ID: 1084204405

View in Genome Browser
Species Human (GRCh38)
Location 11:67583671-67583693
Sequence GCCCGGGGTGCAGCGGCCGC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 482
Summary {0: 1, 1: 0, 2: 6, 3: 27, 4: 448}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084204394_1084204405 10 Left 1084204394 11:67583638-67583660 CCGGGGACTCCAGGGCGCCCCTC 0: 1
1: 0
2: 2
3: 21
4: 303
Right 1084204405 11:67583671-67583693 GCCCGGGGTGCAGCGGCCGCCGG 0: 1
1: 0
2: 6
3: 27
4: 448
1084204402_1084204405 -9 Left 1084204402 11:67583657-67583679 CCTCTGCGGCCGACGCCCGGGGT 0: 1
1: 0
2: 0
3: 6
4: 91
Right 1084204405 11:67583671-67583693 GCCCGGGGTGCAGCGGCCGCCGG 0: 1
1: 0
2: 6
3: 27
4: 448
1084204396_1084204405 1 Left 1084204396 11:67583647-67583669 CCAGGGCGCCCCTCTGCGGCCGA 0: 1
1: 0
2: 2
3: 12
4: 149
Right 1084204405 11:67583671-67583693 GCCCGGGGTGCAGCGGCCGCCGG 0: 1
1: 0
2: 6
3: 27
4: 448
1084204390_1084204405 27 Left 1084204390 11:67583621-67583643 CCAGCTGCGCGGCGACTCCGGGG 0: 1
1: 0
2: 2
3: 9
4: 92
Right 1084204405 11:67583671-67583693 GCCCGGGGTGCAGCGGCCGCCGG 0: 1
1: 0
2: 6
3: 27
4: 448
1084204400_1084204405 -8 Left 1084204400 11:67583656-67583678 CCCTCTGCGGCCGACGCCCGGGG 0: 1
1: 0
2: 0
3: 8
4: 75
Right 1084204405 11:67583671-67583693 GCCCGGGGTGCAGCGGCCGCCGG 0: 1
1: 0
2: 6
3: 27
4: 448
1084204398_1084204405 -7 Left 1084204398 11:67583655-67583677 CCCCTCTGCGGCCGACGCCCGGG 0: 1
1: 0
2: 1
3: 9
4: 108
Right 1084204405 11:67583671-67583693 GCCCGGGGTGCAGCGGCCGCCGG 0: 1
1: 0
2: 6
3: 27
4: 448

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084204405 Original CRISPR GCCCGGGGTGCAGCGGCCGC CGG Exonic