ID: 1084203422

View in Genome Browser
Species Human (GRCh38)
Location 11:67577136-67577158
Sequence GAGCCTTCCCACACCTACCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084203422_1084203432 30 Left 1084203422 11:67577136-67577158 CCCTGGTAGGTGTGGGAAGGCTC No data
Right 1084203432 11:67577189-67577211 ATGTCAGCGCCCTCAGTCCCTGG No data
1084203422_1084203428 -8 Left 1084203422 11:67577136-67577158 CCCTGGTAGGTGTGGGAAGGCTC No data
Right 1084203428 11:67577151-67577173 GAAGGCTCTCGGGGGTGCTTTGG No data
1084203422_1084203429 -7 Left 1084203422 11:67577136-67577158 CCCTGGTAGGTGTGGGAAGGCTC No data
Right 1084203429 11:67577152-67577174 AAGGCTCTCGGGGGTGCTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084203422 Original CRISPR GAGCCTTCCCACACCTACCA GGG (reversed) Intergenic
No off target data available for this crispr