAGTGGGGTGG + Intergenic
972418705 4:38867594-38867616 TTTCCGCGCTGGCACAGGGGTGG + Intergenic
978385574 4:108172829-108172851 CCTCCCAGCTGGCAGAAGGGCGG - Intergenic
980244742 4:130224373-130224395 CTTCCCTGCTGGAAGGAGGGAGG + Intergenic
982157165 4:152535085-152535107 CTTCCGCGCTGCCAGGGGAGGGG + Exonic
982317802 4:154048770-154048792 CTTTCCCCCTGACAGAGGGGAGG - Intergenic
984102265 4:175499928-175499950 CTTCCCCACTGGCAGTGGCTCGG + Intergenic
985555303 5:555196-555218 CTTCCTCGCGGGCGCCGGGGCGG + Intergenic
985692504 5:1321242-1321264 ATTCCCCGCTGGCAGAGCTGTGG - Intronic
989102317 5:37834719-37834741 CTTACCGGCGGGCAGCGGGAAGG + Exonic
997612988 5:135228211-135228233 TCTCCCCTCTGGCAGCAGGGGGG + Intronic
1001640333 5:173239284-173239306 CCTCTCCCCTGGCTGCGGGGTGG - Intergenic
1002455500 5:179343991-179344013 CTTCCCCGGAGGCAACGAGGAGG - Exonic
1003188212 6:3850723-3850745 CTTCCCCGCCAGCCGCTGGGAGG + Exonic
1005360019 6:25023131-25023153 CTTCCCGGCTGGCAGCGTAGTGG - Intronic
1006470645 6:34226894-34226916 CTTCCCTGCTGGCAGCTGCCCGG - Intergenic
1007100651 6:39244061-39244083 CTTCCCCTTAGGCAGCCGGGTGG + Intergenic
1007416358 6:41693729-41693751 CTGCCCCGTTGGTAGCTGGGTGG - Intronic
1007521265 6:42452956-42452978 CTTCCCCGCCCCCATCGGGGCGG - Intergenic
1013359514 6:109381853-109381875 CTTCCGCGGGGGCAGCGGTGGGG - Intronic
1020105627 7:5421094-5421116 CTTCCCGGGCGGCAGCGGGCCGG + Exonic
1020142416 7:5619873-5619895 CTTCCTCCCTGGCAGGGGAGTGG + Intergenic
1029187089 7:98747003-98747025 CATCCCAGCTGGCAGCGGATGGG - Intergenic
1029195428 7:98802283-98802305 CTTCCCCGTTGGCAGAAGAGAGG - Intergenic
1029858311 7:103541181-103541203 GTTCCCAGCTGGCAGGGAGGTGG + Intronic
1032194148 7:129780078-129780100 CTCCCCCGCCTGCAGCGCGGAGG - Intergenic
1034843062 7:154417561-154417583 CTTCGCTTCTGGGAGCGGGGTGG - Intronic
1034978019 7:155459083-155459105 CGTCCCGGCTCGCCGCGGGGAGG + Intronic
1035635020 8:1138068-1138090 CTGCCCCGCTGACACCGGGATGG + Intergenic
1036646346 8:10613032-10613054 CTTCCCCACTGGCTGCCGTGAGG + Exonic
1037615561 8:20515928-20515950 CTCCCACGCTGGCAGCGGAAAGG - Intergenic
1038683419 8:29692575-29692597 CTTCCCAGCTGGGTGGGGGGAGG + Intergenic
1040902149 8:52428162-52428184 CTTCCCCTTAGGCAGCTGGGCGG + Intronic
1042267627 8:66925331-66925353 CTTCCCCGGGCGCAGCGGAGCGG - Intergenic
1042793344 8:72633202-72633224 CTTCCTGGCTGGCAGTGGGTGGG + Intronic
1049557291 8:143289434-143289456 CCTCCTCGCTGGCAGCCGGCAGG - Intergenic
1056788098 9:89606688-89606710 CCTCCCCTCTGGCAGAGGGAGGG + Intergenic
1057917685 9:99069777-99069799 CTTCCCCGTGCTCAGCGGGGAGG - Exonic
1058828220 9:108793780-108793802 CACCCCAGCTGGGAGCGGGGAGG - Intergenic
1060811661 9:126614048-126614070 CGGCCCCGCGGGCCGCGGGGGGG - Intergenic
1061426395 9:130501116-130501138 CTCCCCGGCTGGCAGCGTAGTGG + Exonic
1062004926 9:134234278-134234300 CTTCCCCGCTGGAAACGGAACGG + Intergenic
1062264852 9:135682276-135682298 CTCCCCCGGTGGCAGAGGGAGGG - Intergenic
1062379579 9:136280792-136280814 CTCCTTGGCTGGCAGCGGGGAGG - Intergenic
1062398874 9:136363749-136363771 CTTCCAAGATGGCGGCGGGGCGG - Exonic
1062567019 9:137167976-137167998 CTGCCCGCCAGGCAGCGGGGTGG - Exonic
1062607191 9:137353593-137353615 CTGCCACGGTGGCTGCGGGGTGG - Intronic
1185838642 X:3368479-3368501 TTTCCCAGCTGGCAGCGTAGTGG + Intergenic
1189083618 X:37997983-37998005 CTTCCCAGCTGTCAGCAGAGAGG - Intronic
1189310330 X:40013720-40013742 GTTCTCCCCTGGCAGCGGAGCGG - Intergenic