ID: 1084186002

View in Genome Browser
Species Human (GRCh38)
Location 11:67471801-67471823
Sequence ACAGTCCATAAGGGGACAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084186002_1084186008 -6 Left 1084186002 11:67471801-67471823 CCTGCTGTCCCCTTATGGACTGT No data
Right 1084186008 11:67471818-67471840 GACTGTGGGAGAATTCCCCTTGG No data
1084186002_1084186017 17 Left 1084186002 11:67471801-67471823 CCTGCTGTCCCCTTATGGACTGT No data
Right 1084186017 11:67471841-67471863 GGTAGGATTTCCAGGTTATAGGG No data
1084186002_1084186016 16 Left 1084186002 11:67471801-67471823 CCTGCTGTCCCCTTATGGACTGT No data
Right 1084186016 11:67471840-67471862 GGGTAGGATTTCCAGGTTATAGG No data
1084186002_1084186011 0 Left 1084186002 11:67471801-67471823 CCTGCTGTCCCCTTATGGACTGT No data
Right 1084186011 11:67471824-67471846 GGGAGAATTCCCCTTGGGGTAGG No data
1084186002_1084186010 -4 Left 1084186002 11:67471801-67471823 CCTGCTGTCCCCTTATGGACTGT No data
Right 1084186010 11:67471820-67471842 CTGTGGGAGAATTCCCCTTGGGG No data
1084186002_1084186009 -5 Left 1084186002 11:67471801-67471823 CCTGCTGTCCCCTTATGGACTGT No data
Right 1084186009 11:67471819-67471841 ACTGTGGGAGAATTCCCCTTGGG No data
1084186002_1084186013 9 Left 1084186002 11:67471801-67471823 CCTGCTGTCCCCTTATGGACTGT No data
Right 1084186013 11:67471833-67471855 CCCCTTGGGGTAGGATTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084186002 Original CRISPR ACAGTCCATAAGGGGACAGC AGG (reversed) Intergenic
No off target data available for this crispr