ID: 1084195830

View in Genome Browser
Species Human (GRCh38)
Location 11:67523292-67523314
Sequence GCCAAGCGGCCCTGGCGCCG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 183}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084195830_1084195848 25 Left 1084195830 11:67523292-67523314 CCCCGGCGCCAGGGCCGCTTGGC 0: 1
1: 0
2: 0
3: 14
4: 183
Right 1084195848 11:67523340-67523362 TGCCAGGCCTGGAACCCCGGGGG 0: 1
1: 0
2: 1
3: 26
4: 229
1084195830_1084195850 28 Left 1084195830 11:67523292-67523314 CCCCGGCGCCAGGGCCGCTTGGC 0: 1
1: 0
2: 0
3: 14
4: 183
Right 1084195850 11:67523343-67523365 CAGGCCTGGAACCCCGGGGGTGG 0: 1
1: 0
2: 3
3: 24
4: 310
1084195830_1084195835 -9 Left 1084195830 11:67523292-67523314 CCCCGGCGCCAGGGCCGCTTGGC 0: 1
1: 0
2: 0
3: 14
4: 183
Right 1084195835 11:67523306-67523328 CCGCTTGGCACAGTTCCCCATGG 0: 1
1: 0
2: 1
3: 16
4: 253
1084195830_1084195840 9 Left 1084195830 11:67523292-67523314 CCCCGGCGCCAGGGCCGCTTGGC 0: 1
1: 0
2: 0
3: 14
4: 183
Right 1084195840 11:67523324-67523346 CATGGGCCCTGAACCATGCCAGG 0: 1
1: 0
2: 5
3: 21
4: 790
1084195830_1084195841 14 Left 1084195830 11:67523292-67523314 CCCCGGCGCCAGGGCCGCTTGGC 0: 1
1: 0
2: 0
3: 14
4: 183
Right 1084195841 11:67523329-67523351 GCCCTGAACCATGCCAGGCCTGG 0: 1
1: 0
2: 6
3: 38
4: 255
1084195830_1084195845 22 Left 1084195830 11:67523292-67523314 CCCCGGCGCCAGGGCCGCTTGGC 0: 1
1: 0
2: 0
3: 14
4: 183
Right 1084195845 11:67523337-67523359 CCATGCCAGGCCTGGAACCCCGG 0: 1
1: 1
2: 7
3: 63
4: 522
1084195830_1084195836 -8 Left 1084195830 11:67523292-67523314 CCCCGGCGCCAGGGCCGCTTGGC 0: 1
1: 0
2: 0
3: 14
4: 183
Right 1084195836 11:67523307-67523329 CGCTTGGCACAGTTCCCCATGGG 0: 1
1: 0
2: 0
3: 4
4: 56
1084195830_1084195846 23 Left 1084195830 11:67523292-67523314 CCCCGGCGCCAGGGCCGCTTGGC 0: 1
1: 0
2: 0
3: 14
4: 183
Right 1084195846 11:67523338-67523360 CATGCCAGGCCTGGAACCCCGGG 0: 1
1: 0
2: 5
3: 45
4: 499
1084195830_1084195847 24 Left 1084195830 11:67523292-67523314 CCCCGGCGCCAGGGCCGCTTGGC 0: 1
1: 0
2: 0
3: 14
4: 183
Right 1084195847 11:67523339-67523361 ATGCCAGGCCTGGAACCCCGGGG 0: 1
1: 0
2: 0
3: 21
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084195830 Original CRISPR GCCAAGCGGCCCTGGCGCCG GGG (reversed) Exonic
900156171 1:1204143-1204165 CCCAAGCGGCTCTGCCGGCGGGG + Intronic
900633754 1:3652027-3652049 TCCAAGCGCCCCGCGCGCCGAGG + Intronic
901046980 1:6402802-6402824 GCCAAGCAGCCCTGGGGTCCTGG + Intergenic
906314400 1:44776832-44776854 ACCAAGTGGGCCTGGCGCGGTGG + Intronic
906637078 1:47416845-47416867 GAGCGGCGGCCCTGGCGCCGCGG - Exonic
906960885 1:50419004-50419026 GCCCAGCGCCCCAGGCGCCATGG + Exonic
907491671 1:54812490-54812512 GCCAAGCTCCCCTGGCACTGTGG - Intronic
907611879 1:55879472-55879494 GCCGAGCAGCGCTGGAGCCGGGG - Intergenic
910138430 1:83999210-83999232 GCCGAGAGGCGCGGGCGCCGGGG + Intergenic
911589508 1:99730578-99730600 GCCAAGCGGGCCGGGCGAGGTGG + Intronic
914803024 1:150974367-150974389 GGCCGGCGGGCCTGGCGCCGCGG - Intronic
914878945 1:151532947-151532969 GCCAAGGGTCCCTGGGGCCCAGG + Intronic
919802191 1:201360691-201360713 GCAAAGAGGCCCTGGGACCGGGG + Intronic
920660554 1:207910969-207910991 GCCAAGCGGCCGCGGCGCGCGGG + Intronic
922674484 1:227542311-227542333 GCCAGGCGGCCCTGGAGCCCTGG + Intergenic
922696904 1:227735446-227735468 GCCGAGCGGCCGAGGCGCCGCGG + Exonic
922783271 1:228269856-228269878 GCAAAGGGGCCCTGGGGCCCAGG - Intronic
923144511 1:231188492-231188514 GCCCAGCAGCCCTGCCTCCGAGG + Intronic
923750095 1:236739546-236739568 GCCAAGCCCTCCTGGCGCCACGG + Intronic
923864073 1:237919970-237919992 GGCAAGCCACCCAGGCGCCGAGG - Intergenic
1065993113 10:31031899-31031921 GCCCAGCGGCCCGCGCCCCGTGG - Exonic
1066054100 10:31664261-31664283 GCTATGCGGCCCAGGCGCTGTGG + Intergenic
1066072890 10:31838540-31838562 GCCAAGCGGGCCAGGCACAGTGG + Intronic
1067142072 10:43666543-43666565 CCCAAGTGGCCCGGGCCCCGGGG + Intergenic
1067147403 10:43703383-43703405 GCCCAGGGGCCCTGGAGGCGTGG + Intergenic
1070112090 10:73495957-73495979 GCCAAGCGGCGGCGCCGCCGGGG + Exonic
1074866127 10:117545339-117545361 CCGCAGCCGCCCTGGCGCCGCGG - Intronic
1075112134 10:119596382-119596404 GCCAAGAGGCCCGGGCACCGCGG - Intronic
1077264921 11:1643676-1643698 GGCAAGCCGCCCAGGTGCCGAGG + Intergenic
1081058026 11:38434941-38434963 GCAAAGGGGGCCTGGCGCCCTGG - Intergenic
1081528556 11:43943010-43943032 GCCAAGCTGCCCAAGGGCCGGGG + Exonic
1083301198 11:61740390-61740412 GCCAGGAGGCCCTGGCACCGAGG + Intronic
1084195830 11:67523292-67523314 GCCAAGCGGCCCTGGCGCCGGGG - Exonic
1084213079 11:67632754-67632776 GCCAAGAGGCCCAGGTGCCAGGG - Intronic
1087638051 11:100725648-100725670 GCCAGGTGGCCCGGGCGCAGTGG + Intronic
1091124498 11:133082780-133082802 GCGAGGAGGCCCAGGCGCCGGGG - Intronic
1091401767 12:185454-185476 TCCAAAAGGCCCTGGCCCCGAGG - Intergenic
1092350743 12:7753721-7753743 GCCAAGGGGGCCGGGCGCGGTGG + Intergenic
1096394390 12:51254831-51254853 GCCAAGCATGCCTGGCCCCGGGG - Intronic
1096497316 12:52045976-52045998 GGCAATAGGCCCTGGGGCCGAGG + Intronic
1097591767 12:61583147-61583169 GGCAAGCCACCCAGGCGCCGAGG - Intergenic
1103342754 12:120229886-120229908 ACCACGGGGCCCTGGCGCTGGGG - Intronic
1103357899 12:120335319-120335341 GACAAGCCACCCAGGCGCCGAGG + Intergenic
1103581495 12:121918726-121918748 GCCACGCGGCCCTGGCGAGGGGG + Intronic
1104697251 12:130872452-130872474 GCCTGGCCGCCATGGCGCCGCGG + Intronic
1105850305 13:24328347-24328369 GCCAAGCGGCTCTAGGACCGCGG - Intergenic
1107560050 13:41550465-41550487 ACCAAGCTGCCCTGATGCCGGGG + Intergenic
1108577668 13:51803759-51803781 GTCAGGCGGCCCCGGCGCCAAGG - Intronic
1108635954 13:52334288-52334310 GCCCAGCGAGCCTGGCGCCGGGG - Intergenic
1108651856 13:52488960-52488982 GCCCAGCGAGCCTGGCGCCGGGG + Intergenic
1112041480 13:95552610-95552632 GCCCAGCGGACCCGGCGCCAGGG - Intronic
1112402101 13:99086424-99086446 GCGGAGCGGGCCGGGCGCCGAGG - Intronic
1116895649 14:50312518-50312540 GCCATGCGGACATGGGGCCGTGG + Exonic
1122955038 14:105066566-105066588 GCCATGCGGCCCTGCAGCAGGGG - Intergenic
1123023068 14:105411315-105411337 GCGAAGGGGAGCTGGCGCCGAGG + Intronic
1123028728 14:105440650-105440672 GCCATGTGGCCCTGGCCCTGAGG - Intronic
1124038985 15:26082701-26082723 GCCGCGCGGGCCTGGCTCCGGGG + Intergenic
1124288960 15:28430429-28430451 CCCAAATGGCCCGGGCGCCGTGG + Intergenic
1124294263 15:28486882-28486904 CCCAAATGGCCCGGGCGCCGTGG - Intergenic
1125508916 15:40282595-40282617 GCCAGGCTGCCCGGGCGCGGCGG - Intronic
1125760202 15:42091158-42091180 GGCAAGCCACCCAGGCGCCGAGG + Intronic
1128732983 15:70033635-70033657 GCCCAGCGCCCCAGGCGCGGGGG + Intergenic
1129878749 15:78993750-78993772 GCCCAGAGGCCCAGGCGCTGTGG + Intronic
1132155789 15:99494698-99494720 GCCAATGGGACCGGGCGCCGTGG + Intergenic
1132321217 15:100926970-100926992 GCCATGCTGGCCGGGCGCCGTGG - Intronic
1132499904 16:280655-280677 GGCGCGCGGCCCGGGCGCCGCGG - Exonic
1133010468 16:2908032-2908054 GGCAAGCCACCCAGGCGCCGAGG - Intergenic
1133108087 16:3527115-3527137 GGCAAGCCGCCCAGGTGCCGAGG + Intronic
1134400413 16:13904714-13904736 GGCAAGCCACCCAGGCGCCGAGG + Intergenic
1135400331 16:22162493-22162515 GCCCGGTGGCCCTGGCGGCGCGG + Intergenic
1135670989 16:24375371-24375393 GGCAAGCCACCCAGGCGCCGAGG - Intergenic
1136352784 16:29722064-29722086 GACAAGCCACCCAGGCGCCGAGG - Intergenic
1136393949 16:29982862-29982884 ACCCAACGGCCCTGGTGCCGAGG + Exonic
1136560044 16:31033764-31033786 GCCTCCCGGCTCTGGCGCCGGGG + Exonic
1136626575 16:31465603-31465625 GGCAAGCCACCCAGGCGCCGAGG - Intronic
1137604159 16:49776219-49776241 GCCAAGCGGAGCTGGAGCAGCGG + Intronic
1141924708 16:87160525-87160547 GCCCAGTGCCCCTGGGGCCGTGG - Intronic
1142336308 16:89491222-89491244 GCCCAGGGGCTCTGGAGCCGCGG - Intronic
1144501024 17:15786703-15786725 GCCATAGGGCCCTGGTGCCGCGG - Intergenic
1144825922 17:18105717-18105739 GCCCAGCGTCCCTGGGGCGGAGG - Intronic
1144913494 17:18702657-18702679 GCCAAGCTGGCCAGGCGCAGTGG - Intronic
1145110355 17:20156452-20156474 GCCCGGCGGCCCCGGCGCCCAGG - Intronic
1145163191 17:20589378-20589400 GCCATAGGGCCCTGGTGCCGCGG - Intergenic
1145886303 17:28384654-28384676 CAAAAGCGACCCTGGCGCCGCGG - Intronic
1146725054 17:35149700-35149722 GCCAGGCGGGCCTGGCGCAGTGG - Intronic
1147171047 17:38619027-38619049 GCCATGGGGCCCTGGAGCCCTGG - Intergenic
1147193231 17:38748911-38748933 GGCCAGCGCCCCTGCCGCCGAGG - Intronic
1148466578 17:47868691-47868713 GACAAGTGGCCCTGGCTCCTTGG - Intergenic
1148782647 17:50130283-50130305 GCCGAGCAGCCGGGGCGCCGAGG + Intergenic
1148849729 17:50548731-50548753 GCCAAGTGGCCCTGGCTACATGG - Intronic
1148896950 17:50844369-50844391 GCCAAGCTGCCCTGCCCCAGAGG - Intergenic
1150476627 17:65480514-65480536 CCCAAGCGGGCCGGGCGCGGTGG + Intergenic
1151704350 17:75758715-75758737 GCCAGGCTGCCCTGCCCCCGCGG - Intronic
1151763969 17:76122602-76122624 GCAGAGCGGCCCTGGGGCCCCGG + Intergenic
1152363600 17:79843360-79843382 GCCAAAGGACCCTGGCGTCGCGG - Intergenic
1152581168 17:81166180-81166202 TCCGCCCGGCCCTGGCGCCGCGG + Intergenic
1152618420 17:81348548-81348570 GCCAAGGGGCCCTGGGACAGTGG + Intergenic
1152728890 17:81960450-81960472 GCCCCGCGGTCCTGGCCCCGAGG - Intronic
1153609949 18:6873942-6873964 GCCAACTGGCCCAGGCGCCATGG - Intronic
1154132890 18:11751648-11751670 GCCAGGCGGCCGCGGCGCAGCGG + Intronic
1157333437 18:46720234-46720256 GCTAAGCGGCCCTGCCTCCCAGG - Intronic
1160289003 18:77572803-77572825 GCCAAGGGGAACTGACGCCGGGG + Intergenic
1160454848 18:78992962-78992984 GCTCTGCGGCGCTGGCGCCGGGG - Exonic
1160807885 19:1000610-1000632 CCCGGGCCGCCCTGGCGCCGCGG + Exonic
1161911115 19:7194795-7194817 GCAAAGCTGGCCTGGCGCGGTGG - Intronic
1162410694 19:10503283-10503305 GCCACGCAGCCCTGGAGCCGAGG - Exonic
1164513603 19:28916302-28916324 GGCAAGGGGGCCGGGCGCCGTGG - Intergenic
1164834764 19:31349911-31349933 CCCACGCGGGCCTGGGGCCGGGG - Intergenic
1165078070 19:33291737-33291759 GCCAAGCTTCCCTAGCGCCGGGG - Intergenic
1165671298 19:37681503-37681525 GGCAAGCCACCCAGGCGCCGAGG - Intronic
1166113765 19:40640216-40640238 GCCAAGGGGGCCAGGCGCGGTGG - Intergenic
1166808126 19:45499030-45499052 GCTGAGCCGCGCTGGCGCCGTGG + Exonic
1167466054 19:49651622-49651644 GCCGGGCGGCCCGGCCGCCGGGG - Exonic
934561407 2:95315422-95315444 TCCAAGGGGCGCTGGGGCCGAGG - Intronic
934892971 2:98087015-98087037 GCCAAGAGGGCGGGGCGCCGAGG - Intergenic
935570878 2:104659296-104659318 GCTACGCGGCGCTGGCGGCGGGG + Intergenic
936370280 2:111897976-111897998 GCGACACGGCCCTGGCGGCGAGG - Intergenic
937375722 2:121334596-121334618 GCCAAGCTGGCCGGGTGCCGTGG - Intergenic
941019566 2:160393488-160393510 GCCAAGCTGGCCGGGCGCGGTGG + Intronic
941096637 2:161245041-161245063 GCAAAGGGGCCCTGGGGCCCAGG - Intergenic
945779666 2:214153504-214153526 GGCAAGCCACCCAGGCGCCGAGG - Intronic
947600867 2:231449191-231449213 GCCAGGCGGGCCTGGCGCAGTGG - Intergenic
947774626 2:232697665-232697687 GCCAAGAGGCCCTGGCCTAGGGG - Intronic
1169295584 20:4394577-4394599 GGCAAGCCACCCAGGCGCCGAGG - Intergenic
1174488547 20:50876236-50876258 GCCAGGCAGCCCAGGCGCAGTGG - Intronic
1175898932 20:62352415-62352437 GTCAAGGGGCCCGGGCACCGCGG - Intronic
1178555701 21:33588486-33588508 GCCGAGCCGCCCTGGTGGCGGGG - Exonic
1180138074 21:45874113-45874135 GACAAGCGGGCCGGGCGCGGTGG - Intronic
1180871878 22:19150851-19150873 GCCATGAGACCCTGGCTCCGAGG - Intergenic
1181801533 22:25350826-25350848 GCCAGGCGGCCCCGGGGCTGAGG - Intergenic
1182279371 22:29209099-29209121 GCCAAGCGGGCCCGGGGCCAAGG - Intronic
1183604498 22:38860613-38860635 GCCTAGAGGCCGTGGCGCTGGGG + Intergenic
1184497236 22:44849063-44849085 GCGTAGCTGCCCTGGCGCAGGGG + Intronic
953705349 3:45226251-45226273 GCCCAAGGGCCCCGGCGCCGGGG - Exonic
954451696 3:50575133-50575155 GCCAAGAGGGCCAGGCGCTGTGG + Intronic
954635992 3:52071184-52071206 GCCAGGCCGCCCTGGCACCCTGG - Intergenic
954838978 3:53494784-53494806 GCCGAGCGGCCCCGGCGGCCGGG + Intronic
967858969 3:194137632-194137654 ACCGAACGGCCCTGGCCCCGTGG - Intronic
968230784 3:197003435-197003457 CCCCAGCGGCCCCGGCGCCCGGG - Exonic
968293170 3:197554817-197554839 CCCTAGCGGCCCAGGCGCCTTGG - Intronic
968547278 4:1205706-1205728 GCCTGGAGGCCCTGGGGCCGTGG - Intronic
968570883 4:1340196-1340218 GCCATGCTGCCCGGGCCCCGGGG - Intergenic
968659630 4:1793693-1793715 GCCAGGCGGCCCGGGAGCCCTGG + Intronic
969114383 4:4861936-4861958 GCCAGAGGGCCCTGGCGCCAGGG + Intronic
969114978 4:4865805-4865827 GCCAGGAGGTCCTGGAGCCGGGG - Intergenic
969559793 4:7939689-7939711 TCCAGTCGGCCCAGGCGCCGCGG - Exonic
982002349 4:151032484-151032506 CCCAAGGGGCCCGGGCGCGGTGG + Intergenic
982771215 4:159399207-159399229 GCCAAGTGGGCCGGGCGCAGTGG + Intergenic
984714037 4:182910143-182910165 GCCAAGCAACCCTGGCTCCCTGG + Intronic
985558929 5:571943-571965 TCCACGCGGACCTGGAGCCGCGG + Intergenic
986330813 5:6714630-6714652 GCCCCGGGGCCCAGGCGCCGCGG + Exonic
988993505 5:36693225-36693247 GCCAGCCGGCCCTGGCCCGGTGG + Intergenic
992851362 5:80812843-80812865 GCCAAGCTGGCCAGGCGCGGTGG - Intronic
994353213 5:98769546-98769568 GCCACGCGGCCGAGGCGCGGAGG - Exonic
994516088 5:100774652-100774674 GGCAAGCCACCCAGGCGCCGAGG + Intergenic
997585552 5:135040981-135041003 GCCAAGCGGCCCTGGAGGCACGG - Intronic
997972045 5:138411483-138411505 GGCAAGCCACCCAGGCGCCGAGG - Intronic
998322072 5:141241746-141241768 GCCGAACAGCCCTGGCTCCGTGG - Intergenic
1002499105 5:179635694-179635716 GCCCAGGGGGCCAGGCGCCGTGG + Intergenic
1002502571 5:179656829-179656851 GCCCAGGGGGCCAGGCGCCGTGG - Intergenic
1003065963 6:2903550-2903572 CTGAAGAGGCCCTGGCGCCGGGG - Intergenic
1003086221 6:3063678-3063700 CTGAAGAGGCCCTGGCGCCGGGG + Intergenic
1005225226 6:23634679-23634701 GGGAAGCGGCTGTGGCGCCGTGG - Intergenic
1005688763 6:28281621-28281643 GCCCAGCGGCCCGGGCTCTGGGG + Exonic
1015910274 6:138162194-138162216 GCCGCGCGGCCCTCCCGCCGCGG - Intronic
1019324706 7:432423-432445 ACCAAGCTGCCCTGGAGCTGTGG + Intergenic
1021065074 7:16163259-16163281 GACAAGCGGCCCAGGTGCAGTGG - Intronic
1023021867 7:36018301-36018323 GGCAAGCCACCCAGGCGCCGAGG - Intergenic
1024279647 7:47708999-47709021 GCCTTGCTGCCCTGGGGCCGAGG + Intronic
1029562232 7:101310197-101310219 GGCAAGCTACCCAGGCGCCGAGG - Intergenic
1034833928 7:154334475-154334497 GGCAAGCGGCACTGGCTGCGTGG + Intronic
1035127055 7:156616460-156616482 GCAAAGCGGCGTTGGCGCCCCGG + Intergenic
1036785034 8:11680328-11680350 GACAACGGGCCCTGGAGCCGGGG + Intronic
1036930568 8:12951830-12951852 GCCAAGCTGGCCTGCGGCCGCGG + Intronic
1037822488 8:22141682-22141704 GCAAAGCGGCCCCGGCGGGGAGG + Exonic
1038461726 8:27722883-27722905 GACAAGTGGACCTGGTGCCGGGG - Intergenic
1038789813 8:30658248-30658270 GCTTGGCTGCCCTGGCGCCGCGG - Exonic
1038883612 8:31640103-31640125 GGACCGCGGCCCTGGCGCCGGGG + Intronic
1042235779 8:66612677-66612699 GCCAAGCGGCCGCGGGGACGCGG + Intronic
1042920638 8:73915983-73916005 GCCAAGAGGGCCAGGCGCAGTGG + Intergenic
1045510714 8:102810436-102810458 GCGGAGCGGCCCGGGCGCGGCGG + Intergenic
1047855104 8:128900992-128901014 GCCAAGGGGACCTGGAGCCTGGG + Intergenic
1049204442 8:141357123-141357145 GCCAAGTGGCCGTGGCGCTGTGG - Exonic
1049239805 8:141531440-141531462 GCCAAGCCGGCCGGGCGCAGTGG - Intergenic
1049516309 8:143059110-143059132 GGCAAGCCACCCAGGCGCCGAGG - Intronic
1056126228 9:83538381-83538403 GCCCAGCGGCCGGGGCGCGGCGG + Exonic
1059449001 9:114358202-114358224 GCCAGGCAGCCCTGACGCAGGGG + Intronic
1061835940 9:133329803-133329825 GGCAAGCCACCCAGGCGCCGAGG - Intergenic
1062190254 9:135244301-135244323 GCCCAGCGGGCCAGGCGCCGTGG + Intergenic
1062502870 9:136858753-136858775 GCCAGGCGGCCCGGCCCCCGGGG - Exonic
1185495903 X:554586-554608 TCCAAGCGGAGCTGGCTCCGGGG - Intergenic
1191251676 X:58262926-58262948 ACCAAGCGGGCCTGGAGCAGGGG - Intergenic
1191252022 X:58264319-58264341 CCCACGCGGGCCTGGCGCAGGGG - Intergenic
1194218685 X:91165736-91165758 GCCAAATGGCCCTGGGGCGGGGG - Intergenic
1197078005 X:122376059-122376081 GGCAAGCCACCCAGGCGCCGAGG - Intergenic
1197242646 X:124136447-124136469 GGCAAGCCACCCAGGCGCCGAGG + Intronic
1199086392 X:143634510-143634532 CCCAAGCGGCCAGGGCGGCGGGG - Intronic
1200555194 Y:4629488-4629510 GCCAAATGGCCCTGGGGCGGGGG - Intergenic