ID: 1084195314

View in Genome Browser
Species Human (GRCh38)
Location 11:67521196-67521218
Sequence GGGTCCAGGCCAGGATCAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 544
Summary {0: 1, 1: 0, 2: 2, 3: 39, 4: 502}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084195314_1084195320 -4 Left 1084195314 11:67521196-67521218 CCCCCTGATCCTGGCCTGGACCC 0: 1
1: 0
2: 2
3: 39
4: 502
Right 1084195320 11:67521215-67521237 ACCCGCCTACCCTTCTCCCTTGG 0: 1
1: 0
2: 0
3: 14
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084195314 Original CRISPR GGGTCCAGGCCAGGATCAGG GGG (reversed) Intronic
900160079 1:1219267-1219289 GGGTCCAGGCCATGTCCTGGGGG - Intronic
900184312 1:1325783-1325805 AGCTCCTGGCCAGGAGCAGGTGG - Intronic
900536527 1:3180564-3180586 AGACCCAGGCCAGCATCAGGAGG + Intronic
900837748 1:5018943-5018965 GTGTCAAGGGCAGGACCAGGCGG + Intergenic
902096238 1:13948275-13948297 GTGTCAAGGGCAGGACCAGGTGG + Intergenic
902421792 1:16286517-16286539 GTGTCAAGGGCAGGACCAGGTGG - Intronic
902871137 1:19314237-19314259 GGGTCCTGTCCAAGGTCAGGGGG + Intronic
903131729 1:21283995-21284017 GGTACTAGGCCAGGATCAGGAGG + Intronic
903937668 1:26907807-26907829 GAGTCATGGCCAGGATCAAGCGG - Intronic
904384849 1:30134579-30134601 GGATTCAGGGCAGGAGCAGGGGG - Intergenic
904627283 1:31814247-31814269 GGCTCCAGCACAGGACCAGGAGG - Exonic
904686645 1:32265696-32265718 TGGTCCAGGCTGGGGTCAGGTGG - Intronic
904832944 1:33316857-33316879 GGGCCCAGGCCTAGACCAGGTGG + Intronic
904885351 1:33733594-33733616 GTGTCAAGGGCAGGACCAGGTGG + Intronic
905229766 1:36507778-36507800 TGGTCCACGCCAGGCTCAGAGGG + Intergenic
905292495 1:36931980-36932002 GGGGGCAGGACAGGATGAGGAGG - Intronic
905546245 1:38802423-38802445 GGATCCAGGCCAGTAGCATGAGG + Intergenic
905881875 1:41469177-41469199 AGGTCCAGGCCAGGGGCAGATGG + Intergenic
905928065 1:41766072-41766094 GAGTCCTGGGCAGGTTCAGGTGG + Intronic
906380190 1:45327634-45327656 GGGTGCAGGCCAAGGTCAGGTGG - Exonic
906651520 1:47516227-47516249 GTGTCAAGGGCAGGACCAGGTGG + Intergenic
907308946 1:53528550-53528572 GGGGCCAGGCCAGGCCCTGGGGG - Intronic
907819602 1:57954043-57954065 GGGTCCTGGCAAGGAACAGATGG - Intronic
913326165 1:117630606-117630628 GGCTCCAGGCCAAGGTAAGGTGG - Intergenic
914915854 1:151818801-151818823 GTGTCCAGGCCAGGGACTGGAGG - Intronic
915754724 1:158248812-158248834 GGGTACAGGGCAGGATCTGAAGG - Intergenic
917075658 1:171201927-171201949 GTGTCAAGGGCAGGACCAGGTGG - Intronic
917248191 1:173027545-173027567 GTGTCAAGGGCAGGACCAGGTGG + Intergenic
917665501 1:177221766-177221788 AGTTCCAGGACACGATCAGGTGG + Intronic
917861237 1:179146607-179146629 GTGTCAAGGGCAGGATCAGGCGG + Intronic
918230767 1:182529044-182529066 GTGTCAAGGGCAGGACCAGGTGG - Intronic
919730219 1:200908933-200908955 GAGTCCAGGTCAGGATCAGGGGG + Exonic
920198932 1:204247511-204247533 GGGTCCATTGCAGGATAAGGAGG - Intronic
920962166 1:210673120-210673142 GGGTGCCGGGCAAGATCAGGAGG - Intronic
922232569 1:223699656-223699678 GGGCCTAGGAAAGGATCAGGAGG - Intergenic
922571112 1:226635133-226635155 GTGTGCAGGCCAGAGTCAGGGGG - Intronic
923861568 1:237897101-237897123 GTGTACAGCCCAGGATCAGTGGG - Intergenic
924351362 1:243117682-243117704 GTGTCAAGGGCAGGACCAGGTGG - Intergenic
924953518 1:248906645-248906667 GGGACCAGGGCAGGCTCGGGCGG + Intronic
1063616200 10:7602409-7602431 GTGTCAAGGGCAGGAGCAGGTGG + Intronic
1063951190 10:11224905-11224927 GAGCCAAGGCCAGGATCAGAGGG + Intronic
1064249194 10:13693849-13693871 GGGTCCCAGCCATGCTCAGGGGG + Intronic
1065830776 10:29611887-29611909 GGGGCCACGCCAGAACCAGGGGG + Intronic
1067078915 10:43203005-43203027 GGGTCCAGGGTGGGACCAGGGGG - Intronic
1069217340 10:65838600-65838622 GTGTCGAGGGAAGGATCAGGTGG - Intergenic
1069605828 10:69738048-69738070 GGGTGCAGGGCAAGATCAGGAGG + Intergenic
1070711529 10:78686662-78686684 GGGTCAGGGTCAGGGTCAGGTGG + Intergenic
1071044434 10:81356398-81356420 GTGTCGAGGGCAGGACCAGGTGG + Intergenic
1072633632 10:97163895-97163917 GGGGACCGGCCAGTATCAGGGGG + Intronic
1073588143 10:104730877-104730899 GTGTCAAGGGCAGGACCAGGTGG - Intronic
1074298467 10:112212126-112212148 GGGTCCAGTCAAGGAAGAGGGGG + Intronic
1074526205 10:114265524-114265546 GGGCCCTGGCCAGGATCAGTGGG + Intronic
1074733139 10:116398655-116398677 TTGGCCAGGCCAGGCTCAGGGGG + Intergenic
1075682449 10:124342420-124342442 CTGTCCAGTCCAGGAGCAGGAGG + Intergenic
1075822665 10:125328104-125328126 GTGTCAAGGGCAGGTTCAGGTGG + Intergenic
1075978898 10:126720292-126720314 GGTTCCAGGACAGCATCTGGTGG - Intergenic
1076098621 10:127755222-127755244 GGGTCCAGCTCTGAATCAGGTGG - Intergenic
1076532256 10:131152968-131152990 GTGTCAAGGGCAGGAGCAGGTGG - Intronic
1076789624 10:132769834-132769856 CGGTACAGCCCAGGCTCAGGTGG + Intronic
1076815558 10:132913110-132913132 GCCGCCCGGCCAGGATCAGGTGG + Exonic
1076907911 10:133372688-133372710 GGGTGCGGGCCAGGGTCAGGTGG + Intronic
1077407970 11:2391105-2391127 GGGGCAAGGCCAGGAGGAGGAGG + Intronic
1077672174 11:4166774-4166796 GGGTCCATGCCAGGGCCAAGAGG - Intergenic
1077761078 11:5099171-5099193 GTGTCAAGGGCAGGACCAGGTGG + Intergenic
1078080939 11:8204425-8204447 GGTTCCAGGCAAGGACCAGATGG - Intergenic
1078101279 11:8331813-8331835 GGGTCCAGGCCAGCTTGGGGGGG + Intergenic
1078446754 11:11410341-11410363 GGGTGCTGGCAAGGAGCAGGTGG - Intronic
1079016127 11:16870339-16870361 GGGTCTAGGGCAGGATGTGGTGG + Intronic
1079080121 11:17408196-17408218 GTGCCCAGGGCAGAATCAGGTGG - Intronic
1079118450 11:17656489-17656511 GGGTGATGGCCAGGAACAGGTGG + Intergenic
1079127467 11:17728550-17728572 GTGTCAAGGGCAGGACCAGGTGG + Intergenic
1081577503 11:44328344-44328366 GGGGCCAGGCCAGGGTGAAGGGG - Intergenic
1081613770 11:44578751-44578773 AGGTCCAGGACTGGACCAGGGGG + Intronic
1081867688 11:46368542-46368564 GGGTCAAGGCCAGGGGCAGAAGG + Intronic
1083072536 11:60000469-60000491 GGGTACATGCCAGGAACAGAAGG + Intergenic
1083702151 11:64486635-64486657 GGGGCCAGGGCAGGATGGGGAGG + Intergenic
1083712813 11:64559431-64559453 GGAACCAGGCCAGGGTCTGGGGG - Intronic
1084172591 11:67407673-67407695 GGGGCCAGGCCAAGAACAGGAGG + Intronic
1084195314 11:67521196-67521218 GGGTCCAGGCCAGGATCAGGGGG - Intronic
1084218585 11:67664653-67664675 GGCTCCAGGCCAGGATCCCAAGG + Intronic
1084351319 11:68601988-68602010 GGGTACACGCCAGGGTCACGTGG + Intronic
1084589004 11:70079364-70079386 GCGCCCAGGCCTGGTTCAGGTGG + Intronic
1084646716 11:70463393-70463415 GAGTGCAGGCCAGGCTCAGAAGG + Intergenic
1084785397 11:71438962-71438984 GGGTCCAGGCGACGATCCCGGGG + Exonic
1084962816 11:72726231-72726253 GGGTCCATGCCGGCATCAAGAGG - Intronic
1085457787 11:76675017-76675039 GAGCCAAGGCCAGGATGAGGTGG + Intergenic
1085475951 11:76788997-76789019 GGGAGCAGGCCAGGGGCAGGCGG + Intronic
1086032181 11:82373377-82373399 TGCTCCAGGCCAAGATGAGGTGG - Intergenic
1086265941 11:84998239-84998261 GTGTCAAGGGCAGGACCAGGTGG + Intronic
1086791419 11:91043342-91043364 GTGTCAAGGACAGGACCAGGTGG - Intergenic
1087482593 11:98719996-98720018 GTGTCAAGGGCAGGACCAGGTGG - Intergenic
1088579348 11:111300104-111300126 GGGGCCAGGCCTGGGGCAGGGGG - Intronic
1089367803 11:117931780-117931802 AGGGCCAGGCCAGGGTCAGTGGG - Intergenic
1089385649 11:118065928-118065950 GTGACCAGGCTAGAATCAGGAGG + Intergenic
1091285769 11:134408120-134408142 GGGTCCAGCCCAGAGTCTGGAGG + Intronic
1091447371 12:551723-551745 GGTTTCAGGAGAGGATCAGGTGG + Intronic
1091986367 12:4912311-4912333 GGGTCTGGCCCAGGATCTGGAGG - Exonic
1092177328 12:6419161-6419183 GCGTCCAGGCCAGGGGCAGTTGG + Intergenic
1092613042 12:10191505-10191527 GATTTCAGGCCAGGAGCAGGGGG - Exonic
1093440133 12:19185303-19185325 TGGTCAATGACAGGATCAGGAGG - Intronic
1095351953 12:41223870-41223892 GGGTCCAGGGCAGGGTTAGAGGG + Intronic
1095492803 12:42752949-42752971 GTGTCAAGGGCAGGACCAGGTGG + Intergenic
1096194724 12:49642522-49642544 GTGTCCAGGCCAGGCTGAGTGGG + Exonic
1096217838 12:49808356-49808378 GGGGTCAGCCCAGGATGAGGGGG + Intronic
1096840746 12:54378249-54378271 TGCTCCAGGCCAAGGTCAGGAGG + Intronic
1097717250 12:62980058-62980080 GTGTCAAGGGCAGGACCAGGTGG + Intergenic
1099342865 12:81460165-81460187 GTGTCAAGGGCAGGAACAGGTGG + Intronic
1100655874 12:96644807-96644829 GTGTCAAGGGCAGGACCAGGTGG - Intronic
1100759924 12:97796159-97796181 GTGTCAAGGCCAAGACCAGGTGG - Intergenic
1100821817 12:98438922-98438944 GGGTCCAGTCAGGGAGCAGGGGG + Intergenic
1101094808 12:101327162-101327184 GGGTCCCGGCCAGGAACCGCAGG - Exonic
1102011051 12:109618536-109618558 GGGTACAGGGCAGGAGGAGGAGG + Intergenic
1102397657 12:112601070-112601092 GTGTCAAGGGCAGGACCAGGTGG - Intronic
1102533882 12:113566917-113566939 GGGTACAGCCCTGGAGCAGGAGG + Intergenic
1102559857 12:113754413-113754435 TGTTCCAGGCCAGGAACAGCAGG + Intergenic
1103270772 12:119671618-119671640 GTGTCAAGGGCAGGACCAGGTGG - Intronic
1103919984 12:124394299-124394321 TGGGCCAGGCCAAGGTCAGGGGG + Intronic
1104608501 12:130207240-130207262 GTGTCAAGGGCAGGACCAGGTGG + Intergenic
1106040398 13:26084685-26084707 GTGTCCAGGACAGGTTCAGAAGG + Intergenic
1106571155 13:30929258-30929280 GGGTCCAGGCCTGGAGAAGATGG - Intergenic
1107649996 13:42535497-42535519 GTGTCAAGGTCAGGGTCAGGTGG - Intergenic
1110169129 13:72479492-72479514 AGGTCAAGGGCAGGACCAGGTGG + Intergenic
1110283572 13:73723572-73723594 GGGCCCATGCCAGAATGAGGAGG - Intronic
1110359788 13:74611572-74611594 GTGTCAAGGGCAGGACCAGGTGG + Intergenic
1110366239 13:74688949-74688971 GGGCCCAGCCTAGGATCAGAAGG + Intergenic
1110492496 13:76125309-76125331 ATGTCAAGGGCAGGATCAGGTGG + Intergenic
1113813505 13:113156302-113156324 AGGTCAAGGGCAGGACCAGGTGG - Intergenic
1113900079 13:113791945-113791967 GGGTGCCGGCCTGGATCAGGGGG - Intronic
1113907896 13:113828828-113828850 TGGCCCAGGTGAGGATCAGGTGG - Intronic
1113907950 13:113829012-113829034 TGGCCCAGGTGAGGATCAGGTGG - Intronic
1113907973 13:113829104-113829126 TGGCCCAGGTGAGGATCAGGTGG - Intronic
1113908000 13:113829196-113829218 TGGCCCAGGTGAGGATCAGGTGG - Intronic
1113908057 13:113829425-113829447 TGGCCCAGGTGAGGATCAGGTGG - Intronic
1113908082 13:113829516-113829538 TGGCCCAGGTGAGGATCAGGTGG - Intronic
1113908124 13:113829700-113829722 TGGCCCAGGTGAGGATCAGGTGG - Intronic
1113908137 13:113829746-113829768 TGGCCCAGGTGAGGATCAGGTGG - Intronic
1113908151 13:113829792-113829814 TGGCCCAGGTGAGGATCAGGTGG - Intronic
1114055738 14:18965861-18965883 GTGTCCAGGCCAGCAAGAGGGGG - Intergenic
1114106809 14:19435903-19435925 GTGTCCAGGCCAGCAAGAGGGGG + Intergenic
1114615568 14:24066397-24066419 GGGCCCAGGCCCAGACCAGGAGG + Exonic
1119961229 14:78859020-78859042 GTGTCAAGGGCAGGACCAGGTGG + Intronic
1120418072 14:84244658-84244680 GGGTCAAGGGGAGGACCAGGTGG - Intergenic
1120818237 14:88885201-88885223 GTGTCAAGGGCAGGACCAGGTGG - Intergenic
1122136124 14:99633893-99633915 GTGTCCGGGACAGGATCAGAAGG + Intergenic
1123011363 14:105351040-105351062 GGGGCCAGCCCAGGTTCGGGTGG - Intronic
1124022884 15:25939850-25939872 GGGTCCAGGCCTGGAGAATGGGG - Intergenic
1124664741 15:31582701-31582723 GGGTCAAGGGCAGGGCCAGGTGG - Intronic
1125091284 15:35795748-35795770 GTGTCAAGGGCAGGACCAGGTGG + Intergenic
1126437860 15:48654221-48654243 AGGTCCAGGCCATGCTCAAGGGG - Intergenic
1126494877 15:49279074-49279096 GTGTCAAGGGCAGGACCAGGTGG - Intronic
1129073701 15:72973438-72973460 GGGTACAGTCCAGGAAAAGGTGG + Intergenic
1129523267 15:76198910-76198932 GGGTCCAGGTCTGGAGCAGAGGG + Intronic
1130273630 15:82465234-82465256 GAGCCCAGACCAGGACCAGGAGG + Intergenic
1130465980 15:84192605-84192627 GAGCCCAGACCAGGACCAGGAGG + Intergenic
1130498283 15:84480931-84480953 GAGCCCAGACCAGGACCAGGAGG - Intergenic
1130588270 15:85197201-85197223 GAGCCCAGACCAGGACCAGGAGG + Intergenic
1130647887 15:85744705-85744727 GTGGGCTGGCCAGGATCAGGAGG - Exonic
1132335515 15:101046003-101046025 GTGTCCAGGCCAGGTTTAGATGG - Exonic
1132986339 16:2769479-2769501 GCGCTCAGGCCAGGACCAGGGGG + Intronic
1134264379 16:12680809-12680831 GGGTTCAGCCCAGGAGCACGTGG - Intronic
1135462578 16:22658032-22658054 GTGTCAAGGGCAGGACCAGGTGG + Intergenic
1136747256 16:32601745-32601767 GGGTCCAGGCCATGATTTAGAGG + Intergenic
1137021551 16:35432944-35432966 GGGCCCAGGGCATGAACAGGAGG - Intergenic
1137707106 16:50543272-50543294 ATGTCAAGGGCAGGATCAGGTGG + Intergenic
1137713868 16:50585694-50585716 GTGTCCAGCCCAGGAGGAGGAGG - Intronic
1137951778 16:52790841-52790863 GTGTCAAGGGCAGGACCAGGTGG + Intergenic
1139369559 16:66458376-66458398 AGATCCAGGCCTGTATCAGGTGG - Intronic
1139655856 16:68386963-68386985 GGACCCAGGCCAGGCGCAGGGGG + Intronic
1140068117 16:71626874-71626896 GGGTTCAGGCCACGAGAAGGGGG - Intronic
1140192555 16:72830278-72830300 TGGTCTAGGCCAGTACCAGGAGG - Intronic
1140357868 16:74321351-74321373 GGGTCCAGGCCCGGCTCACCTGG + Intergenic
1140510097 16:75500984-75501006 GGATCAAGGGCAGGACCAGGTGG + Intergenic
1140585606 16:76288062-76288084 GTGTCAAGGACAGGACCAGGTGG + Intronic
1140628363 16:76821992-76822014 GGGTCAAGGGCAGGGCCAGGGGG - Intergenic
1141237065 16:82228566-82228588 AGGTGCAGGCAGGGATCAGGTGG + Intergenic
1141352297 16:83309342-83309364 GGGTCCAGGTCAGTCTCTGGAGG + Intronic
1141436496 16:84002599-84002621 GGGGAGAGGCCAGGACCAGGAGG - Exonic
1141509864 16:84505126-84505148 GGCTCTAGGCCAGGACCAGCAGG - Intronic
1141747937 16:85938559-85938581 GGGGCCAGGGCAGGAACAGAAGG - Intergenic
1141965042 16:87436367-87436389 GGGTCCAGGGCAGGAGTAGAGGG - Intronic
1142145761 16:88492355-88492377 GGCCCCAGGCCAGGTTCAGAGGG - Intronic
1203049388 16_KI270728v1_random:860951-860973 GGGTCCAGGCCATGATTTAGAGG + Intergenic
1143153002 17:4818661-4818683 GGGATCAGGACAGAATCAGGAGG - Intronic
1143263657 17:5619537-5619559 GTGTCAAGGGCAGGACCAGGTGG - Intergenic
1144753945 17:17668347-17668369 GGGGCCAGGGCAGGAGCAGGAGG - Intergenic
1144760267 17:17703240-17703262 CTGTCCAGGTCAGGGTCAGGAGG + Intronic
1144855332 17:18264341-18264363 GGGGCCAGGCCAAGAGGAGGCGG - Exonic
1145001238 17:19306200-19306222 GAGCCAAGGCCAGGCTCAGGTGG + Intronic
1145909033 17:28532147-28532169 GGGGCCAGGCCGGGAGCTGGTGG - Intronic
1147016896 17:37499223-37499245 GTGTCAAGGGCAGGACCAGGTGG - Intronic
1147389241 17:40099260-40099282 GGGTCCAGCCCACGACCTGGTGG - Intronic
1147915489 17:43882979-43883001 GGGTCCAGGCCAGGGCTGGGGGG + Exonic
1148781464 17:50124299-50124321 GCGTGCAGGCCAGCATGAGGGGG + Intronic
1148993430 17:51686043-51686065 GGGTCAAGGGCAGGGCCAGGTGG + Intronic
1149122913 17:53191280-53191302 GTGTCAAGGCCAGGACCAGGTGG - Intergenic
1149442995 17:56690822-56690844 GGATCCAGGGCAGGAACATGTGG + Intergenic
1150700185 17:67440295-67440317 GGGTCAAGGCCAGGATTAGAAGG - Intronic
1151339866 17:73464226-73464248 GTGTCAAGGGCAGGACCAGGCGG + Intronic
1151349309 17:73522309-73522331 GCAGCCAGGCCAGGATGAGGTGG - Intronic
1151362173 17:73595611-73595633 GGGCCCAGGCCAGGCCCAGATGG + Intronic
1151478687 17:74357508-74357530 GGTTCCAGGCCAGGAACTGCAGG + Exonic
1151715992 17:75831326-75831348 GGGTCCAGAGCAGGGTCAGGAGG + Exonic
1151758825 17:76089392-76089414 GGGTACAGGCCAGGAGCTGGGGG - Intronic
1152137836 17:78515575-78515597 GGGTCCTGGCCAGCAACAGCAGG - Intronic
1152693363 17:81731939-81731961 AAATCCAGGCCAGGAGCAGGGGG - Intergenic
1152789857 17:82273165-82273187 GGGTTCTGGCCACGATCCGGCGG + Intronic
1153101845 18:1480540-1480562 GTGTCAAGGCCAGGACCTGGTGG - Intergenic
1155978226 18:32154625-32154647 GCGTCAAGGACAGGACCAGGTGG + Intronic
1157673632 18:49551574-49551596 GTGTCAAGGGCAGGACCAGGTGG - Intergenic
1158272021 18:55726680-55726702 AGGTCAAGGGCAGGACCAGGTGG - Intergenic
1159171872 18:64780873-64780895 GTGTCCAGGGCAGGGCCAGGTGG + Intergenic
1159455616 18:68657311-68657333 GTGTCAAGGCGAGGACCAGGTGG - Intergenic
1160243604 18:77140064-77140086 GTGTCAAGGCCAGGACGAGGTGG + Intergenic
1160732576 19:647984-648006 GGGTCCTGCCCTGGAACAGGCGG + Exonic
1160916076 19:1497330-1497352 GGGTCCAGGCAAGGCCCTGGGGG + Exonic
1160919482 19:1513095-1513117 GCGCCCAGGCCCGGGTCAGGAGG + Exonic
1161332949 19:3696931-3696953 GGCGCCAGGCCTGGCTCAGGGGG + Intronic
1161482786 19:4519170-4519192 GGGTCTCGGCAAGGAGCAGGGGG + Intergenic
1161653331 19:5498416-5498438 GGGCTCAGGCCAGGGTCAGCAGG - Intergenic
1162027182 19:7901002-7901024 GGGTCCAGGCCAGGAGATGGGGG + Exonic
1162809032 19:13153382-13153404 GGGTGCAGGCGAGGGTCAGAGGG - Exonic
1163255314 19:16152657-16152679 GGATCCAGGGCAGGGGCAGGTGG + Intronic
1163397347 19:17071449-17071471 GGGCTGAGGCCAGGACCAGGTGG + Intronic
1163572352 19:18089978-18090000 GGGCCCAGGCCAGGGTCAGCTGG + Intronic
1163632883 19:18426113-18426135 GGGGCCGGGGCAGGAACAGGAGG + Intronic
1164446779 19:28324430-28324452 GAGTTCAGGCCATGATGAGGAGG + Intergenic
1165121224 19:33560116-33560138 CAGCCCAGGCCAGGCTCAGGGGG + Intergenic
1165384369 19:35501840-35501862 GGGTCCAGGCCAGGCCCAGCAGG + Intronic
1165394968 19:35558949-35558971 GGCGCCAGGGCAGGATCTGGTGG - Intronic
1165746634 19:38233571-38233593 GGGTCCGGGCCGGGATTGGGGGG + Intergenic
1165804744 19:38573359-38573381 GGGTCCAGGCCTGGACTGGGTGG - Intronic
1165806623 19:38584544-38584566 GGGTCAGGGCCAGGATAGGGGGG - Intronic
1165806663 19:38584647-38584669 GGGTCAGGGCCAGGATAAGGGGG - Intronic
1166068982 19:40376902-40376924 GGGTCAGGGCCAGGGTCATGGGG + Intronic
1166069171 19:40377414-40377436 GGGTCAGGGCCAGGGTCGGGGGG + Intronic
1166346609 19:42170187-42170209 TGGGCCAGACCAGGATGAGGGGG - Intronic
1166873896 19:45885902-45885924 GGGGCCGGGCCTGGATCCGGCGG - Exonic
1167015515 19:46838584-46838606 GGGTCCGGGCCAGCATCCTGGGG - Intronic
1167375263 19:49107782-49107804 GGGGCCGGGCCTGGATGAGGTGG - Exonic
1167455656 19:49595791-49595813 GTGGCCAGGCCAGGAGGAGGGGG - Exonic
925052909 2:831115-831137 GGGTGCAGGCCAGCATGTGGGGG - Intergenic
925080603 2:1061160-1061182 GCGTCCAACCCAGGATCACGCGG - Intronic
925731714 2:6923702-6923724 GGGTCCAGGCCAGGTCCTGCAGG + Intronic
926612065 2:14956775-14956797 GTGTCAAGGGCAGGACCAGGTGG - Intergenic
927716425 2:25356153-25356175 GGGTGCTGGCCAGGCTCAGAGGG - Intergenic
928511845 2:32010341-32010363 GGGCCCAGCCCAGGAGGAGGCGG + Exonic
929444914 2:41994099-41994121 TGGTGCAGGCCAATATCAGGAGG + Intergenic
929824448 2:45299373-45299395 GGGTCCAGGCCAGGCCCTGTAGG - Intergenic
929868063 2:45735079-45735101 TGGGCCAGGCCAGCATCTGGTGG + Intronic
930748193 2:54906358-54906380 AGATCTCGGCCAGGATCAGGGGG + Intronic
930825514 2:55693295-55693317 GGGTCCGGGCCAGCATCCCGGGG + Intronic
932313001 2:70759223-70759245 GCTTCCAGGGCAGGATCTGGAGG - Intronic
932610898 2:73199257-73199279 TGGTCCAGACCAGGAACAAGTGG + Intergenic
932715556 2:74098984-74099006 GGGGCCTGGCCAGGACCTGGAGG - Intronic
932915568 2:75854727-75854749 GTGTCAAGGGCAGGACCAGGTGG + Intergenic
933566307 2:83954560-83954582 GGGTCCAGGCCACCATCAGAGGG + Intergenic
933790153 2:85877308-85877330 GGGTCCAGTCCAGGATCATTTGG + Intronic
934652603 2:96100992-96101014 AGGTCCTGGCTAGGCTCAGGTGG - Intergenic
936635343 2:114249928-114249950 GTGTCAAGGGCAGGACCAGGTGG + Intergenic
936805268 2:116324123-116324145 GTGTCAAGGGCAGGACCAGGTGG + Intergenic
936864091 2:117057044-117057066 GTCTCCAGGCCCTGATCAGGAGG - Intergenic
937889343 2:126925267-126925289 GTGTCAAGGGCAGGACCAGGTGG + Intergenic
937889604 2:126927172-126927194 GTGTCAAGGGCAGGACCAGGTGG + Intergenic
937904484 2:127046198-127046220 GGGCCCAGGCCAGGACAGGGTGG - Intergenic
938473916 2:131590464-131590486 GTGTCCAGGCCGGCATGAGGGGG - Intergenic
939759365 2:146155253-146155275 GTGTCAAGGGCAGGACCAGGTGG - Intergenic
940547043 2:155101647-155101669 GTGTCAAGGGCAGGGTCAGGTGG - Intergenic
941380263 2:164784033-164784055 GGAGCCAGGCCAGGAGAAGGAGG + Intronic
942381990 2:175401222-175401244 GTGTCAAGGGCAGGATCAGGTGG - Intergenic
943047187 2:182872974-182872996 GTGTCAAGGGCAGGACCAGGTGG + Intergenic
943145447 2:184038590-184038612 GGGTCTTGGCAAGGATCAGATGG + Intergenic
943232052 2:185266007-185266029 GTGTCAAGGGCAGGACCAGGTGG - Intergenic
943518642 2:188919250-188919272 GTGTCAAGGGCAGGACCAGGTGG - Intergenic
944557119 2:200898453-200898475 GGGTCAAGGGCGGGACCAGGTGG - Intronic
945042637 2:205755062-205755084 AGGTCCAGGCCAGGGTCAAAGGG - Intronic
945139502 2:206668767-206668789 GTGTCAAGGGCAGGACCAGGTGG + Intronic
945236079 2:207632811-207632833 GGGTCCTGGCCAGTATGATGTGG + Intergenic
945495151 2:210500172-210500194 GTGTCAAGGGCGGGATCAGGTGG - Intronic
946142148 2:217700493-217700515 GTGTCAAGGGCAGGACCAGGTGG + Intronic
946203132 2:218083217-218083239 TGGTCCAGGCCATGAAGAGGCGG + Exonic
946312812 2:218892392-218892414 GGGTAGGGGCCAGGAGCAGGAGG - Intronic
946394412 2:219435916-219435938 GGGTCCAGGGTAGGAGGAGGTGG + Intronic
947208132 2:227681214-227681236 GTGTCAAGGGCAGGACCAGGTGG - Intergenic
947324604 2:228960889-228960911 GTGTCAAGGGCAGGACCAGGTGG - Intronic
947653988 2:231810669-231810691 GGGTCCAGTCCTGGAGCAGCTGG + Intergenic
947831178 2:233142906-233142928 GGGTAGAGGCCAGGATGTGGAGG - Intronic
947904375 2:233749673-233749695 GTGTCAAGGACAGGATCTGGTGG + Intronic
948040354 2:234896656-234896678 CTGTCCAGGCCAGGATCACCTGG + Intergenic
948791645 2:240381636-240381658 AGGCCCAGGCCAGGATGAGAAGG + Intergenic
1169227329 20:3864845-3864867 GGGCCAAGGCCAGGGCCAGGTGG - Intronic
1169610768 20:7377838-7377860 GTGTCAAGGGCAGGACCAGGTGG + Intergenic
1169618283 20:7474923-7474945 GTGTCAAGGGCAGGACCAGGTGG + Intergenic
1169709990 20:8550343-8550365 GTGTCAAGGACAGGACCAGGTGG + Intronic
1170750493 20:19140665-19140687 GTGTCAAGGGCAGGAACAGGTGG - Intergenic
1170782339 20:19437229-19437251 GTGTCAAGGGCAGGACCAGGTGG + Intronic
1171469741 20:25360803-25360825 AGGTGGAGGCCAGGATCAGGCGG + Intronic
1172405692 20:34687264-34687286 GACTCCAGCCCAGGACCAGGAGG - Intergenic
1173226845 20:41167161-41167183 GAGTCCAGGCCAAGCCCAGGTGG - Intronic
1173747687 20:45450240-45450262 GGGCCCAGGCCCAGATCAGCCGG - Intergenic
1174364766 20:50049925-50049947 GGGTCCAGGCCCAGACCTGGGGG - Intergenic
1174404021 20:50292315-50292337 GGGTCCAGGTTAGGATTTGGGGG + Intergenic
1175223945 20:57433970-57433992 GGGTCCAGGCCAGCATGAAGGGG + Intergenic
1175445547 20:59017295-59017317 GGATCCAGCCCAGGATCATGGGG + Intergenic
1175740692 20:61417856-61417878 GGGGCCAGGCCAGGAGCAGCAGG + Intronic
1175980635 20:62736821-62736843 GTGTCAAGGGCAGGACCAGGGGG + Intronic
1176063223 20:63181317-63181339 GGGGCCAGGCCACAATCAGCAGG + Intergenic
1176108322 20:63399777-63399799 GGGGCCAGGCCAACAACAGGAGG + Intergenic
1176179265 20:63741862-63741884 GGCTCCAGGCCAGGCTCTGTGGG - Exonic
1177418505 21:20825591-20825613 GTGTCAAGGGCAGGACCAGGTGG - Intergenic
1177528893 21:22335753-22335775 GTGTCAAGGGCAGGACCAGGTGG + Intergenic
1178110997 21:29370219-29370241 GTGTCAAGGTCAGGACCAGGTGG - Intronic
1178494962 21:33078744-33078766 GGGTCCATGACAGCATCAGATGG + Intergenic
1178839983 21:36130373-36130395 GGGCCCAGCCCAGGAGGAGGCGG - Intergenic
1179801541 21:43813573-43813595 GGGGCCTGGCCAGGAGCAGGTGG + Intergenic
1179803960 21:43825764-43825786 GGGTCCTGGCTAGGAAGAGGAGG - Intergenic
1179826343 21:43968387-43968409 GGGTCCTGGGGAGGATCTGGGGG + Intronic
1179899751 21:44383462-44383484 GGGCCCAGGCTGGGATCAGCAGG + Intronic
1180474215 22:15688412-15688434 GTGTCCAGGCCAGCAAGAGGGGG - Intergenic
1181112284 22:20609247-20609269 GATCCCAGGCCAGGATCAGAGGG - Intergenic
1181339410 22:22166119-22166141 GGCTCCAGGCCAGGACCAGGGGG - Intergenic
1182017368 22:27052133-27052155 GTCTCCAGGCCAGACTCAGGAGG - Intergenic
1182310878 22:29405606-29405628 GGGTCCAGGGCATGATCTAGAGG + Intronic
1182681480 22:32083161-32083183 GGGGCCAGGGCAGGCTGAGGAGG + Intronic
1182690174 22:32155152-32155174 GGGTCCAGGGCATGATCTAGAGG - Intronic
1183544899 22:38450243-38450265 GGGTCCTGGCAAGGGGCAGGCGG - Intronic
1183829199 22:40409061-40409083 GGACCCAGCCCAGCATCAGGGGG + Intronic
1184029106 22:41880787-41880809 GGCTGCAGGCCAGGTCCAGGCGG - Exonic
1184098291 22:42328479-42328501 GGGACCAGACCAGGTTCACGGGG - Intronic
1184333473 22:43840226-43840248 GGGGTAAGGCCAGGAGCAGGGGG + Intronic
1184654997 22:45936625-45936647 GGGCCCAGGACAGGCTCAGAGGG + Intronic
1185237119 22:49720537-49720559 GGGTCCAGCCCAGGAGGTGGGGG - Intergenic
949421822 3:3873830-3873852 GGGTCAAGGGCAGGAGCAAGGGG - Intronic
950145345 3:10645958-10645980 GGGTCCCACCCAGGATCAAGTGG - Intronic
950438588 3:12994476-12994498 GGGTCCAGGCGCGGAACCGGGGG + Intronic
950488312 3:13285719-13285741 GAGTCCAGTCCAGAAGCAGGTGG - Intergenic
950555833 3:13695469-13695491 GGGTCCAGGCCAGAATCCTAGGG - Intergenic
950853036 3:16081124-16081146 GTGTCAAGGGCAGGACCAGGTGG - Intergenic
951442025 3:22734423-22734445 GTGTCAAGGGCAGGACCAGGGGG + Intergenic
952504684 3:33996975-33996997 GTGTCAAGGGCAGGACCAGGTGG - Intergenic
952579523 3:34815865-34815887 GTGTCAAGGACAGGACCAGGTGG + Intergenic
952604638 3:35130248-35130270 GTGTCAAGGGCAGGACCAGGTGG - Intergenic
953052293 3:39355849-39355871 AGGTCCATTCCAGGATCAAGGGG - Intergenic
953391385 3:42535906-42535928 GGGTTGAGGCCAGGTTCAGAAGG - Intronic
954132068 3:48565979-48566001 GGGTCCAGGTCAGGCCCAAGGGG + Intronic
954287089 3:49626741-49626763 GGGGCAAGGCCAGCATGAGGAGG - Intronic
954433904 3:50485890-50485912 GGGTCCAGACCAGGGGCACGGGG + Intronic
954591907 3:51790074-51790096 GGGTCCAGGTCAGGTAAAGGTGG + Intergenic
954864415 3:53716985-53717007 AGGCCCAGCCCAGGCTCAGGGGG - Intronic
956452231 3:69386134-69386156 GCGTCCTGGCCAGGCTCCGGCGG + Intronic
956860498 3:73319062-73319084 GTGTCAAGGGCAGGACCAGGTGG + Intergenic
957267084 3:77981952-77981974 GTGTCAAGGGCAGGACCAGGTGG - Intergenic
957418410 3:79935722-79935744 GTGTCAAGGGCAGGAGCAGGTGG - Intergenic
957587111 3:82146649-82146671 GTGTCAAGGGCAGGACCAGGTGG + Intergenic
959306293 3:104670708-104670730 GTGTCAAGGGCAGGACCAGGTGG - Intergenic
960355916 3:116653076-116653098 GTGTCAAGGGCAGGACCAGGTGG - Intronic
960628306 3:119702905-119702927 GTGGCCAGGCCAGGGTCAGGAGG - Intergenic
961302065 3:125928492-125928514 CAGGCCAGGCCAGGATCAGATGG + Intergenic
961823442 3:129586810-129586832 GGGTCCAAGACAGGATGGGGAGG - Intronic
962255937 3:133870331-133870353 GTGTCAAGGACAGGACCAGGTGG - Intronic
964751667 3:160059360-160059382 GGGGCCAGGCCAGGAAGAGCAGG + Intergenic
965410072 3:168319385-168319407 GTGTCAAGGGCAGGATCAGGTGG - Intergenic
967459488 3:189728854-189728876 GTGTCAAGGGCAGGACCAGGAGG - Intronic
968631908 4:1656236-1656258 GGCTCCAGGCCTGGACCTGGTGG - Intronic
968813497 4:2810361-2810383 GGGCCTGGGCCAGGGTCAGGTGG + Intronic
968995578 4:3943353-3943375 CAGGCCAGGCCAGGATCAGATGG - Intergenic
969195533 4:5560565-5560587 GTGTCAAGGGCAGGACCAGGTGG - Intronic
969219378 4:5749691-5749713 GGGTGCAGGGCAGCATCAGAGGG - Intronic
969321617 4:6416451-6416473 GGGCACAGGTGAGGATCAGGAGG - Intronic
969365276 4:6690513-6690535 GGGCCCAGGTGGGGATCAGGAGG - Intergenic
970504070 4:16708932-16708954 GGCCCCAGGGCAGGATGAGGTGG - Intronic
970898314 4:21129042-21129064 GTGTCAAGGGCAGGGTCAGGTGG + Intronic
971677570 4:29653429-29653451 GTGTCAAGGGCAGGAACAGGTGG - Intergenic
972708034 4:41564766-41564788 ATGTCAAGGGCAGGATCAGGTGG + Intronic
972752984 4:42011338-42011360 GTGTCAAGGGCAGGACCAGGAGG - Intronic
972997863 4:44904905-44904927 GTGTCAAGGGCAGGACCAGGTGG + Intergenic
974557196 4:63466043-63466065 GTGTCAAGGGCAGGACCAGGTGG - Intergenic
974678924 4:65136511-65136533 GTGTCAAGGACAGGACCAGGTGG - Intergenic
978213297 4:106163757-106163779 GTGTCAAGGACAGGACCAGGTGG - Intronic
978373471 4:108051742-108051764 TGGTCCAGGAGAGCATCAGGGGG - Intronic
978895942 4:113887330-113887352 GGGTCAAGGTCAGGGCCAGGTGG - Intergenic
979840734 4:125436810-125436832 GTGTCAAGGGCAGGGTCAGGTGG - Intronic
980279961 4:130706706-130706728 GTGTCAAGGGCAGGACCAGGTGG - Intergenic
980798171 4:137711998-137712020 GACTCCAGACCAGGATCAGCTGG - Intergenic
981343452 4:143648477-143648499 GTGTCAAGGGCAGGACCAGGTGG + Intronic
982987915 4:162233563-162233585 TGGTCAAGGGCAGGACCAGGTGG - Intergenic
984279901 4:177658029-177658051 GTGTCAAGGGCAGGACCAGGTGG + Intergenic
984314209 4:178105389-178105411 GGGTCAAGGGCAGTACCAGGTGG - Intergenic
985733608 5:1565066-1565088 GGAGCCAGGCCAGGAGCAAGAGG - Intergenic
985780696 5:1869395-1869417 GGGGCCTGGGCAGGAGCAGGGGG + Intergenic
986204124 5:5607478-5607500 GTGTCAAGGGCAGGACCAGGTGG - Intergenic
986767884 5:10944402-10944424 ATGTCAAGGGCAGGATCAGGTGG - Intergenic
987181422 5:15372440-15372462 TGGTGGAGGCCAGGAACAGGTGG + Intergenic
987431743 5:17843311-17843333 GTGTCAAGGGCAGGACCAGGTGG - Intergenic
988388137 5:30593209-30593231 GTGTCAAGGGCAGGACCAGGTGG - Intergenic
989224416 5:39010048-39010070 GTGTCAAGGGCAGGACCAGGTGG + Intronic
989822844 5:45816427-45816449 GTGTCAAGGGCAGGACCAGGTGG + Intergenic
990458207 5:56009265-56009287 GGGGCCAGGCTCGGATCAAGGGG + Intergenic
992144664 5:73833910-73833932 GTGTCAAGGGCAGGACCAGGTGG - Intronic
992162264 5:74015054-74015076 GGGTCCTGGCAAGAACCAGGGGG + Intergenic
992523374 5:77580437-77580459 GTGTCAAGGGCAGGACCAGGTGG - Intronic
993704016 5:91149291-91149313 GTGTCAAGGGCAGGACCAGGTGG + Intronic
994781326 5:104094459-104094481 GTGTCAAGGACAGGACCAGGTGG - Intergenic
994952658 5:106484323-106484345 ATGTCAAGGCCAGGACCAGGTGG + Intergenic
997303932 5:132825182-132825204 GGTTCCTGGGGAGGATCAGGAGG - Exonic
998146817 5:139733857-139733879 GGGGCCAGCCCAGGAGCTGGGGG + Intergenic
999847874 5:155505363-155505385 AGGTCAAGGGCAGGACCAGGTGG - Intergenic
999933142 5:156455601-156455623 GGCTCCAGGCAAGGGTCAGGTGG - Intronic
1001737779 5:174020979-174021001 GGGTCAAGGCCAGGGTCCTGAGG + Intergenic
1001776955 5:174336294-174336316 AGGTGCTGCCCAGGATCAGGAGG + Intergenic
1001836568 5:174837462-174837484 GTGTCAAGGGCAGGACCAGGTGG + Intergenic
1001924572 5:175626964-175626986 TGGTGCAGGCCCTGATCAGGAGG - Intergenic
1001987397 5:176086323-176086345 GGGTCCAGGCCATGATTTAGAGG + Intronic
1002229470 5:177751819-177751841 GGGTCCAGGCCATGATTTAGAGG - Intronic
1002265875 5:178031954-178031976 GGGTCCAGGCCATGATTTAGAGG + Intronic
1002650003 5:180684390-180684412 GGGTCCAGTCCATGATTTGGAGG - Intergenic
1003307258 6:4940837-4940859 GGGTACAGGTCAGGGTCATGGGG - Intronic
1003385767 6:5666022-5666044 GGCTCCATGGCAGGATCTGGAGG + Intronic
1003498822 6:6687271-6687293 GGCTCCCAGCCAGGATCCGGAGG - Intergenic
1004163334 6:13233677-13233699 GTGTCAAGGGCAGGACCAGGTGG - Intronic
1004521190 6:16362440-16362462 GGGTGGGGGCCAGGAACAGGAGG - Intronic
1005910154 6:30302556-30302578 GGGGTCAGGCCAAGATCAGAAGG + Intergenic
1007740781 6:44008315-44008337 GGGTCCTGGCCAGGTTCCTGAGG + Intergenic
1011055534 6:83199767-83199789 GTGTCAAGGACAGGACCAGGTGG - Intergenic
1011780544 6:90784753-90784775 GTGTCAAGGGCAGGACCAGGTGG - Intergenic
1011784691 6:90830624-90830646 AGGTCTGGGTCAGGATCAGGAGG + Intergenic
1011805946 6:91072524-91072546 GTGTCAAGGGCAGGACCAGGTGG + Intergenic
1012015000 6:93838848-93838870 ACGTCAAGGGCAGGATCAGGTGG - Intergenic
1013603500 6:111726772-111726794 GTGTCAAGGGCAGGACCAGGTGG + Intronic
1013930925 6:115531861-115531883 GTATCAAGGGCAGGATCAGGCGG + Intergenic
1014177432 6:118345968-118345990 GGGTCAAGGCCAGAGTCAGTCGG - Intergenic
1014757977 6:125323015-125323037 GGGTCTAGGGCAGCATCCGGTGG + Intergenic
1015673910 6:135723450-135723472 GTGTCAAGGGCAGGAGCAGGTGG + Intergenic
1016375309 6:143414415-143414437 TGGTCCAGGACAGGACCAGAGGG + Intergenic
1016456919 6:144240395-144240417 GTGTCAAGGGCAGGACCAGGTGG + Intergenic
1016529496 6:145042153-145042175 GTGTCCAGGGCAGGGTCAGGTGG - Intergenic
1017717458 6:157222689-157222711 GGAACCAGGCCAGGGCCAGGTGG - Intergenic
1017762236 6:157578616-157578638 GTGTCAAGGGCAGGACCAGGTGG + Intronic
1018104341 6:160468583-160468605 GTGTCAAGGGCAGGACCAGGTGG - Intergenic
1018112531 6:160549181-160549203 GTGTCAAGGGCAGGACCAGGTGG - Intronic
1019398158 7:834488-834510 GAGGCCAGCCCAGGACCAGGAGG - Intronic
1019713441 7:2527726-2527748 GCGTCCAGGCCAGGAGGAAGGGG - Exonic
1019769898 7:2877002-2877024 GGGCCCAGGCCAAGACCAGCCGG - Intergenic
1021258727 7:18427567-18427589 TGGTGGAGGCCAGGATCAGCAGG - Intronic
1021342988 7:19488172-19488194 GGATCCAGGCCAGTAGCATGAGG - Intergenic
1021489905 7:21208296-21208318 GTGTACAGGGCAGGACCAGGTGG - Intergenic
1022423266 7:30244480-30244502 ATGTCAAGGGCAGGATCAGGTGG - Intergenic
1022472256 7:30689092-30689114 GGGGCCAGCCCAGGCTCAGCAGG - Intronic
1022890017 7:34687631-34687653 GTGTCAAGGGCAGGACCAGGTGG - Intronic
1022978128 7:35577098-35577120 GTGTCAAGGGCAGGGTCAGGTGG - Intergenic
1023849032 7:44140238-44140260 GGGTTCAGGCAGGGTTCAGGTGG + Intronic
1023874976 7:44281959-44281981 GGGACCAGCCCAGGATGAGCTGG - Intronic
1026740698 7:72976549-72976571 GGGTGCAGGACAGGATGGGGGGG + Intergenic
1027103034 7:75388522-75388544 GGGTGCAGGACAGGATGGGGGGG - Intergenic
1028245209 7:88468767-88468789 GTGTCAAGGGCAGGACCAGGTGG + Intergenic
1028286641 7:89011254-89011276 GTGTCAAGGGCAGGACCAGGTGG - Intronic
1028286881 7:89013110-89013132 GTGTCAAGGGCAGGACCAGGTGG - Intronic
1028984848 7:97001777-97001799 CGGTCCAGACCAGGAACAGCAGG + Intergenic
1029170673 7:98627347-98627369 GGGTGCAGGGCAGGTGCAGGTGG + Intronic
1029965924 7:104740754-104740776 ATGTCAAGGCCAGGACCAGGTGG - Intronic
1030416992 7:109257947-109257969 GTGTCAAGGGCAGGACCAGGTGG + Intergenic
1034119307 7:148612138-148612160 TGGTCCAGGCCAGAAGCAGGTGG - Intronic
1034296327 7:149975874-149975896 AGGTCAAGGGCAGGACCAGGTGG - Intergenic
1034429132 7:151032173-151032195 GGGAACAGGCCAGGCACAGGTGG - Intronic
1034463121 7:151209467-151209489 GGGCCAAGGCCAGGAGGAGGCGG - Intronic
1034778989 7:153859925-153859947 GTGTCAAGGGCAGGACCAGGTGG - Intergenic
1035038227 7:155909045-155909067 GGGGCCAGGCCAGGCTCTGGGGG + Intergenic
1035532506 8:364348-364370 GGGTCAAGGCCAAGTTCAAGGGG - Intergenic
1035625388 8:1067187-1067209 GGATCCAGGCCAGCAGCACGAGG - Intergenic
1035653378 8:1286082-1286104 GTGTCAAGGGCAGGACCAGGTGG + Intergenic
1035896133 8:3404401-3404423 GGGACCAGGGCAGGATGAGGTGG + Intronic
1037150048 8:15626154-15626176 GGGTCCTGCCTAGGCTCAGGAGG - Intronic
1037642658 8:20761911-20761933 GGAATCAGGCAAGGATCAGGTGG - Intergenic
1038150995 8:24942268-24942290 GGGGCCAGGCCTCGATGAGGAGG + Intergenic
1038159425 8:25022758-25022780 AGGTCAAGGGCAGGACCAGGTGG - Intergenic
1038410443 8:27354342-27354364 TGGTCCAGGCCAGGACGGGGAGG + Intronic
1039071496 8:33652896-33652918 GTGTCAAGGGCAGGATCAGGTGG + Intergenic
1039548662 8:38428159-38428181 GGGCCCAGGCCAGGACCTGGAGG + Intronic
1039798921 8:40937777-40937799 TGGTCCAGGCCACACTCAGGGGG - Intergenic
1039835821 8:41255551-41255573 TGGCCCAGTCCAGAATCAGGAGG + Intergenic
1040463809 8:47675931-47675953 GTGTCCTTGCCAGGCTCAGGTGG - Intronic
1041188490 8:55328160-55328182 GTGTCAAGGGCAGGACCAGGTGG - Intronic
1041484291 8:58357374-58357396 GTGTCAAGGGCAGGACCAGGTGG - Intergenic
1041691789 8:60694576-60694598 GGGTCCTGGCAGGGAGCAGGTGG + Intronic
1042692042 8:71510660-71510682 GTGTCAAGGTCAGGACCAGGTGG - Intronic
1046064515 8:109180808-109180830 GCGTCAAGGGCAGGAGCAGGTGG + Intergenic
1047325831 8:123834962-123834984 GTGTCAAGGGCAGGACCAGGTGG + Intergenic
1048729344 8:137419975-137419997 GTGTCAAGGGCAGGACCAGGTGG - Intergenic
1048743471 8:137587787-137587809 GTGACCAGACCAGGATCAGCTGG - Intergenic
1048940415 8:139395869-139395891 GGGTCCAGACCAGGTGCAGGAGG - Intergenic
1049012982 8:139899976-139899998 AAGGCCAGGCCAGGAGCAGGTGG + Intronic
1049991542 9:996249-996271 GGGTCCAGCCAAGGAGCAAGTGG + Intergenic
1051885949 9:21893186-21893208 GTGTCAAGGGCAGGACCAGGTGG - Intronic
1056149065 9:83766060-83766082 GAGTCCAGGGTGGGATCAGGTGG + Intronic
1056378336 9:86035545-86035567 GGAGCCAGGCCGGGAGCAGGTGG - Exonic
1056710869 9:88991259-88991281 GGGTCCAGGCTAGGGGCGGGCGG + Intronic
1056876190 9:90333292-90333314 GGGTCCAGTCCAGTAACAGTGGG + Intergenic
1057144529 9:92749161-92749183 GGGTCCAGGCCAGGAAAAGAGGG + Intronic
1057457623 9:95228678-95228700 GGGTCTAGCCCAGGATGATGAGG + Intronic
1057759207 9:97859251-97859273 GGTTCCGGGCCAGAAACAGGAGG - Intergenic
1058674330 9:107387777-107387799 GGGATCAGGACAGGATAAGGGGG + Intergenic
1058998411 9:110322746-110322768 GGTACCAGGACAGAATCAGGAGG + Intronic
1059896902 9:118876512-118876534 AAGTCCAGGCCAGCATCAGGCGG - Intergenic
1060474963 9:123979876-123979898 GTGTCGAGGGCAGGACCAGGTGG - Intergenic
1060618712 9:125043852-125043874 GGGTGGAGGCCAGGAACAGGTGG + Intronic
1060706913 9:125811386-125811408 GTGTCAAGGGCAGGACCAGGTGG + Intronic
1061415405 9:130444740-130444762 GGGCCCAGGCCCGGACCTGGTGG + Intergenic
1061809129 9:133152271-133152293 TGGTGCAGGCCAGGATTAGAGGG - Intergenic
1062092264 9:134684539-134684561 TGGTCCAGGCCAGGAGCACCTGG + Intronic
1062621786 9:137426103-137426125 GGTTCCTGGACAGGAGCAGGAGG + Intronic
1185620155 X:1449303-1449325 GCGTCAGGGCCAGGATCTGGGGG - Intronic
1185818896 X:3182784-3182806 AGGTCAAGGGCAGGACCAGGTGG + Intergenic
1187411385 X:19053438-19053460 GGGTGCAGGACAGGGTCACGTGG - Intronic
1188297222 X:28463939-28463961 GTGTCAAGGGCAGGACCAGGTGG - Intergenic
1188470566 X:30533767-30533789 GGGTCAAGGGTGGGATCAGGTGG - Intergenic
1189312072 X:40026222-40026244 AGGTCCAGGCCAGAAGCAGGGGG + Intergenic
1189743184 X:44142683-44142705 GTGTCAAGGACAGGACCAGGTGG - Intergenic
1189887164 X:45559433-45559455 GTGTCAAGGGCAGGACCAGGTGG + Intergenic
1190107234 X:47569424-47569446 GGCTCCTGGTCAGGATCAGAGGG + Intronic
1190127975 X:47722918-47722940 GTGGTCAGGGCAGGATCAGGAGG - Intergenic
1192207424 X:69105657-69105679 GGGTCCAGCCCAGGCCCAGTGGG + Intergenic
1193865205 X:86721973-86721995 GTGTCAAGGGCAGGACCAGGTGG - Intronic
1194338329 X:92677377-92677399 GTGTGAAGGGCAGGATCAGGTGG - Intergenic
1194554101 X:95336814-95336836 GTGTCAAGGCCAGGACTAGGTGG - Intergenic
1194589814 X:95786199-95786221 GTGTCAAGGGCAGGACCAGGTGG + Intergenic
1194712168 X:97249282-97249304 GAGTCCAGGCCAAGTTCATGAGG - Intronic
1195209769 X:102642732-102642754 GCGTCAAGGGCAGGACCAGGTGG - Intergenic
1195326001 X:103759081-103759103 GTGTCAAGGGCAGGAACAGGTGG - Intergenic
1195820313 X:108938193-108938215 GTGTCAAGGGCAGGACCAGGTGG + Intergenic
1196498501 X:116350689-116350711 GTGTCCAGGGGGGGATCAGGTGG - Intergenic
1196864127 X:120055390-120055412 GTGTCAAGGGCAGGACCAGGTGG + Intergenic
1196878972 X:120180940-120180962 GTGTCAAGGGCAGGACCAGGTGG - Intergenic
1197223386 X:123933868-123933890 GTGTCAAGGCCGGGACCAGGTGG + Intergenic
1197665300 X:129216764-129216786 GTGTCAAGGGCAGGACCAGGTGG - Intergenic
1198775133 X:140171683-140171705 GTGTCAAGGACAGGACCAGGTGG + Intergenic
1198920679 X:141722467-141722489 GTGTCAAGGGCAGGACCAGGTGG + Intergenic
1199236507 X:145500014-145500036 GGGTCCAGGCCCTCTTCAGGAGG - Intergenic
1199510682 X:148618504-148618526 GTGTCAAGGTCAGGACCAGGTGG - Intronic
1199582410 X:149373362-149373384 TGGCCCAGGCAAGGATTAGGGGG - Intergenic
1199745973 X:150772170-150772192 TGGCCCGGGCCAGAATCAGGAGG - Intronic
1199990287 X:152983929-152983951 GATCCCAGGCCAGGAACAGGTGG + Intergenic
1200016821 X:153170896-153170918 AGGTCAAGGGCAGGACCAGGTGG + Intergenic
1200033377 X:153313403-153313425 GATCCCAGGCCAGGAACAGGTGG + Intergenic
1200217453 X:154374366-154374388 AGGTCCGGGCCAGGTTCAGCTGG - Intronic
1200646731 Y:5794160-5794182 GTGTGAAGGGCAGGATCAGGTGG - Intergenic