ID: 1084189855

View in Genome Browser
Species Human (GRCh38)
Location 11:67493994-67494016
Sequence ACCGAAGTCACCAATAGCTC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 38
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 35}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084189855_1084189859 7 Left 1084189855 11:67493994-67494016 CCCGAGCTATTGGTGACTTCGGT 0: 1
1: 0
2: 0
3: 2
4: 35
Right 1084189859 11:67494024-67494046 TGGATCCACTTGCCCGACAGCGG 0: 1
1: 0
2: 0
3: 2
4: 60

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084189855 Original CRISPR ACCGAAGTCACCAATAGCTC GGG (reversed) Exonic
910813578 1:91264244-91264266 ACCAAAGTCGCCCCTAGCTCTGG + Intronic
912712443 1:111959646-111959668 ACCCAAGACACCAGTAGCTGTGG + Intronic
917396281 1:174597826-174597848 ACCCAACACACCAATATCTCTGG - Intronic
1083962326 11:66021281-66021303 ACCCAAGTCACCAACAAGTCAGG - Intronic
1084189855 11:67493994-67494016 ACCGAAGTCACCAATAGCTCGGG - Exonic
1086839441 11:91667093-91667115 ACTGAAGGCAACAATAGCTAAGG - Intergenic
1098296513 12:69009879-69009901 ACCTAATTAACAAATAGCTCTGG + Intergenic
1098507256 12:71267518-71267540 ACAGAAATCACCAAAACCTCTGG - Intronic
1113036469 13:106055048-106055070 ACTGATTTCACCAATATCTCTGG - Intergenic
1113782559 13:112985087-112985109 ACCCAAGGCAAGAATAGCTCAGG + Intronic
1117451007 14:55849964-55849986 ATGAAAGTCACCAATACCTCAGG + Intergenic
1126698291 15:51343918-51343940 ACCGAACTCACCAATGGCATAGG - Intronic
1127284201 15:57518292-57518314 ACCGAAGACACCCATAGATATGG - Intronic
1143151970 17:4812821-4812843 ACAGAAGACAGAAATAGCTCAGG + Intronic
932164978 2:69497953-69497975 GCCGATGTCACCCATACCTCTGG + Intronic
933292801 2:80456183-80456205 CTCCATGTCACCAATAGCTCAGG - Intronic
938804760 2:134795978-134796000 ACCCAGATCACCCATAGCTCAGG + Intergenic
941732795 2:168936697-168936719 ATAGAAGTCACCAAGAGCTTGGG - Intronic
1178406087 21:32324322-32324344 ACCGAAGTCCCCATCAGCTCTGG - Intronic
957749632 3:84396736-84396758 ACCAAAGTCACCAAAATTTCTGG + Intergenic
964813864 3:160695355-160695377 GCCTTAGTGACCAATAGCTCTGG + Intergenic
968534672 4:1116006-1116028 AACGAAGTCCCCAGTAGCACAGG - Intergenic
969948034 4:10804996-10805018 ACCAAAGTCTCCATCAGCTCTGG + Intergenic
972745408 4:41927548-41927570 AGCCAAGTCATCAATAACTCTGG + Intergenic
988477539 5:31600570-31600592 ACAGAAGTCTCTAAAAGCTCTGG - Intergenic
994094383 5:95835797-95835819 AGCAAAGTCACCAACAGCACTGG + Intergenic
995543623 5:113207920-113207942 ATTGAAGTCCCCAGTAGCTCAGG - Intronic
1002641216 5:180631524-180631546 ACCGAAGTCACCCACAGCCTGGG + Intronic
1002926337 6:1607870-1607892 ACCGAACTCACCACTTGCTGAGG + Intergenic
1007961457 6:45963593-45963615 TCCCAAGTCAGCAATAACTCTGG + Intronic
1010665906 6:78629615-78629637 ACCGAAGGCACCAACAGCTAAGG + Intergenic
1022322237 7:29298034-29298056 GCCGAAGTCACCAAGGCCTCGGG - Intronic
1032788133 7:135218033-135218055 AGCAAAGTCCCCATTAGCTCAGG + Intergenic
1048270121 8:133021737-133021759 AATGAAGTCACCAATAGGACCGG - Intronic
1052069659 9:24066696-24066718 ACAGTAGTCACCAATTGCTATGG - Intergenic
1053098565 9:35350232-35350254 AATGCAGTCACCAATAGCTTAGG + Intronic
1057273384 9:93663391-93663413 AGGAAAGTCACCCATAGCTCTGG - Intronic
1199680104 X:150218196-150218218 ACTGAAGTCACCAAGGGGTCAGG + Intergenic