ID: 1084195093

View in Genome Browser
Species Human (GRCh38)
Location 11:67520038-67520060
Sequence CTTCCGGGAGGTGCGGCCAC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 3, 3: 8, 4: 112}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084195093_1084195099 -5 Left 1084195093 11:67520038-67520060 CCAGTGGCCGCACCTCCCGGAAG 0: 1
1: 0
2: 3
3: 8
4: 112
Right 1084195099 11:67520056-67520078 GGAAGGCGTCCCGTAGCTCCCGG 0: 1
1: 0
2: 0
3: 2
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084195093 Original CRISPR CTTCCGGGAGGTGCGGCCAC TGG (reversed) Exonic
900582170 1:3414690-3414712 CAGCCGGGAGATGGGGCCACTGG - Intronic
901058502 1:6460742-6460764 CTTGAGGGAGGTGGGGCCAGAGG - Exonic
901341936 1:8502574-8502596 CTTCTGGGAGGTGTGCCCAGCGG + Intronic
902385605 1:16073734-16073756 CTCCCGCGCGCTGCGGCCACAGG - Intergenic
904322535 1:29707106-29707128 CTGCGGGGAGGGGCGGCCCCAGG + Intergenic
905692598 1:39954578-39954600 CTTCTGGCAGGGGCAGCCACTGG + Intergenic
910124910 1:83829820-83829842 ATTCCTGGAGGAGAGGCCACTGG - Intergenic
910693757 1:89991049-89991071 CTTCCAGGAGATGCTGCCGCTGG - Intergenic
913057792 1:115178345-115178367 CTTCAGGGAGGTCAGGACACTGG + Intergenic
914994971 1:152535563-152535585 CCTCCAGGAGGAGCTGCCACCGG + Intronic
916496718 1:165354246-165354268 CTTCCGAGAGGCCCGGCCACCGG + Intronic
920214368 1:204351382-204351404 CTTCCTGGAGGTGAGGCGACCGG - Intronic
1065553618 10:26892792-26892814 CTTCCGGAAGCTGCAGCCAAGGG + Intergenic
1067054472 10:43042895-43042917 CCTCCAGGGGCTGCGGCCACTGG - Intergenic
1067789652 10:49278161-49278183 CTTCCTGCAGATGAGGCCACTGG + Intergenic
1071288787 10:84173190-84173212 CTTAAAGGAGGTGGGGCCACAGG - Intergenic
1071579372 10:86756195-86756217 CTGCCGGGCGCTGCGGCCATCGG - Intergenic
1073995906 10:109315121-109315143 CTTACTGGATGTGGGGCCACTGG + Intergenic
1077230020 11:1454599-1454621 CTTCCTGTCGGTGAGGCCACAGG + Exonic
1082271175 11:50170585-50170607 TCTCCTGGAGGTGCAGCCACAGG - Intergenic
1083852598 11:65376932-65376954 CTTCCGGGAGGAGGGGCCCCGGG - Exonic
1084195093 11:67520038-67520060 CTTCCGGGAGGTGCGGCCACTGG - Exonic
1084978083 11:72814250-72814272 CCTCCGGGAGGAGCCGCCTCCGG - Intergenic
1088604250 11:111512909-111512931 CGTCCGGGAGCTGCAGCCGCGGG + Intergenic
1089207110 11:116773089-116773111 CGGCTGGCAGGTGCGGCCACCGG + Intergenic
1089846333 11:121461420-121461442 CTACCAGGAGGTGAGGCAACAGG - Intronic
1091139414 11:133222450-133222472 CGTCAGTGAGGAGCGGCCACAGG - Intronic
1091617006 12:2057382-2057404 CTTCCAGTAGGTGGCGCCACAGG + Intronic
1096535627 12:52270867-52270889 CTTCCTGTAGCTGCTGCCACAGG - Intronic
1096995089 12:55833363-55833385 CTTCCTGGAGGGGCTGGCACTGG + Intergenic
1101130243 12:101682641-101682663 CTTCCTGGAGGGGCAGCAACAGG + Exonic
1102465849 12:113130551-113130573 CTGCCGGGTGCTGCGGGCACTGG - Intronic
1103595346 12:122021795-122021817 CCTCCGGGCGCCGCGGCCACCGG - Exonic
1105005735 12:132719458-132719480 CCTCCGGGTGGTGTGGCCTCAGG + Intronic
1106036103 13:26046876-26046898 CCCCCGGGAGGTGCTGGCACTGG + Exonic
1113393108 13:109916715-109916737 CTTCCGGTAGCTGGGACCACAGG + Intergenic
1113527360 13:110991683-110991705 CTTCCGGGAGGTGCGGCCCTGGG + Intergenic
1113713199 13:112484389-112484411 CTTCCGGGAGGTGCGGCCCTGGG - Intergenic
1114267513 14:21081622-21081644 CTTCCAGGAGATGCGGGCCCTGG + Exonic
1114495093 14:23126796-23126818 CTTCAGAGAGGAGAGGCCACAGG - Exonic
1114636126 14:24187886-24187908 CTTTCAGGAGGTGTGGGCACAGG + Intronic
1122070998 14:99205261-99205283 CTTCATGGAGGTGTGGCCACAGG + Intronic
1122691661 14:103534638-103534660 CACCCTGGAGGTGCTGCCACAGG + Exonic
1126436978 15:48646190-48646212 CTACCGGGAGGCGCGGGCAGCGG - Intergenic
1129424719 15:75455043-75455065 CTTGCGGGAGGGGCGGCCGGGGG - Intronic
1132771618 16:1566843-1566865 CGCCAGGGAGGTGGGGCCACTGG - Intronic
1135068871 16:19335024-19335046 CTGCAGTGAGGTGCGGCCATGGG - Intergenic
1142123797 16:88400281-88400303 CTTTCAGCAGGTGGGGCCACAGG - Intergenic
1142335830 16:89489684-89489706 CTGCCGGGAGGGGCTGCCAGGGG - Intronic
1142415031 16:89936584-89936606 GGTCAGGGAGATGCGGCCACAGG + Intergenic
1142625455 17:1188862-1188884 CTTCTGGGAGGGGCAGCCAGAGG - Intronic
1143508805 17:7384176-7384198 CTTCGGGCTGGTGCGGCCTCTGG + Exonic
1143731817 17:8886000-8886022 GATACGGGAGGTGGGGCCACGGG - Intronic
1143731846 17:8886064-8886086 TTACCGGGAGGTGGGGCCATGGG - Intronic
1144759412 17:17698881-17698903 CTTGAGGGAGGTGTGGCCAAAGG + Intronic
1146655059 17:34630157-34630179 CATCCTGGAGGTGGGGCCCCTGG + Intronic
1147955352 17:44130613-44130635 CTTCTGGGACATTCGGCCACTGG - Intergenic
1150675898 17:67245597-67245619 CTTCCTGGAAGCGCGGCCGCAGG - Intronic
1157687029 18:49650945-49650967 CTGCCGGCAGGTGCGGCGGCTGG + Intergenic
1160895510 19:1400254-1400276 CTTCCTGGAGGAGGGGGCACAGG + Intronic
1161752835 19:6110259-6110281 CGTCCGGGTGGTGCGCCCGCGGG - Intronic
1161976952 19:7612401-7612423 CTTCCTGCAGGTGCAGCCGCGGG + Exonic
1163695543 19:18761610-18761632 CTTTTGGGAGGGGCGGCCACTGG + Intronic
1165148902 19:33749722-33749744 CCTCAGGGAGGTGCACCCACTGG - Intronic
1165319300 19:35075806-35075828 CTTCCAGGAGGTGCTGGCCCTGG + Intergenic
1165800789 19:38548386-38548408 CTTCTTGGAGATGAGGCCACGGG - Exonic
1166760082 19:45218609-45218631 CTTCCTGGAGGAGGGGACACCGG + Intronic
925047064 2:780520-780542 CTTCCAGCAAGTGCAGCCACAGG + Intergenic
925126672 2:1461916-1461938 GTTCCGGGGGGTCCGGGCACTGG + Intronic
932779916 2:74553623-74553645 CCTCCGGGAGGCGCTGCCCCTGG - Intronic
934742810 2:96738055-96738077 CTTCCTGTAGGTGTGGGCACAGG - Exonic
937966479 2:127515392-127515414 CTCTCTGGAGGTGTGGCCACAGG + Intronic
947741437 2:232486742-232486764 CTTCCCGCAGCTGCGGCCCCAGG - Exonic
1173704645 20:45100920-45100942 CGCCCGGGAGGTGCCACCACAGG - Exonic
1175263661 20:57689931-57689953 CTGCCGGGCGATGCAGCCACTGG - Intronic
1176145811 20:63564954-63564976 CGTCCGGGAGGTGCTGCCTGAGG - Exonic
1176367107 21:6039916-6039938 CTTCCGGGAGGTCCCTGCACTGG + Intergenic
1176378874 21:6101836-6101858 CTTCAGGTAGGAGCGGCCAGAGG + Intergenic
1179408218 21:41142660-41142682 ATACGGGCAGGTGCGGCCACAGG - Intergenic
1179744600 21:43436401-43436423 CTTCAGGTAGGAGCGGCCAGAGG - Intergenic
1179756412 21:43498630-43498652 CTTCCGGGAGGTCCCTGCACTGG - Intergenic
1180157383 21:45984106-45984128 CTTCCAGGAGGGCCGGCCTCAGG + Intronic
1183201290 22:36387397-36387419 CTTCCGGGAGCCGCGGCCCCTGG - Intronic
1183306295 22:37084872-37084894 CTGCTGGGAGGTGCAGCCAGGGG - Intronic
1183334851 22:37240757-37240779 CTTCCCGGAGGAGGGGGCACTGG + Intronic
1183640670 22:39090630-39090652 CCTCGGGGAGGTGATGCCACCGG + Intergenic
1183738046 22:39654702-39654724 CTTCCTGGAGGTGATGGCACTGG + Intronic
1184113983 22:42411478-42411500 CTGCCGGGAGCATCGGCCACTGG - Exonic
1184631315 22:45782489-45782511 CTTCTGGGAGGTGCAGCAGCTGG + Intronic
950576304 3:13834078-13834100 CTTCTGGGAGCTGTGACCACAGG - Intronic
951407251 3:22316114-22316136 CTTCCGGGTGAGGGGGCCACAGG - Intronic
951411536 3:22372553-22372575 CATCCGGGAGGAGCAGCCGCCGG + Intronic
951465044 3:22991537-22991559 CTTCCAGGAAGTGAGGACACCGG - Intergenic
952327544 3:32334915-32334937 CTTCCAGAAGGTGAGGCCAAGGG + Intronic
955002404 3:54939497-54939519 CTTCAGGGAGGCAGGGCCACAGG + Intronic
961674301 3:128555496-128555518 CTTCCTGGCGGGGCGGCCGCGGG - Intergenic
966879921 3:184344514-184344536 GGTCCTGGAGGTGCGGCCCCAGG - Exonic
967527691 3:190513936-190513958 CTTCCAGGAGCTGCGGCCGCGGG - Intergenic
978605726 4:110476807-110476829 TCTCCCGGAGGTGCAGCCACAGG - Exonic
985646116 5:1085520-1085542 CTTGCGGGAGGGACGGGCACTGG - Intronic
985688610 5:1294917-1294939 CTACCGCGAGGTGCTGCCGCTGG - Exonic
985975624 5:3417457-3417479 CCTCCGGACAGTGCGGCCACGGG - Intergenic
992939755 5:81750790-81750812 TTCCCGGGAGGTGCGGGCGCTGG - Intronic
1006155272 6:32010155-32010177 ATTCCAGGAGGTGCTGCCTCTGG - Intergenic
1006161578 6:32042889-32042911 ATTCCAGGAGGTGCTGCCTCTGG - Intronic
1006364983 6:33610029-33610051 CTGCTGGGAGGGGCTGCCACAGG - Intergenic
1006389546 6:33750445-33750467 CTTCCTGGAGGTGGTGACACTGG - Intergenic
1007133544 6:39499273-39499295 CTTCCTGGAGGTGGTGGCACAGG + Intronic
1017716692 6:157218142-157218164 CTTCCAGGAGATGCTGCCACAGG + Intergenic
1019861755 7:3665290-3665312 GTTCCTGTAGGTGAGGCCACGGG - Intronic
1021528732 7:21618905-21618927 CTTCCGGCAGGTGACGCCTCAGG + Intronic
1029161622 7:98556523-98556545 CTTCCTGGAAGCGCGGTCACTGG + Intergenic
1029686716 7:102153485-102153507 CTTCCGGGAGCAGCAGCAACAGG - Intronic
1032791545 7:135246519-135246541 CCTCCGAGAGGTTCTGCCACAGG - Exonic
1034436780 7:151066374-151066396 CTCCCGGGAGGTGCGGGCACGGG - Intronic
1034879589 7:154753061-154753083 CCTCCAGGAAGTGTGGCCACTGG + Intronic
1035892139 8:3356958-3356980 ATTCTGGGAGCTGCGGCCCCTGG + Intronic
1049180643 8:141220405-141220427 CGTAGGTGAGGTGCGGCCACTGG - Intronic
1049312047 8:141938477-141938499 CTACCGTGAGCTGAGGCCACCGG - Intergenic
1058053233 9:100427087-100427109 CTTCCCCGAGCTGCGGCCGCCGG - Intergenic
1060733988 9:126054833-126054855 CTTCCAGGAGGTCAGTCCACTGG - Intergenic
1061964652 9:134006152-134006174 CTTCCTGGATGCGCTGCCACAGG + Intergenic
1188037760 X:25337995-25338017 CTTGTGGGAGGGGCAGCCACTGG - Intergenic
1190489840 X:50970460-50970482 CTACCTGTAGGTGCTGCCACTGG + Intergenic