ID: 1084194674

View in Genome Browser
Species Human (GRCh38)
Location 11:67517766-67517788
Sequence CTCAATCCCCAGTGCAGCAA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084194668_1084194674 29 Left 1084194668 11:67517714-67517736 CCCGCGTGCTGTGGCTCTGATGT No data
Right 1084194674 11:67517766-67517788 CTCAATCCCCAGTGCAGCAACGG No data
1084194670_1084194674 0 Left 1084194670 11:67517743-67517765 CCCCTCCAAAATGCATGTTGAAA 0: 7
1: 152
2: 637
3: 1964
4: 2686
Right 1084194674 11:67517766-67517788 CTCAATCCCCAGTGCAGCAACGG No data
1084194673_1084194674 -5 Left 1084194673 11:67517748-67517770 CCAAAATGCATGTTGAAACTCAA No data
Right 1084194674 11:67517766-67517788 CTCAATCCCCAGTGCAGCAACGG No data
1084194672_1084194674 -2 Left 1084194672 11:67517745-67517767 CCTCCAAAATGCATGTTGAAACT No data
Right 1084194674 11:67517766-67517788 CTCAATCCCCAGTGCAGCAACGG No data
1084194671_1084194674 -1 Left 1084194671 11:67517744-67517766 CCCTCCAAAATGCATGTTGAAAC No data
Right 1084194674 11:67517766-67517788 CTCAATCCCCAGTGCAGCAACGG No data
1084194669_1084194674 28 Left 1084194669 11:67517715-67517737 CCGCGTGCTGTGGCTCTGATGTT No data
Right 1084194674 11:67517766-67517788 CTCAATCCCCAGTGCAGCAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084194674 Original CRISPR CTCAATCCCCAGTGCAGCAA CGG Intergenic
No off target data available for this crispr