ID: 1084183450

View in Genome Browser
Species Human (GRCh38)
Location 11:67457873-67457895
Sequence GAGGCAAACCACCTTGGTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 115}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084183444_1084183450 -1 Left 1084183444 11:67457851-67457873 CCAGGGGGACTTCCTGGAGCAGG 0: 1
1: 2
2: 17
3: 131
4: 618
Right 1084183450 11:67457873-67457895 GAGGCAAACCACCTTGGTGTGGG 0: 1
1: 0
2: 1
3: 11
4: 115
1084183438_1084183450 16 Left 1084183438 11:67457834-67457856 CCAGCTAGAGGATCCGTCCAGGG 0: 1
1: 0
2: 0
3: 1
4: 56
Right 1084183450 11:67457873-67457895 GAGGCAAACCACCTTGGTGTGGG 0: 1
1: 0
2: 1
3: 11
4: 115
1084183443_1084183450 3 Left 1084183443 11:67457847-67457869 CCGTCCAGGGGGACTTCCTGGAG 0: 1
1: 0
2: 5
3: 42
4: 253
Right 1084183450 11:67457873-67457895 GAGGCAAACCACCTTGGTGTGGG 0: 1
1: 0
2: 1
3: 11
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084183450 Original CRISPR GAGGCAAACCACCTTGGTGT GGG Intronic
900586612 1:3435629-3435651 GGTGCAAGCCGCCTTGGTGTGGG + Exonic
904327821 1:29738970-29738992 GAGGCAAACCAACTCAGAGTAGG - Intergenic
912664941 1:111570528-111570550 GAGGGACACCAAGTTGGTGTTGG - Intronic
915511832 1:156390866-156390888 GAGTCAAGGCACCCTGGTGTGGG + Intergenic
917729660 1:177862093-177862115 GAGGCAGTCAACCTAGGTGTTGG - Intergenic
921033782 1:211357000-211357022 GAGACAAACCAACAAGGTGTAGG + Intronic
921911953 1:220559383-220559405 GAGGCAAACCTGGTTGGAGTGGG + Intronic
922683154 1:227617672-227617694 CAGGCAAACCACATTGGTCATGG - Intronic
922988438 1:229884960-229884982 GGGGCCAGCCACCCTGGTGTTGG + Intergenic
923263820 1:232293334-232293356 GGGCCAAAGCACCTGGGTGTGGG - Intergenic
1062911956 10:1217152-1217174 GAGGGAAGCCGCCTTGGTTTTGG + Intronic
1079120935 11:17684352-17684374 CAGGCAAACCATCTTGGTTTGGG + Intergenic
1079384990 11:19971054-19971076 GAGGCAGACCATCATGGTGTGGG + Intronic
1080102181 11:28472385-28472407 CAGGAAGGCCACCTTGGTGTTGG + Intergenic
1081337506 11:41884878-41884900 AAGGCACACTACCTTGATGTGGG - Intergenic
1082631853 11:55552235-55552257 GAGTAAAACCACCTTGGTCTTGG + Intergenic
1083589423 11:63884507-63884529 GCAGTAAACCACCTTGGTTTTGG + Intronic
1083877603 11:65532543-65532565 GAGGCCAAACACCTGGGTGGTGG + Intronic
1084183450 11:67457873-67457895 GAGGCAAACCACCTTGGTGTGGG + Intronic
1096745628 12:53725144-53725166 GTGACATTCCACCTTGGTGTTGG + Exonic
1101514397 12:105420849-105420871 GAGGCAAATCAGATTGCTGTGGG - Intergenic
1102713424 12:114948946-114948968 GAAACAAGCCACCTTGGTGGGGG - Intergenic
1108789711 13:53953434-53953456 GCGGCAGACCTGCTTGGTGTGGG + Intergenic
1109352476 13:61202394-61202416 GAGGCAAACAACTTTGGGGCAGG - Intergenic
1118544717 14:66873555-66873577 GGGGCACTCCAGCTTGGTGTGGG + Intronic
1118687306 14:68303599-68303621 GAGGCAAGTCACTTTGGGGTGGG + Intronic
1121683703 14:95815938-95815960 GAGACTGAGCACCTTGGTGTAGG - Intergenic
1128071581 15:64800318-64800340 CAGGCAAATCACCTTAGTTTAGG - Intergenic
1128443094 15:67731699-67731721 GAGGCAAAGTACCTTGCTTTAGG + Intronic
1131946650 15:97629515-97629537 GAGGAAAACCACCCTGTGGTGGG - Intergenic
1133444017 16:5844807-5844829 AAGGGAAACCGCCTTTGTGTTGG - Intergenic
1133895321 16:9921800-9921822 GAAGCAATGCACCTAGGTGTGGG + Intronic
1136775021 16:32867292-32867314 CAGGCAAACCACCTTAGACTCGG - Intergenic
1136895597 16:33994220-33994242 CAGGCAAACCACCTTAGACTCGG + Intergenic
1137008120 16:35297313-35297335 GAGTCAAATCACCTAGGTGATGG - Intergenic
1137009364 16:35308244-35308266 GAGTCACATTACCTTGGTGTTGG + Intergenic
1137690352 16:50422441-50422463 GTGGCAAACCACAGAGGTGTTGG + Intergenic
1139497150 16:67327937-67327959 GAGGGAAACCAGATTGGAGTGGG + Intronic
1139666344 16:68459563-68459585 GAGTCACACCAGCTTGATGTAGG + Intergenic
1140859185 16:79004457-79004479 GAGGCAGACCCTGTTGGTGTTGG + Intronic
1203077439 16_KI270728v1_random:1129401-1129423 CAGGCAAACCACCTTAGACTCGG - Intergenic
1148477816 17:47940919-47940941 GAGGAAAACCACTCTGGTCTGGG + Intergenic
1151563315 17:74882630-74882652 CAGGCCCACCACGTTGGTGTAGG + Exonic
1152026471 17:77812635-77812657 GAGCCCAACCCCATTGGTGTTGG - Intergenic
1152195984 17:78918605-78918627 GAGGCTGACCACCTCAGTGTCGG - Intronic
1153833987 18:8948116-8948138 CAGCCAAACCACCTTTCTGTAGG - Intergenic
1156794840 18:41031502-41031524 GAAACTAACAACCTTGGTGTAGG + Intergenic
1163988220 19:20972291-20972313 GAGTCACATCACCTAGGTGTGGG - Intergenic
1164078245 19:21840233-21840255 GAGTCACACCACCTAGATGTTGG + Intronic
1164082929 19:21876132-21876154 GAGTCATATCACCTGGGTGTTGG - Intergenic
1164098657 19:22034737-22034759 GAGTCACACCACCTAGGTGTTGG + Intergenic
1164099221 19:22039731-22039753 GAGTCAAATCACCTAGGTGCTGG + Intergenic
1164127893 19:22335119-22335141 GAGTAAAATCACCTGGGTGTTGG + Intergenic
1164128182 19:22337444-22337466 GAGTAACATCACCTTGGTGTTGG + Intergenic
1164171297 19:22727881-22727903 GAGTAACATCACCTTGGTGTTGG - Intergenic
1164171608 19:22730248-22730270 GAGTAAAATCACCTGGGTGTTGG - Intergenic
1164181789 19:22825653-22825675 GAGTCATATCACCTAGGTGTTGG - Intergenic
1164191663 19:22923734-22923756 GAGTAATATCACCTTGGTGTTGG - Intergenic
1164193648 19:22934224-22934246 GAGTCAAATCACCTAGGTGATGG - Intergenic
1164206137 19:23060377-23060399 GAGTCACATCACCTAGGTGTGGG + Intergenic
1164206218 19:23060894-23060916 GACGCACATCACCTTGGTGTTGG + Intergenic
1164227772 19:23260987-23261009 CAGTCACATCACCTTGGTGTTGG + Intergenic
1164233046 19:23307945-23307967 GAGTCACATCACCTAGGTGTTGG - Intronic
1164233864 19:23315254-23315276 GAGTCACATCACCTAGGTGTTGG - Intronic
1164243054 19:23407186-23407208 GAGTCAAATCACCTTGGTGCTGG + Intergenic
1164255154 19:23521628-23521650 CAGTCATACCACCTAGGTGTTGG + Intergenic
1164303311 19:23981058-23981080 GAGTCACATCACCTAGGTGTTGG + Intergenic
1164303974 19:23987362-23987384 GAGTCACATCACCTAGGTGTTGG + Intergenic
1164311545 19:24050516-24050538 GAGTCATATCACCTTGGTGCTGG - Intronic
1164314139 19:24071886-24071908 GAGTCACATCACCTAGGTGTTGG + Intronic
1164314373 19:24073989-24074011 TAGTCACACCACCTAGGTGTTGG - Intronic
1164325994 19:24192291-24192313 GAGTCATATCACCTAGGTGTTGG + Intergenic
929842034 2:45477003-45477025 GAGCCAAAGCACATTGGAGTTGG - Exonic
931144485 2:59502263-59502285 GAGGAAAACCACCTTGGGGTTGG - Intergenic
934762276 2:96863288-96863310 AAGGAAAACCACCATGGTGAGGG + Intronic
938187337 2:129243219-129243241 GAGTCACATCACCTAGGTGTTGG + Intergenic
947111872 2:226727242-226727264 GAGGCAAACCCCCTTGCCCTGGG - Intergenic
948527634 2:238581514-238581536 GATGCAAACACCCTTGTTGTGGG + Intergenic
948797719 2:240413204-240413226 GAGCCAAACCACCCTGGTGGGGG + Intergenic
1171843937 20:30251483-30251505 GAGGCAAACCTCTTTAGAGTAGG + Intergenic
1178868304 21:36349308-36349330 CAGGCAAACAACATGGGTGTTGG + Exonic
1181552638 22:23649461-23649483 GAGGGCAACCCCCTTGGTCTCGG + Intergenic
1183113155 22:35668205-35668227 AAGGCAAAACAACTTGATGTGGG - Exonic
949939414 3:9143323-9143345 TAGGCAACCCACTTTGGTGCTGG - Intronic
952512303 3:34069705-34069727 GAGGCAAATCACCTTGCTAAAGG + Intergenic
958904225 3:99924309-99924331 TAGGCAAACCATATTGGAGTTGG - Exonic
959774805 3:110145040-110145062 GGGGAAAACCTCCTTGATGTTGG - Intergenic
960946216 3:122968478-122968500 GAGGCACAGCACCTTGGGGCTGG - Intronic
964411110 3:156398821-156398843 GAGACAACCCACTATGGTGTGGG - Intronic
967680447 3:192356192-192356214 CAAGAAAACCCCCTTGGTGTGGG - Intronic
968717361 4:2170520-2170542 GAGAAAAGCAACCTTGGTGTGGG + Intronic
974333770 4:60512891-60512913 AAGGCCAACCTCCTTAGTGTGGG - Intergenic
975657058 4:76652146-76652168 GAGGCAAACTTACCTGGTGTTGG + Intronic
979293819 4:119007643-119007665 GAGTCAAGCCACCTTGGCCTTGG + Intronic
983245142 4:165279345-165279367 GAGGGAAACCACCGTAGTCTGGG - Intronic
985705918 5:1401345-1401367 GAGGCAGCCCACCTGGGTGTGGG - Intronic
992889700 5:81192689-81192711 GTTGAAAACCACCTTGGTTTAGG + Intronic
997900903 5:137763228-137763250 TAAGGTAACCACCTTGGTGTTGG + Intergenic
998904547 5:146890390-146890412 GTGGCAAACCATGATGGTGTAGG - Intronic
1000853306 5:166367519-166367541 GAGGCAAATCACCTGGGTGCTGG + Intergenic
1002569819 5:180133994-180134016 GAGGCAAAGCACCTTGCTTGAGG + Intronic
1005829606 6:29660046-29660068 GAGGCAAACCACCATGCCCTAGG - Intronic
1006907925 6:37545544-37545566 GAGGGAAGCCCCCGTGGTGTAGG - Intergenic
1009670433 6:66741499-66741521 GTGGCACACCACATTGGGGTAGG - Intergenic
1017382848 6:153850282-153850304 GCAGCAAACCACCATGGTGCAGG - Intergenic
1024751169 7:52467266-52467288 AAAGTAAACCACCTAGGTGTCGG - Intergenic
1025781286 7:64604063-64604085 GAGTCAAATCACCTAGGTGCTGG - Intergenic
1025784680 7:64633701-64633723 GAGTCACACAACCTGGGTGTGGG - Intergenic
1031356277 7:120791037-120791059 GAGGCAAACTGGCTGGGTGTGGG + Intronic
1033367698 7:140684079-140684101 GGGGCAAGCCATGTTGGTGTTGG + Intronic
1035333502 7:158111474-158111496 GCTGCAAACCACCCTGGTGACGG - Intronic
1035345709 7:158196413-158196435 GAGGCAGACCCCCATGGTGGAGG - Intronic
1039842299 8:41302880-41302902 GAGAAAAACCACCCTGCTGTGGG + Intronic
1040377917 8:46844361-46844383 GAGTCACACCACCTAGGTGCTGG - Intergenic
1041643754 8:60229988-60230010 GAGGGAAACCCCCTTGGGATTGG - Intronic
1047021563 8:120780236-120780258 GAGGCAAGCCAATTTGGTGGTGG - Intronic
1051875908 9:21793432-21793454 GAAGCAAACCAACCTGGAGTTGG - Intergenic
1055478217 9:76684703-76684725 GAGGCAATCTACCCTGGTGGGGG + Intronic
1196327619 X:114426123-114426145 CAGGCAAAACATCTTGATGTGGG - Intergenic
1200858683 Y:7966644-7966666 GAGTCACACCACCTAGGTGATGG + Intergenic
1200867346 Y:8059080-8059102 GAGTCACACCACCTTGGTGCTGG - Intergenic
1200892769 Y:8341256-8341278 GAGTCAAATCACCTAGATGTTGG - Intergenic
1200894605 Y:8361510-8361532 GAGTCACACCACCTTGGTGCTGG + Intergenic
1202072361 Y:21005362-21005384 GAGTCAAATCACTTTGGTATTGG + Intergenic
1202270838 Y:23072682-23072704 GAGTTACATCACCTTGGTGTAGG - Intergenic
1202295188 Y:23348000-23348022 GAGTTACATCACCTTGGTGTAGG + Intergenic
1202423833 Y:24706426-24706448 GAGTTACATCACCTTGGTGTAGG - Intergenic
1202446956 Y:24963659-24963681 GAGTTACATCACCTTGGTGTAGG + Intergenic