ID: 1084191510

View in Genome Browser
Species Human (GRCh38)
Location 11:67501374-67501396
Sequence GCTGAATTGTAGGCGTGGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 94}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084191500_1084191510 12 Left 1084191500 11:67501339-67501361 CCTCTGTGTGCAGATGACCTGGG 0: 1
1: 0
2: 2
3: 32
4: 703
Right 1084191510 11:67501374-67501396 GCTGAATTGTAGGCGTGGTGGGG 0: 1
1: 0
2: 0
3: 12
4: 94
1084191496_1084191510 28 Left 1084191496 11:67501323-67501345 CCAACTAGGGACCATCCCTCTGT 0: 1
1: 0
2: 0
3: 9
4: 96
Right 1084191510 11:67501374-67501396 GCTGAATTGTAGGCGTGGTGGGG 0: 1
1: 0
2: 0
3: 12
4: 94
1084191498_1084191510 13 Left 1084191498 11:67501338-67501360 CCCTCTGTGTGCAGATGACCTGG 0: 1
1: 0
2: 3
3: 21
4: 211
Right 1084191510 11:67501374-67501396 GCTGAATTGTAGGCGTGGTGGGG 0: 1
1: 0
2: 0
3: 12
4: 94
1084191497_1084191510 17 Left 1084191497 11:67501334-67501356 CCATCCCTCTGTGTGCAGATGAC 0: 1
1: 1
2: 0
3: 23
4: 266
Right 1084191510 11:67501374-67501396 GCTGAATTGTAGGCGTGGTGGGG 0: 1
1: 0
2: 0
3: 12
4: 94
1084191505_1084191510 -5 Left 1084191505 11:67501356-67501378 CCTGGGCACTGAGGCAGGGCTGA 0: 1
1: 0
2: 2
3: 40
4: 485
Right 1084191510 11:67501374-67501396 GCTGAATTGTAGGCGTGGTGGGG 0: 1
1: 0
2: 0
3: 12
4: 94

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084191510 Original CRISPR GCTGAATTGTAGGCGTGGTG GGG Intronic
900567263 1:3339663-3339685 GCTGCATTGTGTGTGTGGTGGGG + Intronic
903314740 1:22493878-22493900 GCTGAGTTGTATGCATTGTGTGG + Intronic
904896318 1:33820894-33820916 TCTGAAGCATAGGCGTGGTGGGG - Intronic
916945690 1:169724802-169724824 GGGGAATTGAAGGGGTGGTGGGG + Intronic
1062994755 10:1855439-1855461 CCTGAAATGTAGGCATTGTGTGG + Intergenic
1063348924 10:5336747-5336769 ACTGTGTTGTGGGCGTGGTGAGG + Intergenic
1069458754 10:68575091-68575113 GAAGTATTGTAGGCCTGGTGTGG + Intronic
1069977979 10:72231082-72231104 GCAGAAATGAAGGCCTGGTGAGG - Intronic
1075856829 10:125637009-125637031 GTAGAATTATAGGCCTGGTGCGG + Intronic
1076619610 10:131778838-131778860 CCTGCATTGTTGGCGTGGTTGGG - Intergenic
1083824093 11:65188516-65188538 GCTGATGTGTAGGGGTGGAGAGG - Intronic
1084191510 11:67501374-67501396 GCTGAATTGTAGGCGTGGTGGGG + Intronic
1085284327 11:75350308-75350330 GCTGTATACTAGGCGTAGTGTGG - Intronic
1090998981 11:131892589-131892611 ACTGCATTGTCGGCATGGTGCGG + Intronic
1092145633 12:6212715-6212737 GTTGAATTGTATGGGTTGTGGGG + Intronic
1094392746 12:29970357-29970379 GCTGAGTTCTGGGCCTGGTGGGG + Intergenic
1096974391 12:55691302-55691324 GCTGGAGTGGAGGCGGGGTGTGG + Intronic
1100673842 12:96845542-96845564 CCTGAATTGTGGTGGTGGTGGGG - Intronic
1102656516 12:114486396-114486418 GCTGAATAGTATGGGTGGTATGG + Intergenic
1112118217 13:96380972-96380994 GCTGAATTCAAGAAGTGGTGTGG + Intronic
1113506283 13:110818937-110818959 CCTGAATTGGGGGCGTTGTGAGG - Intergenic
1113984563 13:114303493-114303515 GCAGAATTGTCGGCCCGGTGCGG + Intronic
1114228132 14:20757209-20757231 ACAGTATTGTAGGCCTGGTGAGG - Intergenic
1115441107 14:33436966-33436988 GCAAAATTGTAGGGGTAGTGTGG - Intronic
1116150486 14:41134927-41134949 ACTGAACTGTAAGAGTGGTGGGG - Intergenic
1119034356 14:71217161-71217183 GCAGAAGTGCAGGTGTGGTGTGG + Intergenic
1123008346 14:105335141-105335163 GCTGACTGGAATGCGTGGTGTGG + Intronic
1123481196 15:20633181-20633203 GTTGAATAGGAGGAGTGGTGAGG - Intergenic
1123636816 15:22367184-22367206 GTTGAATAGGAGGAGTGGTGAGG + Intergenic
1123724724 15:23090641-23090663 GATGAATTTTAGGCTGGGTGTGG - Intergenic
1128405358 15:67331808-67331830 GCTGAAATGTGGGTGTGGAGAGG - Intronic
1129506971 15:76089508-76089530 GCTGAATTGTAGAATTCGTGGGG + Intronic
1129640642 15:77373590-77373612 GCTGGGTTGTAGTGGTGGTGGGG - Intronic
1130524884 15:84696331-84696353 GCTGAATTGAAGACGTGGAGTGG + Intronic
1131026266 15:89144421-89144443 ACTGAATGGTAGGCCCGGTGTGG - Intronic
1132697956 16:1210272-1210294 GCTGAAGTGGAGGCGTGGCCAGG + Intronic
1132812343 16:1807224-1807246 TCTGAATGGTAGGGGTGGTGGGG - Intronic
1136656464 16:31712207-31712229 GCTGGATTGAAGGCCAGGTGGGG + Intergenic
1141689209 16:85587034-85587056 GCAGAATTGTGTGTGTGGTGGGG + Intergenic
1144567381 17:16371136-16371158 AATGAATTGTAGGCTGGGTGTGG - Intergenic
1144775762 17:17783764-17783786 GCTGAGGTGTAGGCGGGGGGCGG + Intronic
1146127136 17:30238527-30238549 CCTGAATTGGAGGCGGGGCGGGG - Intergenic
1148757037 17:49978675-49978697 GGGGAAGTGGAGGCGTGGTGAGG - Intergenic
1152187473 17:78866968-78866990 ACTGAATTGTAGGCCGGGCGCGG + Intronic
1160531176 18:79565645-79565667 GCTGATTTGTGTGTGTGGTGGGG + Intergenic
1161146157 19:2679596-2679618 TCTGGAATGTAGGCATGGTGAGG - Intronic
927871775 2:26628599-26628621 GCTGAATTGAGGGCGAGTTGAGG + Intronic
928409167 2:31041073-31041095 ACTGAATTGTAAGCTTTGTGAGG - Intronic
936807135 2:116348373-116348395 GCTGAAGTGTAGGATGGGTGTGG - Intergenic
942001856 2:171655471-171655493 GCTAAACTGGAGGAGTGGTGTGG - Intergenic
945819619 2:214647936-214647958 CCTGAATTCTAGGCTTGCTGTGG - Intergenic
1170602045 20:17848753-17848775 GCTAACCTGTAGGGGTGGTGAGG - Intergenic
1171060692 20:21956633-21956655 CCTGGACTGTAGGTGTGGTGTGG + Intergenic
1176003501 20:62846017-62846039 GCTGTTCTGTAGGCGTGTTGTGG + Intronic
1181489952 22:23255488-23255510 GCTGCATTGTGAGCGTGGTTTGG + Intronic
1182401673 22:30082498-30082520 GGGCAATTGAAGGCGTGGTGTGG + Intronic
1182514099 22:30843072-30843094 ACTGAATTGCAGGCCGGGTGCGG - Intronic
1184181714 22:42832693-42832715 GCTAAATAGTAGGCCCGGTGTGG + Intronic
1184902263 22:47453810-47453832 GCTGAATGTGAGGAGTGGTGAGG + Intergenic
951514318 3:23541693-23541715 GCTGAATTGGGGCGGTGGTGGGG - Intronic
953498850 3:43413326-43413348 GTTGAATTGTAATCCTGGTGGGG + Intronic
954180065 3:48874676-48874698 GCTGAATAGTAGTCATGGTATGG - Intronic
959773405 3:110126459-110126481 GCTGAATTGGAGACGTGCTTGGG + Intergenic
966573768 3:181476926-181476948 GCTGCATTGCAGGGTTGGTGGGG + Intergenic
969405908 4:6991645-6991667 GCTGTCTTGTTGGCGTGGTCTGG + Intronic
973375814 4:49285943-49285965 GCTGAAATCTGGGCGTGGTGGGG + Intergenic
973376714 4:49291962-49291984 GCTGAAATCTGGGCGTGGTGGGG + Intergenic
973377632 4:49298114-49298136 GCTGAAATCTGGGCGTGGTGCGG + Intergenic
973378552 4:49304250-49304272 GCTGAAATCTGGGCGTGGTGCGG + Intergenic
973380507 4:49317253-49317275 GCTGAAATCTGGGCGTGGTGGGG - Intergenic
973381596 4:49324298-49324320 GCTGAAATCTGGGCGTGGTGGGG - Intergenic
973386116 4:49515370-49515392 ACTGAAATCTGGGCGTGGTGGGG - Intergenic
980604487 4:135071577-135071599 GCTAGATTGTAGGCGGGGTCGGG + Intergenic
989507839 5:42247896-42247918 GCTGTATAGGAGGCATGGTGAGG + Intergenic
989645902 5:43632338-43632360 GCTGGACTGAAGGCCTGGTGTGG + Intronic
989789370 5:45378243-45378265 GCTGAATGGTAGGGTTGATGAGG - Intronic
991714449 5:69438236-69438258 ACTGAATTTAAGGAGTGGTGAGG - Intronic
994844367 5:104967942-104967964 GCTGACTTGTGTGTGTGGTGGGG - Intergenic
998393141 5:141800644-141800666 GCTGACTTGGAGGCATGGTCAGG + Intergenic
999734782 5:154505003-154505025 TCTTAATTGTAGGCCGGGTGCGG - Intergenic
1001870675 5:175151734-175151756 GCTGAATTTTAGCCTTTGTGAGG - Intergenic
1002475391 5:179462191-179462213 CCTGCAGTGTGGGCGTGGTGGGG - Intergenic
1008055693 6:46943882-46943904 GCTGAATTGTACCCTTGGTCTGG - Intronic
1013164155 6:107574848-107574870 GCTGAAACGGAGGGGTGGTGAGG - Intronic
1015978424 6:138814772-138814794 GCTGAAGTGAAGCCGTGGGGAGG + Intronic
1016137107 6:140557378-140557400 GCTGGATTGTAAGCCTGATGTGG + Intergenic
1016354059 6:143198693-143198715 GCTTAAATGCAGACGTGGTGTGG - Intronic
1020253989 7:6491523-6491545 TCTGAATTGGAGGAGTGGGGAGG + Intergenic
1023719955 7:43082874-43082896 GATGTATTGTAGGCCAGGTGTGG + Intergenic
1026049231 7:66931010-66931032 GATGAATGGTGGGCCTGGTGTGG + Intronic
1029945357 7:104527235-104527257 GCTGCATTCTAGTTGTGGTGAGG + Intronic
1030195589 7:106850360-106850382 GCTGGATTGTGGGGGTGCTGAGG - Intergenic
1031199335 7:118659822-118659844 GGGGAATTGTAGGCTTTGTGGGG - Intergenic
1039098565 8:33914553-33914575 GCTGAGTGGTAAGCCTGGTGTGG - Intergenic
1040779702 8:51093295-51093317 GCAGAAATTTAGGCCTGGTGCGG - Intergenic
1042998874 8:74732883-74732905 GCTGACTTGTAGGCTTGGGTAGG + Intronic
1044078223 8:87850244-87850266 GTTGAAATGTAGTAGTGGTGAGG - Intergenic
1049414242 8:142488099-142488121 GCTGAATTGGAGCCTCGGTGAGG - Intronic
1049604291 8:143521848-143521870 GCTGCATTGTTGGGATGGTGGGG - Intronic
1049775352 8:144401408-144401430 GGTGAGTGGTAGGCTTGGTGGGG - Exonic
1056780242 9:89543776-89543798 GCTGGGTTGCAGGCGTGGAGCGG - Intergenic
1203548729 Un_KI270743v1:151420-151442 GCTGAAATCTGGGCGTGGTGGGG + Intergenic
1203549688 Un_KI270743v1:156985-157007 GCTGAAATCTGGGCGTGGTGGGG - Intergenic
1186701307 X:12093062-12093084 GCTTAATTGTAGGAGTGGTAAGG + Intergenic
1191979907 X:66914127-66914149 GCTGAAGAGGAGGGGTGGTGGGG + Intergenic
1198202314 X:134434114-134434136 GGTGAATTCTAGGCATGGGGAGG - Intergenic
1198716330 X:139561586-139561608 GCTGCATTGTAGTTGTGGTGAGG - Exonic