ID: 1084194460

View in Genome Browser
Species Human (GRCh38)
Location 11:67516553-67516575
Sequence CAGGCTGAGGCCTGGGGAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084194443_1084194460 30 Left 1084194443 11:67516500-67516522 CCTGATTCAGACCACCCCACAGC No data
Right 1084194460 11:67516553-67516575 CAGGCTGAGGCCTGGGGAGGTGG No data
1084194446_1084194460 15 Left 1084194446 11:67516515-67516537 CCCACAGCCACTCCCAGTTCTCT No data
Right 1084194460 11:67516553-67516575 CAGGCTGAGGCCTGGGGAGGTGG No data
1084194445_1084194460 16 Left 1084194445 11:67516514-67516536 CCCCACAGCCACTCCCAGTTCTC No data
Right 1084194460 11:67516553-67516575 CAGGCTGAGGCCTGGGGAGGTGG No data
1084194450_1084194460 2 Left 1084194450 11:67516528-67516550 CCAGTTCTCTAGCCGCAGAGCCT No data
Right 1084194460 11:67516553-67516575 CAGGCTGAGGCCTGGGGAGGTGG No data
1084194447_1084194460 14 Left 1084194447 11:67516516-67516538 CCACAGCCACTCCCAGTTCTCTA No data
Right 1084194460 11:67516553-67516575 CAGGCTGAGGCCTGGGGAGGTGG No data
1084194444_1084194460 19 Left 1084194444 11:67516511-67516533 CCACCCCACAGCCACTCCCAGTT No data
Right 1084194460 11:67516553-67516575 CAGGCTGAGGCCTGGGGAGGTGG No data
1084194452_1084194460 -10 Left 1084194452 11:67516540-67516562 CCGCAGAGCCTGCCAGGCTGAGG No data
Right 1084194460 11:67516553-67516575 CAGGCTGAGGCCTGGGGAGGTGG No data
1084194448_1084194460 8 Left 1084194448 11:67516522-67516544 CCACTCCCAGTTCTCTAGCCGCA No data
Right 1084194460 11:67516553-67516575 CAGGCTGAGGCCTGGGGAGGTGG No data
1084194449_1084194460 3 Left 1084194449 11:67516527-67516549 CCCAGTTCTCTAGCCGCAGAGCC No data
Right 1084194460 11:67516553-67516575 CAGGCTGAGGCCTGGGGAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084194460 Original CRISPR CAGGCTGAGGCCTGGGGAGG TGG Intergenic
No off target data available for this crispr