ID: 1084189023

View in Genome Browser
Species Human (GRCh38)
Location 11:67490617-67490639
Sequence TTGTGCCAATGAAGCATGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 206
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 190}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084189011_1084189023 27 Left 1084189011 11:67490567-67490589 CCCACGGGGGCCTGACTAAATGC 0: 1
1: 0
2: 0
3: 2
4: 49
Right 1084189023 11:67490617-67490639 TTGTGCCAATGAAGCATGAATGG 0: 1
1: 0
2: 0
3: 15
4: 190
1084189012_1084189023 26 Left 1084189012 11:67490568-67490590 CCACGGGGGCCTGACTAAATGCC 0: 1
1: 0
2: 1
3: 2
4: 61
Right 1084189023 11:67490617-67490639 TTGTGCCAATGAAGCATGAATGG 0: 1
1: 0
2: 0
3: 15
4: 190
1084189018_1084189023 5 Left 1084189018 11:67490589-67490611 CCTCTACTCGGCAGGGCTGTGGG 0: 1
1: 0
2: 2
3: 17
4: 144
Right 1084189023 11:67490617-67490639 TTGTGCCAATGAAGCATGAATGG 0: 1
1: 0
2: 0
3: 15
4: 190
1084189013_1084189023 17 Left 1084189013 11:67490577-67490599 CCTGACTAAATGCCTCTACTCGG 0: 1
1: 0
2: 0
3: 7
4: 33
Right 1084189023 11:67490617-67490639 TTGTGCCAATGAAGCATGAATGG 0: 1
1: 0
2: 0
3: 15
4: 190

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084189023 Original CRISPR TTGTGCCAATGAAGCATGAA TGG Intronic
900953376 1:5872217-5872239 CTGTGCCAATGTAGCACAAAGGG - Intronic
902088811 1:13885524-13885546 TTGTTCCAATAAAACTTGAATGG - Intergenic
905833002 1:41089478-41089500 TTAGGCCAAAGAAGTATGAAGGG - Intronic
908789976 1:67771494-67771516 TTTTGCGACTGAAGCAGGAAAGG + Intronic
910208269 1:84769412-84769434 TTGGGCCAATGAAATATAAATGG - Intergenic
910559366 1:88573869-88573891 TTTTGACCCTGAAGCATGAATGG - Intergenic
912561398 1:110554261-110554283 TTGGGCCAAGGAAACAGGAAGGG - Intergenic
913285798 1:117225288-117225310 TTTAGCCAATGAAATATGAATGG + Intergenic
917209797 1:172620158-172620180 TTGTACCCATGAAGCAGGGAGGG - Intergenic
917715728 1:177735183-177735205 TTGAGCAAATGAAAAATGAATGG + Intergenic
917929034 1:179811324-179811346 TTGTGCCAGTGCAGCTTGAGAGG + Intronic
919187723 1:194175431-194175453 TTGTGGCCATGAGGTATGAATGG + Intergenic
919495195 1:198256461-198256483 TTTTGCAAATGAACCATGATGGG - Intronic
922856827 1:228782681-228782703 ATGTGCCAATGTAGCATGTGGGG + Intergenic
924106324 1:240652955-240652977 TCGTGCTAAGGATGCATGAAGGG + Intergenic
1063041844 10:2348854-2348876 TTTTCCCAATGAAGCTTGAAGGG - Intergenic
1066745538 10:38602385-38602407 CTGTGCCCTTGAACCATGAAGGG - Intergenic
1067725625 10:48768518-48768540 ATGTGCCAATGAAGCGTTGAAGG - Intronic
1070336440 10:75459391-75459413 TTGTGCCATAGCATCATGAAAGG + Intronic
1070988376 10:80708506-80708528 ATTTGCAAATGATGCATGAAAGG - Intergenic
1072038167 10:91583235-91583257 TTCTACCAATGAAGGAGGAAAGG - Intergenic
1073667049 10:105545303-105545325 TTGTGCATTTGAAGAATGAAAGG - Intergenic
1074306008 10:112279052-112279074 TTGAGCCATTGAAGCCTGCAGGG + Intergenic
1074771809 10:116739844-116739866 GCGTGCCAATGAAACAAGAATGG - Intronic
1076344632 10:129772137-129772159 TGGTGACAAGGAAGCATGTATGG + Intergenic
1079944705 11:26727320-26727342 TTTTGCTAAATAAGCATGAAGGG + Intergenic
1080786303 11:35478205-35478227 ATGTGCCAAGGAAGCCTAAATGG - Intronic
1080820202 11:35798409-35798431 TGTTGCCAATGAACTATGAAAGG - Intronic
1080848465 11:36046852-36046874 GTGTGTCAATAAAGCAGGAAGGG + Intronic
1084189023 11:67490617-67490639 TTGTGCCAATGAAGCATGAATGG + Intronic
1085915638 11:80884666-80884688 ATGTGGCAAGGAACCATGAATGG - Intergenic
1089330878 11:117688255-117688277 CTGTGCCCATGAACCATCAAGGG + Intronic
1090356083 11:126141194-126141216 TTGTGCTAAGCAAGGATGAATGG + Intergenic
1091770810 12:3150108-3150130 CAGTGACAATGTAGCATGAAAGG + Intronic
1093379703 12:18477753-18477775 TTGTGACTCTGAAGAATGAAGGG + Intronic
1093395628 12:18678254-18678276 TTGTGTAAATGATGCATGAAAGG - Intergenic
1093687936 12:22077568-22077590 TTGTACCAGTGAAGCACCAAAGG + Intronic
1094278543 12:28708060-28708082 TTGTGTCAATGGAGCGTGGATGG - Intergenic
1094317000 12:29145963-29145985 GTGAGCCAATTAAGAATGAATGG - Intergenic
1096462701 12:51831138-51831160 TTGTGCAAATGAAGAATTACAGG + Intergenic
1097835827 12:64271982-64272004 CTGTGACCATGAAGCATGTAAGG - Intronic
1097951346 12:65432365-65432387 TTGTGGCAAGGAAAGATGAATGG + Intronic
1099957807 12:89368279-89368301 TTGCTCCAATGAAGTATGTATGG - Intergenic
1101444237 12:104726023-104726045 TTGAGCCAATGAAGCAGGATTGG + Intronic
1101556227 12:105812442-105812464 TGGTGCCATTTAGGCATGAAAGG - Intergenic
1102994902 12:117341598-117341620 TTGTGCCACTGAAGCGTCCATGG - Intronic
1103283760 12:119783140-119783162 CAGTGCCATTGAAGCATTAAGGG - Intronic
1105596049 13:21839408-21839430 TTCTGCCAATGGAGAATGCATGG - Intergenic
1106684420 13:32042916-32042938 TTGTACCAAGGAAGAATGATAGG + Intronic
1107001416 13:35549945-35549967 TTTTGCCATTGTAACATGAAAGG - Intronic
1109012953 13:56974185-56974207 TTGTACCTATGAAGCAGGGAGGG - Intergenic
1110138553 13:72099405-72099427 TTGTGCCAATAATGTATGAGAGG - Intergenic
1110434571 13:75464689-75464711 TTGTGCCAATGCAAGATCAAGGG - Intronic
1112072845 13:95874001-95874023 TTGCCCTAATGAAGAATGAAAGG - Intronic
1113054563 13:106254244-106254266 CTCTGCCAATGAATCATGATGGG - Intergenic
1115410461 14:33068338-33068360 TTGTGCCTAACAAGAATGAATGG - Intronic
1115848846 14:37570992-37571014 AGGTGACATTGAAGCATGAAAGG - Intergenic
1116427001 14:44803263-44803285 TTAGGCAAATGAAGAATGAAGGG - Intergenic
1117090238 14:52243077-52243099 TTGTGTCAATGATGTATTAAAGG + Intergenic
1117167831 14:53057307-53057329 TTGTCCCAAAGAAGTATTAAGGG + Intronic
1118120472 14:62834866-62834888 CTTTGCCATAGAAGCATGAAAGG - Intronic
1121940440 14:98065086-98065108 TTGTGTCCATGAAGTAAGAAGGG + Intergenic
1123891193 15:24781170-24781192 TTGAGCAAATGAAGCATAGAAGG - Intergenic
1126559003 15:50022889-50022911 TAGTGCCAATGAATAATGAAGGG - Intronic
1130391810 15:83463061-83463083 TTGAGTCAGGGAAGCATGAAGGG + Intronic
1131194523 15:90344908-90344930 TTGATCCTATGTAGCATGAAGGG + Intergenic
1134913877 16:18052914-18052936 TTGTACGAATGAAGCAGGACAGG - Intergenic
1137758146 16:50918986-50919008 TTGTGTCAATGAAGCAAGGGTGG - Intergenic
1138133910 16:54504865-54504887 TTGTGACAATGAAGGAAAAAGGG + Intergenic
1139059735 16:63234913-63234935 TTCTGCCAAGGATGCAAGAATGG - Intergenic
1140144424 16:72291912-72291934 TTGTTTCAATGAAGCATTTAAGG + Intergenic
1140598978 16:76451673-76451695 TCTTGCCAATGAAGAGTGAATGG - Intronic
1141777889 16:86136384-86136406 TTGAGCCAAAGAGGCATCAAAGG - Intergenic
1143332000 17:6144377-6144399 TTGTGGCCATGCAGCGTGAATGG + Intergenic
1143348025 17:6264515-6264537 TTCTGCCAATGATCCATAAACGG + Intergenic
1143758416 17:9083516-9083538 TTGGTCTAATGAAGCATGAAGGG + Intronic
1146390211 17:32415193-32415215 TTGTATCCATGAAGCAAGAATGG + Intergenic
1152102775 17:78312575-78312597 TTTTGCTAAAGCAGCATGAATGG + Intergenic
1154487776 18:14890133-14890155 CTTTGCCAATGATCCATGAATGG + Intergenic
1155786866 18:29913202-29913224 TTGCACCCATGAAGCAGGAAGGG - Intergenic
1156918209 18:42486399-42486421 TTTTACCAATGGAGCATAAATGG + Intergenic
1157822091 18:50779547-50779569 TTGTACCCATGAAGCAGGGAAGG - Intergenic
1159466797 18:68794360-68794382 TTTTGCCAATGAAACATAAGTGG - Intronic
1163305296 19:16474163-16474185 TTGTTCTAATAAAGCATGACAGG + Intergenic
1168561073 19:57383785-57383807 TTGTGTCACTTAAGCAAGAAGGG - Intronic
927136999 2:20104533-20104555 TTGTTCACATGAAGCAAGAAGGG - Intergenic
928619360 2:33072855-33072877 TTTGGCCAATGAAACGTGAATGG - Intronic
930989956 2:57641258-57641280 TTTTGCCAAGGGAACATGAATGG - Intergenic
931419609 2:62114416-62114438 TTATGGAAATGAAGTATGAATGG + Intronic
931483799 2:62670334-62670356 TTGGGCCAATGAAATGTGAATGG - Intergenic
931777250 2:65551166-65551188 TTGTTCCAATGAAGCAGAAATGG - Intergenic
935340891 2:102058845-102058867 TTTTGACAATGAAGCATCAAAGG + Intergenic
935620931 2:105128864-105128886 TGGTGCCAAGGCCGCATGAACGG + Intergenic
935677934 2:105611905-105611927 TTGTACAAATCCAGCATGAAAGG - Intergenic
937727708 2:125186804-125186826 TTGTACCCATGAAGCAGGGAGGG + Intergenic
939019269 2:136939737-136939759 TTGTGCCTGTGAAGCGAGAAGGG - Intronic
939266157 2:139876052-139876074 TTGTGGCAATGAGGCATAAGTGG + Intergenic
939318685 2:140586667-140586689 TGGTGCCAATGAATGCTGAATGG + Intronic
940346243 2:152631815-152631837 TTGAGCCAGTTAAGCATCAATGG + Intronic
942839296 2:180340319-180340341 TTGCACCTATGAAGCAGGAAGGG - Intergenic
943478780 2:188391934-188391956 TTCTCCCAGTGAAGCAGGAATGG - Intronic
943700891 2:190987291-190987313 TTGTGCAAATGAACAATGTAAGG - Intronic
944184975 2:196937797-196937819 CTCTGCCATTGAGGCATGAAAGG + Intergenic
945885145 2:215367778-215367800 ATGTGCCAAGGAAGCATGTTTGG - Intronic
1170065479 20:12305529-12305551 TTGTGGCAATGTAGCATCAAGGG - Intergenic
1170241911 20:14175429-14175451 TTGTGCTAATGAAGTGTGGAGGG + Intronic
1170443421 20:16401125-16401147 TTGTGTCAATGAATAATGCAAGG + Intronic
1170647917 20:18213189-18213211 CTCTGCCACTGTAGCATGAAAGG - Intergenic
1173457768 20:43217056-43217078 TGGGGACAATGAAGCTTGAATGG - Intergenic
1175140867 20:56859540-56859562 CTGAGGCAATGAAGCTTGAAGGG - Intergenic
1175653139 20:60746278-60746300 TTGAGAAAATGAACCATGAATGG - Intergenic
1176725565 21:10429368-10429390 TTGTCTCAGTGAAGCCTGAATGG + Intergenic
1177845211 21:26280824-26280846 TTGTGCTAATTAAGTAGGAAAGG + Intergenic
1178274339 21:31223171-31223193 TTGTGCAAAGGAAATATGAAGGG - Intronic
1179116926 21:38501776-38501798 TTGTGGCAGAGAAGCATGCAAGG - Intronic
1182384355 22:29923542-29923564 TTGTTCCAAAGAAGCACAAAAGG - Intronic
1183831751 22:40421890-40421912 TTGTGGCAATGAGGACTGAAAGG + Intronic
949467448 3:4358295-4358317 TTGCCCCATTGAAGCATGGAAGG - Intronic
950685644 3:14616881-14616903 TTGTACCTATGACCCATGAAGGG - Intergenic
952261613 3:31745866-31745888 TTGTTTCACTGAAGCATGAAAGG - Intronic
954835626 3:53464976-53464998 TTGTACTAATGAAACATGAGTGG - Intergenic
955526954 3:59830927-59830949 CTGTACCAATGAAGCAGGATGGG + Intronic
956685480 3:71823632-71823654 TTGTGTTCATGAAGCAGGAAAGG + Intergenic
956719777 3:72107617-72107639 TTGTGCCAATGAAGAATTGGAGG - Intergenic
957361848 3:79170163-79170185 TTGTGCCAATCAAGAGTAAAGGG + Intronic
965995639 3:174879335-174879357 TTGTGCCAATCTACAATGAAGGG - Intronic
968256591 3:197279152-197279174 TTTTCCAAATGAAGCATGAATGG + Intronic
969723755 4:8907392-8907414 TTGAGCGAATGAGGGATGAAAGG + Intergenic
970086335 4:12350919-12350941 TTGTTCCCATCAAGAATGAATGG - Intergenic
970280491 4:14449511-14449533 ATGTGCCAATCAACCTTGAAGGG - Intergenic
970480124 4:16464196-16464218 TTGTTCCAAGAAAGCATGAACGG + Intergenic
970548034 4:17149391-17149413 TCTGGCCAATGAAGGATGAATGG - Intergenic
970767081 4:19562698-19562720 TGCTGCCAGTGGAGCATGAATGG - Intergenic
971909272 4:32774217-32774239 ATGTGCAAATAAAGCATGACAGG + Intergenic
974026519 4:56737799-56737821 TTCTGCCCATGCAGCCTGAACGG + Intergenic
976117170 4:81740238-81740260 TTGGGCCAATGAAGTAAGCATGG - Intronic
976296495 4:83477971-83477993 TTGTTCCAAGGGAGCATGATTGG + Intronic
978106438 4:104907271-104907293 TTTGGCCAATGAAGTGTGAATGG + Intergenic
986115838 5:4773506-4773528 TTGTGTTAATGAAGCATAAATGG - Intergenic
987677829 5:21098043-21098065 TAGTTCCAATGAAGGATGCACGG + Intergenic
988499307 5:31770963-31770985 TTTTGCTAAAGAAGCATGTATGG + Intronic
989789511 5:45380050-45380072 TTGTTATATTGAAGCATGAATGG - Intronic
993905083 5:93613584-93613606 ATGTGACAATGAAGAAGGAAAGG + Intergenic
994172723 5:96675948-96675970 TTATGACAATAAACCATGAAAGG + Intronic
994273502 5:97809005-97809027 GTGAGCCAATTAAGAATGAATGG - Intergenic
996154662 5:120083479-120083501 TTGTGCCACTGGAGAAAGAATGG + Intergenic
996787915 5:127260460-127260482 TTATGACAATGAGACATGAAGGG - Intergenic
997276367 5:132595798-132595820 TTGTGCCCATGAGGTAAGAATGG + Exonic
998536192 5:142933162-142933184 TTGTGCCCATAAAGCCTCAAAGG - Intronic
998677535 5:144426416-144426438 TTTTGCAAATGAAGCATTAAGGG - Intronic
999063774 5:148662792-148662814 TTGTGCCACTGAAGTTTAAATGG - Intronic
999143062 5:149375469-149375491 TTGTGCCAATGAATCACTCAGGG - Intronic
1001454394 5:171849513-171849535 TTGTGCCAATCATCCCTGAAGGG - Intergenic
1003612462 6:7626208-7626230 ATGTGCAAATGAAACACGAAGGG + Intergenic
1003662859 6:8079455-8079477 TTGTGCCAAGGAAGCCAAAAGGG - Exonic
1004252328 6:14032785-14032807 TTGTACCCATGAACCATGCAGGG - Intergenic
1004252353 6:14032900-14032922 TTGTACCCATGAACCATGCAGGG - Intergenic
1006140082 6:31923272-31923294 TTTTGCCAATGGAATATGAATGG + Intronic
1007123039 6:39399545-39399567 TTGTGTCATTGAAGACTGAATGG + Intronic
1007882782 6:45185917-45185939 TTGTACCAATGAAGCCAAAAAGG + Intronic
1007923730 6:45634187-45634209 TTGTGCAAATAAATCATGCATGG - Intronic
1009421102 6:63465944-63465966 TTGTGCCTATGAATCATTATCGG + Intergenic
1009746161 6:67819127-67819149 TTTTGTGAATGAAGCCTGAAGGG - Intergenic
1012104192 6:95132858-95132880 TTGTGCCATTGCAGCAAGACAGG - Intergenic
1012693890 6:102353648-102353670 TTGCACCCATGAAGCATAAAGGG + Intergenic
1012724804 6:102797184-102797206 TTGTGCCAAGGCTGAATGAAGGG + Intergenic
1013582081 6:111545511-111545533 CTGTGCCCAAGAAGGATGAAAGG - Intergenic
1016271658 6:142297222-142297244 TTATGCCAATGTAGCATATATGG + Intergenic
1018987111 6:168646246-168646268 TTGTGCCAGTGAGGCCTGCAGGG - Intronic
1022246432 7:28564380-28564402 GTGTGGTAATGAAGGATGAAGGG - Intronic
1022485816 7:30776883-30776905 TTGGGCGAATGAAGTTTGAATGG + Intronic
1025719681 7:63998726-63998748 TTGTGTCATTCAGGCATGAAGGG + Intergenic
1030776742 7:113543159-113543181 TTATGCTAATGAGGAATGAAGGG - Intergenic
1030853589 7:114522196-114522218 TTGTGCTAATGCAAAATGAAGGG + Intronic
1032527439 7:132589999-132590021 TGGTTCCAAAGAACCATGAAAGG + Intronic
1032868450 7:135953682-135953704 TGGTGTCAGTGAAGCATTAAGGG + Intronic
1032993441 7:137419623-137419645 TTATGCTAATGAGGCATAAATGG + Intronic
1034612307 7:152382208-152382230 TTGTCTCAATGAAGCCTGAATGG - Intronic
1035885299 8:3285050-3285072 TAGGGCCATTGAAGCAAGAAGGG + Intronic
1038201538 8:25417591-25417613 TTGGGCCATTGGAGCATCAAGGG + Intronic
1038548572 8:28445262-28445284 TTGCGCTAATTAAGCCTGAAAGG - Intronic
1040987383 8:53311156-53311178 TGGAGTCAATGCAGCATGAATGG - Intergenic
1041942495 8:63403900-63403922 TGGTGCCAAACAAGCAAGAAAGG - Intergenic
1045238974 8:100381598-100381620 TTGGGCCAATGAAATATGAGTGG + Intronic
1046060637 8:109135343-109135365 TTTTGCCAATGAAACCTGACCGG - Intergenic
1047636269 8:126766500-126766522 TTGTGCAAATGACCCAGGAAAGG - Intergenic
1047697896 8:127421020-127421042 TTCAGCCAATGAAACATGAGTGG - Intergenic
1048739749 8:137541830-137541852 GTGTGACAATGAAATATGAAAGG - Intergenic
1050427841 9:5530153-5530175 TTATTGCAATGAAGCATCAATGG - Intronic
1051378703 9:16432656-16432678 TTGTGCAAATAAAGCATTAGAGG - Intronic
1052496963 9:29239477-29239499 TTATGCAAATGAAGCAAGAGGGG + Intergenic
1055589691 9:77799036-77799058 TTGAGAAAATGAAACATGAATGG - Intronic
1056304715 9:85278497-85278519 TTTTGCCAATGATTCATAAAAGG + Intergenic
1060117476 9:120953900-120953922 TTGTGACATTAAAACATGAATGG - Intronic
1185454600 X:302341-302363 TTCTGCCTCTGAAGCGTGAACGG + Exonic
1186725330 X:12351643-12351665 TGGTGCCAAGGAGGCATGACAGG - Intronic
1187305748 X:18093835-18093857 TGGTGACAATGAGGCGTGAAGGG - Intergenic
1188028795 X:25240586-25240608 TTGTCCCAATGAGGGTTGAAAGG + Intergenic
1193472448 X:81923760-81923782 TTTTGTTAAAGAAGCATGAATGG + Intergenic
1194027459 X:88770578-88770600 TTGTACCCATGAAGCAGGGAGGG - Intergenic
1194131235 X:90084585-90084607 TTGTACCCATGAAGCAAGAAGGG + Intergenic
1194775555 X:97959283-97959305 TAGTGCCACTGAAGCTTGATGGG + Intergenic
1196001444 X:110791349-110791371 TTGTGCAAAGGCAGCAAGAACGG + Intronic
1197801860 X:130358664-130358686 TTGTTCCAAGGGAGCATGATTGG + Exonic
1199192501 X:144987047-144987069 CTGTGAGAATGATGCATGAATGG - Intergenic
1201553777 Y:15247143-15247165 TTCTGCCATTGTTGCATGAAAGG + Intergenic