ID: 1084204405

View in Genome Browser
Species Human (GRCh38)
Location 11:67583671-67583693
Sequence GCCCGGGGTGCAGCGGCCGC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 482
Summary {0: 1, 1: 0, 2: 6, 3: 27, 4: 448}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084204390_1084204405 27 Left 1084204390 11:67583621-67583643 CCAGCTGCGCGGCGACTCCGGGG 0: 1
1: 0
2: 2
3: 9
4: 92
Right 1084204405 11:67583671-67583693 GCCCGGGGTGCAGCGGCCGCCGG 0: 1
1: 0
2: 6
3: 27
4: 448
1084204398_1084204405 -7 Left 1084204398 11:67583655-67583677 CCCCTCTGCGGCCGACGCCCGGG 0: 1
1: 0
2: 1
3: 9
4: 108
Right 1084204405 11:67583671-67583693 GCCCGGGGTGCAGCGGCCGCCGG 0: 1
1: 0
2: 6
3: 27
4: 448
1084204396_1084204405 1 Left 1084204396 11:67583647-67583669 CCAGGGCGCCCCTCTGCGGCCGA 0: 1
1: 0
2: 2
3: 12
4: 149
Right 1084204405 11:67583671-67583693 GCCCGGGGTGCAGCGGCCGCCGG 0: 1
1: 0
2: 6
3: 27
4: 448
1084204402_1084204405 -9 Left 1084204402 11:67583657-67583679 CCTCTGCGGCCGACGCCCGGGGT 0: 1
1: 0
2: 0
3: 6
4: 91
Right 1084204405 11:67583671-67583693 GCCCGGGGTGCAGCGGCCGCCGG 0: 1
1: 0
2: 6
3: 27
4: 448
1084204394_1084204405 10 Left 1084204394 11:67583638-67583660 CCGGGGACTCCAGGGCGCCCCTC 0: 1
1: 0
2: 2
3: 21
4: 303
Right 1084204405 11:67583671-67583693 GCCCGGGGTGCAGCGGCCGCCGG 0: 1
1: 0
2: 6
3: 27
4: 448
1084204400_1084204405 -8 Left 1084204400 11:67583656-67583678 CCCTCTGCGGCCGACGCCCGGGG 0: 1
1: 0
2: 0
3: 8
4: 75
Right 1084204405 11:67583671-67583693 GCCCGGGGTGCAGCGGCCGCCGG 0: 1
1: 0
2: 6
3: 27
4: 448

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084204405 Original CRISPR GCCCGGGGTGCAGCGGCCGC CGG Exonic
900072084 1:779044-779066 GCCGGGGCTGCAGCTGGCGCTGG - Intergenic
900148207 1:1167392-1167414 GCCCTGGGTGCAGCTGCAGGAGG - Intergenic
900175070 1:1287964-1287986 GCCGGCGGTGCAGTGGCCGTAGG - Exonic
901272289 1:7961753-7961775 GGCCGGGGCGCCGCGTCCGCAGG + Intronic
901648484 1:10729139-10729161 GCCTGGGGGGCAGGAGCCGCAGG - Intronic
902786816 1:18738319-18738341 GCCGGGGCTGCCGCTGCCGCTGG - Intronic
902823193 1:18955981-18956003 GCCCGAGTTGCTGCGGCCCCCGG - Exonic
903115572 1:21176435-21176457 CGCCGGGGTGCAGGGGCCGGGGG + Intronic
903526502 1:23994996-23995018 GCCCGGGAGGCAGCGGCTGGAGG - Intergenic
903596901 1:24502372-24502394 GCCCGAGGAGAGGCGGCCGCAGG - Intronic
903897769 1:26620359-26620381 GTCGGGGGCGCAGCTGCCGCCGG - Intergenic
903907706 1:26697491-26697513 GCCCCGGGAGCAGCGGCGGCGGG + Exonic
903923417 1:26817416-26817438 GCCCGGGAGGCAGCGGCTGGAGG + Intergenic
904782989 1:32964536-32964558 GGCCCGGGCGCGGCGGCCGCGGG + Exonic
904794818 1:33051286-33051308 GCCCGGGAGGCAGCGGCTGGAGG + Intronic
905369198 1:37474394-37474416 GTCCGGCGCGCAGCGGCCGCGGG + Intergenic
906436922 1:45804012-45804034 GCCCGGGAGGCAGCGGCTGGAGG + Exonic
906486648 1:46240447-46240469 GCCCGGGAGGCAGCGGCTGGAGG + Intergenic
907442574 1:54488287-54488309 GCCCGGGCAGCAGCCTCCGCAGG + Intergenic
907453923 1:54563096-54563118 GCCCGGGAGGCAGCGGCTGGAGG - Intronic
908555697 1:65254689-65254711 GGCAGGGGCGCAGCGGCGGCGGG + Intronic
910569612 1:88684711-88684733 GCTAGGGGCGCGGCGGCCGCAGG - Intronic
911073031 1:93847193-93847215 GGCCGGGCTGGAGCGGCCGCCGG + Intergenic
911440512 1:97920786-97920808 CTCCGGGGTGCGGGGGCCGCGGG + Intronic
912825486 1:112899346-112899368 GCCCGGGAGGCAGCGGCTGGAGG - Intergenic
912844658 1:113068759-113068781 GCCCGGGAGGCAGCGGCTGGAGG + Intergenic
913250765 1:116910400-116910422 GCCCGGCGGGGAGCGGCCGCGGG + Intronic
913521361 1:119648159-119648181 GCGGCGGCTGCAGCGGCCGCTGG + Intergenic
914293584 1:146297985-146298007 GCCCGCGTCGGAGCGGCCGCCGG + Intergenic
914554628 1:148748768-148748790 GCCCGCGTCGGAGCGGCCGCCGG + Intergenic
916666937 1:166975383-166975405 TCCCTGGGCGCAGCGCCCGCCGG + Intronic
917141615 1:171841400-171841422 GCCCGGGGCGGGGCAGCCGCGGG + Intergenic
919892040 1:201982705-201982727 GCGCGGAGTGCAGCGGCCGCCGG - Exonic
919937060 1:202260408-202260430 GCCCGGGAGGCAGAGGCTGCAGG - Intronic
921060076 1:211578270-211578292 GCACGAGATGCAGCAGCCGCTGG - Exonic
921414448 1:214870452-214870474 GCCCGGGAGGCAGCGGCTGGAGG - Intergenic
922267018 1:223992999-223993021 GCCGGGGCTGCAGCTGGCGCTGG - Intergenic
923219723 1:231882053-231882075 GCCCAGGGCACAGCGGCCACAGG + Intronic
923698867 1:236281617-236281639 GGCCCGTGTGTAGCGGCCGCGGG + Intronic
924629020 1:245719809-245719831 GCTCGGGCTGCAGAGGACGCCGG + Intergenic
1062985659 10:1766176-1766198 GCCAGGAGTGCAGAGGCCTCGGG - Intergenic
1062985688 10:1766322-1766344 GCCGGGAGTGCAGAGGCCACAGG - Intergenic
1063664501 10:8053436-8053458 GCCCGGGTGGCTGCAGCCGCTGG - Intergenic
1064229355 10:13516337-13516359 GCCCGGGGTGGCGCGGAGGCTGG + Intronic
1064622507 10:17229644-17229666 GCCCGGGGTGCGGCTCCTGCAGG + Exonic
1065099572 10:22320750-22320772 GGCCGGGGGGCGGCGGCCGCGGG + Intronic
1065188707 10:23192355-23192377 GGCCAGAGCGCAGCGGCCGCGGG + Exonic
1066464217 10:35639480-35639502 GGCCGGGGGGCGGCGGCGGCGGG - Exonic
1069718416 10:70535098-70535120 GCCAGGGCTGCAGGGGCCCCTGG + Intronic
1069962665 10:72087796-72087818 GGTCGGGGTCCAGCGGCAGCCGG + Intronic
1070318257 10:75334227-75334249 GCCCGGGAGGCAGCGGCTGGAGG - Intergenic
1070689842 10:78516418-78516440 GCCCTGTGTGCAGCTGGCGCAGG + Intergenic
1071695455 10:87864167-87864189 GCCCGGGCTCCGGAGGCCGCCGG + Exonic
1072578473 10:96720592-96720614 GCCGCGGGTGCAGGTGCCGCGGG - Intergenic
1072634264 10:97167277-97167299 GGCCGGGGTGCAGAGGGAGCAGG - Intronic
1072700942 10:97640935-97640957 GCCCGGGGCGCGGCGGCCCAGGG + Exonic
1072950128 10:99840155-99840177 GCCCGGGAGGCAGCGGCTGGAGG - Intronic
1073099514 10:100999518-100999540 GCCCCGGGGCCAGCGGCAGCTGG - Exonic
1073177783 10:101566830-101566852 GCCCTGCGCTCAGCGGCCGCAGG + Intergenic
1074065363 10:110008226-110008248 GCCCGGGCTGCAGCAGCCGCCGG - Exonic
1074586009 10:114768241-114768263 GGCGGGGACGCAGCGGCCGCAGG + Intergenic
1075040584 10:119104269-119104291 GCCCGGGCTCCCGCGGCCCCCGG + Intronic
1076117077 10:127907845-127907867 GAGCGGGATGCAGCAGCCGCCGG + Intronic
1076858425 10:133128470-133128492 GCCCGAGGAGCAGCGGCGGCTGG + Exonic
1077034871 11:489765-489787 CCCCGGGGGGCAGGGGCCGGAGG + Intronic
1077036165 11:495546-495568 TCCCGGGGTGGAGCCGCCACAGG + Intronic
1077142127 11:1029351-1029373 GCCCAGGGTGCACCGGCTGTGGG + Exonic
1077287486 11:1774058-1774080 CCCCAGTGTGCAGCAGCCGCCGG - Intergenic
1077305570 11:1867317-1867339 GGGTGGGGTGCAGCGGCCTCTGG - Intronic
1077502177 11:2914393-2914415 GTCCGGCGTGCAGAGGCCCCAGG + Intronic
1078091676 11:8268200-8268222 GCCCGGGCTTCGGCGGCGGCGGG - Intronic
1078514409 11:12009542-12009564 GCCTGGGATGCCGCGGGCGCAGG - Intronic
1078693980 11:13610703-13610725 GCATGGGATGCAGTGGCCGCAGG + Intergenic
1080385120 11:31806256-31806278 GAGCGGGGAGCAGCCGCCGCAGG + Intronic
1080551342 11:33376228-33376250 GCCGAGGCTGCAGCGGCGGCGGG + Intergenic
1081636752 11:44726951-44726973 GGCGGGCGTGCAGCTGCCGCCGG + Intronic
1081784957 11:45739204-45739226 GCCCGGGAGGCAGCGGCTGGAGG - Intergenic
1081927872 11:46845941-46845963 GCGCGGGTGGCAGCGTCCGCGGG - Intronic
1082996941 11:59262391-59262413 TCCCAGGGTGCAGCTGCTGCTGG + Intergenic
1083199097 11:61108994-61109016 TCCCAGGGTGCAGGGGCGGCAGG + Intronic
1083429149 11:62604957-62604979 GCCCGGGTGGCAGGGGCTGCAGG + Intronic
1083763578 11:64831789-64831811 CCCCGGGGCACAGCGGCTGCTGG - Intronic
1083939569 11:65888426-65888448 GCTCGGGGCGCTGCGGCCCCGGG - Exonic
1083950978 11:65955993-65956015 CTCCTGGGTGCAGCGGGCGCAGG + Intronic
1084204405 11:67583671-67583693 GCCCGGGGTGCAGCGGCCGCCGG + Exonic
1084257935 11:67955428-67955450 GCCGGGGGTGCCGGGGACGCGGG - Intergenic
1084310379 11:68313009-68313031 GCCCGGGACGCAGCGTCCCCGGG - Intronic
1084538894 11:69774691-69774713 GGGCGGGGGGCAACGGCCGCCGG - Intronic
1084709618 11:70835941-70835963 GCTCGGGGTGCAGTGGGCTCGGG - Intronic
1085666310 11:78417936-78417958 GCCGGGGGAGCAGCTGCAGCAGG + Intronic
1088579119 11:111299286-111299308 GCGCTGGGTGCGGCGGCCGAGGG - Exonic
1089262415 11:117232180-117232202 GCCCGGGGTCCGGCTCCCGCGGG + Exonic
1089499910 11:118925792-118925814 GGCGGTGGTGCAGCGGCCCCGGG + Intronic
1090662215 11:128890663-128890685 CCCCGGCGTGCGGCGGCGGCTGG - Intergenic
1091616470 12:2053961-2053983 GCGCGGGGGGCAGAGGGCGCCGG + Intronic
1091762446 12:3096025-3096047 GCCCGGGAGGCAGCGGCTGGAGG - Intronic
1092143802 12:6201092-6201114 GGCAGGGGTGCCTCGGCCGCGGG + Intronic
1092428172 12:8390225-8390247 TCCCGGGGTGCCGGGGGCGCAGG - Intergenic
1093435495 12:19130251-19130273 GGCCGGGCGGGAGCGGCCGCAGG + Intronic
1094199239 12:27780157-27780179 GCCCCGGGAGGAGGGGCCGCCGG + Exonic
1094624171 12:32107010-32107032 GCCCGGGCTGCGGCGGCCGCGGG - Intronic
1095439341 12:42227145-42227167 GCCCGGGAGGCAGCGGCTGGAGG + Intronic
1096464007 12:51838236-51838258 GCCCAGTGTGCAGTGGCCTCTGG - Intergenic
1096528692 12:52230071-52230093 GCCCGGGGTGGAGAGGAAGCAGG + Intergenic
1096634324 12:52948983-52949005 GCCCGGGGCGGAGCGGCCCGGGG + Exonic
1097187429 12:57203217-57203239 CCCCGCGATGCAGCGGCCGTTGG - Exonic
1098320650 12:69239937-69239959 GGCCGCTGTGCAGCTGCCGCCGG + Intronic
1100309133 12:93378138-93378160 GCCCGCGTCGGAGCGGCCGCCGG + Exonic
1100844612 12:98645435-98645457 CTCCGGGGTGCAGCCGCCGTCGG + Exonic
1101135555 12:101739604-101739626 GCCCAGGGTGCTTTGGCCGCCGG + Intronic
1101504079 12:105330708-105330730 GCCCGGGGCGCAGCGGGCTGCGG - Exonic
1101680055 12:106955969-106955991 GCCTGGGCGGCAGCGGCGGCCGG - Exonic
1102578386 12:113871831-113871853 GCCCGGGAGGCAGCGGCTGGAGG + Intronic
1102644636 12:114396184-114396206 GCCCGGGGTCGGGCAGCCGCGGG - Intronic
1102997452 12:117361215-117361237 ACCCGGAGCGCGGCGGCCGCGGG - Intronic
1103607744 12:122099526-122099548 GCCCGGGCTGCAGGGACAGCAGG - Intronic
1103749840 12:123151076-123151098 GCGCGGGCAGCAGCGGCCGCTGG - Intergenic
1103880234 12:124160340-124160362 GCCCCGGCTGCAGCTGCAGCTGG + Intronic
1104697220 12:130872382-130872404 GCCCGGGGAACGGCGGCCGGAGG - Intronic
1105202762 13:18194236-18194258 GGCCGGGGCGCACGGGCCGCTGG - Intergenic
1105368533 13:19782645-19782667 GCCATGGCTGCCGCGGCCGCCGG + Exonic
1105462715 13:20607168-20607190 GCCAGGCGTGCAGCAGCAGCAGG - Intronic
1106391711 13:29340144-29340166 TCACGGGGTGCAGCTGCAGCGGG + Intronic
1108350240 13:49585279-49585301 GCCCCGGACGCAGCGCCCGCAGG + Intronic
1110269174 13:73574250-73574272 GCCCGGGAGGCAGCGGCTGGAGG + Intergenic
1110318425 13:74135032-74135054 GCGCGGGGGGCACCGCCCGCGGG - Intergenic
1110573065 13:77026937-77026959 GCGCGGGGGGCCGCGGCTGCGGG - Exonic
1112208255 13:97347081-97347103 CGCCGGGGTGCAGGGGCGGCGGG - Intronic
1114865999 14:26597152-26597174 GGCAGGGGCGCAGGGGCCGCCGG + Intronic
1115609545 14:35038516-35038538 GCCCGGGAGGCAGCGGCTGGAGG + Intergenic
1116871637 14:50073931-50073953 GCCCGGGAGGCAGCGGCTGGAGG + Intergenic
1117119600 14:52553169-52553191 GCGGGGGCGGCAGCGGCCGCCGG - Exonic
1119296557 14:73537814-73537836 GCCCGGGGTGCGGCGCGAGCCGG + Exonic
1119300799 14:73569819-73569841 GCCCGGGGTGCGGCGCGAGCCGG + Exonic
1121279357 14:92688030-92688052 GTTCGCGGTGGAGCGGCCGCAGG + Exonic
1121473509 14:94174422-94174444 GCCCGGGCCGGAGCGGCCCCGGG - Exonic
1121796678 14:96741687-96741709 GCCCGGGCTGCAGCAGAGGCTGG + Intergenic
1122138166 14:99646311-99646333 GCCTGGGGTGGAGAGGCCCCAGG + Intronic
1122577499 14:102751362-102751384 GTGCAGGGTGCAGCGCCCGCCGG + Intergenic
1122964026 14:105112725-105112747 GCCCGGGAGGCAGCGGCTGGAGG - Intergenic
1123091206 14:105743118-105743140 GCCCAGGGCGCAGAGGCCCCTGG + Intergenic
1123162031 14:106287671-106287693 GGCCGGGTCGGAGCGGCCGCTGG - Intergenic
1123909687 15:24954985-24955007 GCGCAGAGTGGAGCGGCCGCCGG + Exonic
1125492436 15:40158262-40158284 GCCCTGTGTGCAGCGGCCCTGGG - Intergenic
1125500842 15:40239567-40239589 GCCCGGGGGGCTGTGGCAGCAGG + Exonic
1125535676 15:40440438-40440460 GCCCTGGGGGCAGCAGCCTCCGG + Intronic
1125659001 15:41381904-41381926 GCCCGGGAGGCAGCGGCTGGAGG + Intergenic
1125903573 15:43370749-43370771 GCCCAAGGAGCAGCGGCTGCGGG + Intronic
1128529153 15:68432088-68432110 GTCCGGTGTGCAGCGGCGGCGGG + Exonic
1129933692 15:79432180-79432202 GCCCGCGCTCCAGCGGCCCCGGG - Intergenic
1130312277 15:82765982-82766004 GTCCGTGGTGCAGCTGCAGCCGG - Exonic
1131827172 15:96331169-96331191 GCCCGGGCCGCCGCTGCCGCCGG - Exonic
1132585783 16:705336-705358 GACCGAGGCCCAGCGGCCGCGGG + Intronic
1132805008 16:1771345-1771367 GGACGGCGTGCAGCGGCGGCTGG - Exonic
1132837162 16:1959859-1959881 CCCCGGGGTGCAGCGGGGGGCGG - Intronic
1132883670 16:2173076-2173098 ACCTGGGGTGCAGCGGCCACAGG + Intronic
1133026066 16:2989477-2989499 GCCCGGGGTGCTGGAGCAGCTGG - Intergenic
1133038282 16:3046579-3046601 GCCCGGAGAGGAGGGGCCGCTGG + Intergenic
1133165873 16:3946904-3946926 GCTCGGGGTGCAGCGCCTACAGG + Intergenic
1135607363 16:23836116-23836138 GCCCGCGGTCCCGCGGCCCCGGG + Exonic
1136454030 16:30370303-30370325 GCCGGGGGCGGAGCGGCCGCTGG + Intergenic
1137655051 16:50152854-50152876 GCCCGGGATCCGGCGGCCACAGG + Intergenic
1139365025 16:66427629-66427651 GCCCGGGGTCGAGGGTCCGCGGG - Intronic
1139914484 16:70419630-70419652 GCCCTGGGTGCAGCAGCCTCGGG + Intronic
1140098474 16:71895082-71895104 CCCCTGGGTGGAGCGGCCGAGGG - Intronic
1141524654 16:84603908-84603930 GCCCAGGGTGCAGTGGCCCCGGG - Intronic
1141688555 16:85583848-85583870 TCCCTGGGAGCAGAGGCCGCCGG - Intergenic
1141839242 16:86564061-86564083 GCTCCAGGTGCAGCGGCCACGGG + Intergenic
1142253791 16:89004081-89004103 GGCCGAGGGGCAGGGGCCGCAGG + Intergenic
1143164193 17:4889814-4889836 GCACGGGGAGCAGGGGCGGCAGG - Intronic
1143411862 17:6713876-6713898 GCCCGCGGTGCGGAGGGCGCGGG - Intergenic
1145205663 17:20983986-20984008 GCCCGGGAGGCAGCGGCTGGAGG + Intergenic
1146167535 17:30601221-30601243 GCTCGGGGAGCAGCAGCCCCTGG + Intergenic
1147963180 17:44179988-44180010 GCCCGGGAGGCAGCGGCTGGAGG + Intergenic
1148858400 17:50591525-50591547 GCCGGCGCTGCAGCGGCAGCTGG + Exonic
1149296081 17:55264027-55264049 GCCTGGGGTGGTGCGGGCGCTGG - Intergenic
1149296273 17:55265027-55265049 CGCTGGGGAGCAGCGGCCGCCGG + Exonic
1149908723 17:60550820-60550842 GCCCGGGAGGCAGCGGCTGGAGG + Intergenic
1149996693 17:61409567-61409589 CCCCGGGGTGCAGCTGCCGCCGG - Intergenic
1150002698 17:61451754-61451776 GCCCAGGGGGCCGCGGGCGCTGG - Intergenic
1150069454 17:62139108-62139130 GCACGTGGTGCAGAGGCAGCGGG - Intergenic
1151743650 17:76000591-76000613 GCTCGTGGTGCAGCGCCGGCGGG + Intronic
1152175195 17:78782423-78782445 ACCCGGGGTGCGGCGCGCGCGGG - Intergenic
1152287792 17:79422581-79422603 GCCCAGGGTCCAGCAGCCTCAGG + Intronic
1152426430 17:80220790-80220812 GCCCGGAGCGGAGCGGCCGGGGG + Intronic
1152617839 17:81346039-81346061 CCCCGGAGGGCGGCGGCCGCGGG - Intergenic
1152808991 17:82372253-82372275 GGCAGGGGGACAGCGGCCGCCGG - Intergenic
1152824989 17:82458945-82458967 GCCCAGGGTGCCGAGGCCGGGGG - Intronic
1153688162 18:7567112-7567134 GCGCGGGGAGGAGCGGCCACCGG - Exonic
1154202302 18:12308110-12308132 GCCCGGCCTGCAGCAGCCGAGGG - Exonic
1158893577 18:61894260-61894282 GCCGGAGGAGCGGCGGCCGCCGG - Intergenic
1160454696 18:78992436-78992458 GTTGGGGGTGCAGGGGCCGCAGG - Exonic
1160727212 19:622653-622675 GCACGTGGTGCAGAGGCAGCGGG - Exonic
1160732388 19:647151-647173 GCCCGGGGTGCAGCCAGCTCGGG - Intergenic
1160796786 19:949303-949325 ACCTGGGGAGCAGCAGCCGCAGG + Intronic
1160867059 19:1260662-1260684 ACCAGGGGTGCAGCGGGCGGAGG + Intronic
1160878198 19:1307580-1307602 GGCCCGGGTTCAGCCGCCGCCGG + Intergenic
1160966477 19:1749019-1749041 GCGCGGGCTGCAGCCCCCGCCGG - Intergenic
1160998715 19:1897772-1897794 GACCGGGGTGCAGCTGCCTTTGG + Intergenic
1161073398 19:2273552-2273574 GCCCTGGGTGGAGGGGTCGCGGG + Intronic
1161222379 19:3123587-3123609 GCCCGGGCGGCAGCAGCCCCCGG + Exonic
1161321126 19:3642005-3642027 GCCTGGGGTGTAGCGGGCTCTGG + Intronic
1161381351 19:3966700-3966722 TCCAGGTGTGCAGCGGCCGCAGG - Intronic
1161628619 19:5340311-5340333 GCCCGGGGTGGTGCAGCCGGCGG + Intronic
1161925130 19:7294130-7294152 GCCCGGGCCGCAGCGGCCGGGGG - Intergenic
1161939731 19:7394997-7395019 GCTCGGGGAGCAGCAGCCCCAGG + Intronic
1162886687 19:13702746-13702768 GCCCGGGAGGCAGCGGCTGGAGG + Intergenic
1163013749 19:14441205-14441227 CCCCGGGGTACAGCAGCAGCTGG + Exonic
1163019658 19:14475404-14475426 GCGCGGGGTGGAGCGGCCCCTGG - Intergenic
1163113267 19:15174343-15174365 GCCCTGGTCGCAGCGGCCGTCGG + Exonic
1163708612 19:18832352-18832374 GCCCGGGCCGCCGGGGCCGCCGG - Exonic
1163723688 19:18910618-18910640 GCCCAGGGCGCAGCGGGGGCAGG - Intronic
1163787058 19:19280101-19280123 CCCCCGGGTGCAGCGGTCACAGG - Intronic
1163906092 19:20150738-20150760 GCCCGGGAGGCAGCGGCTGGAGG - Intergenic
1164191903 19:22925493-22925515 GCCCGGGAGGCAGCGGCTGGAGG + Intergenic
1164530074 19:29041871-29041893 GGCAGGGGTGCAGCGGCAGAAGG - Intergenic
1164639307 19:29812499-29812521 GCGCGGGGTGAGGCGGCGGCGGG - Intronic
1164653345 19:29901731-29901753 GCCCGGGAGGCAGCGGCTGGAGG - Intergenic
1164886622 19:31783793-31783815 GCAAGGGGACCAGCGGCCGCTGG - Intergenic
1165739815 19:38198438-38198460 GCCCAGGGTCCAGGCGCCGCAGG - Exonic
1165803143 19:38565217-38565239 GCGCGGGTTGTGGCGGCCGCAGG + Exonic
1166046519 19:40233696-40233718 GCAGGGGCTGCAGGGGCCGCTGG + Exonic
1166261433 19:41644216-41644238 GCCCGGGAGGCAGCGGCTGGAGG + Intronic
1166765775 19:45251556-45251578 TCCCGGGGGGCAGGGGCGGCCGG - Exonic
1166888250 19:45973941-45973963 GCCCGGGGGGCGGCGGGCGCGGG + Intergenic
1167517364 19:49930941-49930963 GCCAGGGGGGCAGGGGCCGGGGG - Exonic
1167738686 19:51311715-51311737 GCCCGGGGGGCGGCGGGGGCGGG - Intergenic
1168337725 19:55605759-55605781 GGCCCGGGTGCAGCGGGGGCGGG + Intronic
1168536056 19:57171983-57172005 GTCCGGGGGGCGGGGGCCGCGGG + Intergenic
925401362 2:3575541-3575563 GCCCGGGCTGCAGGCGCCGCTGG - Intronic
925993005 2:9268983-9269005 GAGTGGGGTGCAGGGGCCGCTGG + Intronic
926202603 2:10812583-10812605 CCCCGGCGGGCCGCGGCCGCAGG - Intronic
927141872 2:20136351-20136373 GGCCAGGCTGCAGAGGCCGCAGG + Intergenic
927215847 2:20667426-20667448 GCCCGGGGAACCGCGGCGGCCGG - Exonic
927982261 2:27381388-27381410 GCCCGAGGAGCAGAGGCGGCTGG + Exonic
929614367 2:43296845-43296867 GCCCGGGAGGCAGCGGCTGGAGG + Intronic
930071473 2:47369621-47369643 GGCTGGGGGGCAGCGGCCCCCGG + Intronic
930096572 2:47570671-47570693 GCCCGGGGCCCCGCGGACGCCGG - Exonic
931052270 2:58428385-58428407 GCCCGGGCTGCGCCGACCGCCGG + Intergenic
931867225 2:66426075-66426097 TCCCGGCTTCCAGCGGCCGCCGG - Intergenic
932780603 2:74556327-74556349 GCCTGAGGGGCAGCGGCGGCCGG - Exonic
935137651 2:100321814-100321836 GCTCGGGGCGCTGCGGCCGGAGG - Exonic
937074165 2:119088930-119088952 GCCCCAGGTGCAGCATCCGCAGG + Intergenic
937917704 2:127107040-127107062 GCGCGGCGTGGAGCGGCAGCCGG - Exonic
937919697 2:127120528-127120550 GCCCGGGAGGCAGCGGCTGGAGG - Intergenic
937950995 2:127387898-127387920 GACGAGGGTGCCGCGGCCGCTGG - Intronic
938088415 2:128416920-128416942 TCCAGGGGTGCAGAGGCTGCTGG - Intergenic
938290213 2:130145018-130145040 AGCCGGGGTGCAGTGGCAGCGGG - Exonic
938397856 2:130963973-130963995 GGCGGCGGTGCGGCGGCCGCGGG - Intronic
938466316 2:131527927-131527949 AGCCGGGGTGCAGTGGCAGCGGG + Exonic
939178613 2:138780214-138780236 CCACGAGGGGCAGCGGCCGCAGG + Exonic
940453695 2:153871744-153871766 GCCCGGGGAGGAGCGGGAGCAGG + Intergenic
941951495 2:171160834-171160856 GCCCGGGAGGCGGCGGCGGCGGG + Intronic
942184975 2:173416296-173416318 GCCCCGTGTGCACGGGCCGCAGG - Intergenic
943185177 2:184598352-184598374 GCTCGGGCTGGCGCGGCCGCGGG + Exonic
946327792 2:218993622-218993644 GCCTGGGCTGCGGCGGGCGCGGG - Intergenic
947736072 2:232456208-232456230 GCCCTGGGTGCTGCTGCTGCTGG + Exonic
948116012 2:235494589-235494611 GCCCGGGGCGCCGCAGCCCCCGG - Exonic
948207086 2:236168118-236168140 GCCCGGCATGCAGCGGGCCCAGG - Exonic
948493061 2:238326334-238326356 GCCAGGGCTGCAGTGGCTGCAGG + Intronic
948746114 2:240095550-240095572 GTCCCGGGTGCAGGGGCCCCTGG + Intergenic
948746172 2:240095729-240095751 GTCTGGGGTGCAGGGGCCACGGG + Intergenic
948751671 2:240136706-240136728 CCCAGGGGTGCAGCGGCCGTGGG - Intronic
948850059 2:240701437-240701459 GCCAGGGGGGCTGCGGCCGGAGG - Intergenic
1168777746 20:462270-462292 GCCCGGGGGGCAGGGGCAGCTGG - Intronic
1168828847 20:833514-833536 GCCGGGGCTGAAGCGGCGGCAGG + Intergenic
1170425176 20:16228438-16228460 GCCCGGGAGGCAGCGGCTGGAGG - Intergenic
1171986915 20:31666918-31666940 GCCCAGGGTGCAGCAGCCTGTGG + Intronic
1172271296 20:33657130-33657152 GCCTGGGGTTCAGAGGCCTCTGG + Exonic
1172350067 20:34231365-34231387 GCCCGGGAGGCAGCGGCTGGAGG - Intronic
1172511621 20:35504804-35504826 GCCCAGGCTGCAGCGGGAGCTGG + Exonic
1174171596 20:48621121-48621143 GCCCGGGGAACAGCAGCCTCTGG + Intergenic
1174287722 20:49484071-49484093 GCCCGGGCTGCAGGCGCCGCGGG + Intergenic
1175366773 20:58461279-58461301 GCCCCTGGTGTAGCGGCCGGCGG + Exonic
1175424416 20:58854694-58854716 GCCCGGGTCTCAGCAGCCGCAGG - Exonic
1175429526 20:58891679-58891701 GGCCGGGCTGCGGCGGCGGCGGG - Intronic
1175731183 20:61354824-61354846 GCCAGGGGTGCAGGAGCGGCTGG + Intronic
1175897776 20:62346968-62346990 GCCGGGGCAGCAGCGGTCGCAGG + Exonic
1175993086 20:62799140-62799162 GCCTGCGGTGCAGAGGCCCCAGG + Intronic
1176029818 20:63006557-63006579 GCGCGAGGTGCAGGCGCCGCGGG + Exonic
1176029829 20:63006595-63006617 GCCCGGAGTGCCGTAGCCGCGGG + Exonic
1176286616 21:5022239-5022261 GCCAGGGGTGCTGCGGGTGCCGG - Intergenic
1176549793 21:8216197-8216219 GGCCCGGGTGGAGCCGCCGCAGG + Intergenic
1176557684 21:8260426-8260448 GGCCCGGGTGGAGCCGCCGCAGG + Intergenic
1176568718 21:8399231-8399253 GGCCCGGGTGGAGCCGCCGCAGG + Intergenic
1176576632 21:8443466-8443488 GGCCCGGGTGGAGCCGCCGCAGG + Intergenic
1176715191 21:10343769-10343791 GGCCGGGGCGCACGGGCCGCTGG + Intergenic
1177178644 21:17721142-17721164 GCCCGGGAGGCAGCGGCTGGAGG - Intergenic
1178488849 21:33035266-33035288 GCCCAGAGTGCAGCTGCTGCTGG + Intergenic
1179431037 21:41321378-41321400 CCCGGGAGTGCAGCGCCCGCAGG + Intronic
1179870565 21:44241236-44241258 GCCAGGGGTGCTGCGGGTGCCGG + Intergenic
1179903236 21:44405911-44405933 GCCCGGGGTACAGCGTCGCCGGG - Exonic
1179953651 21:44725719-44725741 GCCCGGGAAGCAGAGGCTGCAGG + Intergenic
1179998524 21:44984888-44984910 GCCGGGGGTGGAGGGGCCGTGGG - Intergenic
1180542486 22:16463679-16463701 GGCAGGGGTGCAGCGCCGGCAGG - Intergenic
1180871704 22:19150293-19150315 GGCCGGGGCGCCGCCGCCGCGGG + Intergenic
1181130544 22:20729082-20729104 GCCTGGGGTGCTGCAGCAGCTGG - Intronic
1181813710 22:25421139-25421161 GCGCGGCGGGCGGCGGCCGCGGG + Intergenic
1182809376 22:33103019-33103041 GGGCGGGGGGCAGGGGCCGCGGG - Intergenic
1183201178 22:36387022-36387044 GCCCGGAATGCAGCAGCCGTCGG - Intronic
1183294019 22:37019460-37019482 GCCTGGGGAGCTGCGGCCGGGGG - Exonic
1183371282 22:37433868-37433890 GTGCGGGGTGCAGTGGCCTCTGG - Intergenic
1183845100 22:40536410-40536432 GCCCGGGAGGCAGCGGCTGGAGG + Intronic
1183949670 22:41345840-41345862 GCAGGGGGTGCAGCAGCCCCTGG + Intronic
1184236946 22:43187505-43187527 GCCCGGTTTGCCGCGGCCCCCGG + Intergenic
1184697911 22:46150250-46150272 CCCTTGGCTGCAGCGGCCGCGGG + Intergenic
1185229312 22:49671038-49671060 GCTGGGGGTGCAGAGGACGCAGG - Intergenic
1185313603 22:50169825-50169847 TCCTGGGGTGCTGCGGCCACTGG - Intergenic
1203254682 22_KI270733v1_random:132523-132545 GGCCCGGGTGGAGCCGCCGCAGG + Intergenic
1203262738 22_KI270733v1_random:177602-177624 GGCCCGGGTGGAGCCGCCGCAGG + Intergenic
950253874 3:11488335-11488357 GCCCGGGAGGCAGCGGCTGGAGG - Intronic
951013743 3:17705936-17705958 GCCCGGGAGGCAGCGGCTGGAGG - Intronic
951217845 3:20040894-20040916 TTCCGCGGTGCAGCGGCCCCAGG - Intronic
954080515 3:48210834-48210856 GCCCGGGAGGCAGCGGCTGGAGG + Intergenic
954152398 3:48663975-48663997 GCGCCGGGTGCAGAGGACGCGGG + Intergenic
954295922 3:49674435-49674457 GCCCGGGCTGCAGGGACCACGGG - Intronic
955297215 3:57746928-57746950 GCCCGGGAGGCAGCGGCTGGAGG + Intergenic
959042490 3:101438839-101438861 GCCCGGGAGGCAGCGGCTGGAGG + Intronic
959539501 3:107523553-107523575 GCGCGGGCTGGAGCGGCCCCAGG + Intronic
959712211 3:109396472-109396494 GCGCGGGCTGCAGCTGTCGCTGG + Intergenic
961305642 3:125958110-125958132 GCCCGGCGCTCAGCGGCCCCAGG - Intergenic
961402977 3:126660177-126660199 GCCAGGGCTGCAGCGGCAGGTGG + Intergenic
961404511 3:126668723-126668745 GCCTGCGGGGCAGGGGCCGCAGG + Intergenic
961641122 3:128365326-128365348 GCCAAGGTTGCAGGGGCCGCTGG + Intronic
963236795 3:142963861-142963883 GCCCGGGCTGCGGCGGCCCGAGG - Intergenic
966359444 3:179119463-179119485 GCCCGGGAGGCAGCGGCTGGAGG + Intergenic
968079196 3:195834916-195834938 GCCGGGGGTGCTGGGGCCCCGGG + Intergenic
968230781 3:197003433-197003455 GCCCCGGGCGCCGGGGCCGCTGG + Exonic
968512527 4:1001919-1001941 GCCCGGGGCACAGCGGCTGAGGG - Intronic
968534145 4:1113122-1113144 ACCTGGGGTGGAGGGGCCGCGGG - Intronic
968591534 4:1462182-1462204 GACCGGGATGCAGAGGCCGCCGG - Intergenic
968599818 4:1503643-1503665 TCCTGGCGTGCAGGGGCCGCAGG - Intergenic
968615533 4:1575931-1575953 ACCCGGGGTGAAGTGGCCCCAGG + Intergenic
968759771 4:2436771-2436793 GGCAGGGGTGGAGCGGCCCCGGG - Intronic
969309599 4:6345802-6345824 TCCCGGGGTGCAGGGGGCTCGGG - Intronic
971279992 4:25234577-25234599 GCCCGCGGTGCGGCTGCGGCTGG - Intronic
972675758 4:41257750-41257772 GCCCAGGATGCGCCGGCCGCCGG + Intronic
973551237 4:52038125-52038147 GCCGGGGGTGCGGGGGGCGCGGG - Intronic
976226397 4:82798273-82798295 GGCCGGGGCGCAGGGGGCGCCGG + Intronic
976390017 4:84497706-84497728 GCCCGGGCGGCGGCGGCGGCGGG + Exonic
976704800 4:88008396-88008418 GCCCGGGGAGCTGCCGCAGCGGG - Intronic
977810035 4:101347393-101347415 GCCGCTGGTGCCGCGGCCGCCGG + Exonic
978351520 4:107825024-107825046 GCCTCGGGGGCGGCGGCCGCGGG + Intronic
979335281 4:119455085-119455107 GCCGGGGCTGCAGCTGGCGCTGG - Intergenic
982616110 4:157637783-157637805 GCCCGGGAGGCAGCGGCTGGAGG - Intergenic
984952614 4:185018480-185018502 CGCAGGGGCGCAGCGGCCGCGGG - Intergenic
985537339 5:472746-472768 GCCCGACCTGCAGCGGCTGCAGG - Exonic
985545748 5:508162-508184 GCCCGGGATGGAGATGCCGCAGG + Intronic
985545770 5:508279-508301 GCCCGGGATGGAGATGCCGCAGG + Intronic
985545820 5:508491-508513 GCCCGGGATGGAGATGCCGCAGG + Intronic
985545830 5:508533-508555 GCCCGGGATGGAGATGCCGCAGG + Intronic
985545861 5:508660-508682 GCCCGGGATGGAGATGCCGCAGG + Intronic
985629845 5:1008730-1008752 GCGCTGCGGGCAGCGGCCGCCGG + Intergenic
985750724 5:1672733-1672755 GCCCGAGGTGCAGGGACCCCCGG + Intergenic
985781962 5:1876332-1876354 GCTCGGGGTCCGGCGGCCGAGGG + Intergenic
990825417 5:59893329-59893351 GCTCGAGGCGTAGCGGCCGCGGG + Exonic
991054450 5:62306352-62306374 GCCCGGGCCGGCGCGGCCGCGGG + Intronic
991351108 5:65721836-65721858 GCCCGGTGTGCAGCGGGTGCCGG + Intronic
992373709 5:76171046-76171068 GCCCGGGAGGCAGCGGCTGGAGG + Intronic
992515976 5:77492442-77492464 GCTTGGGGTGCGGCGGCCGACGG + Exonic
996717757 5:126601243-126601265 GCCCGGGCTGCGGGGGCCGAGGG + Intronic
997304894 5:132829988-132830010 ACCCGGGGAGAGGCGGCCGCGGG + Intronic
1000985236 5:167858816-167858838 GCCCGGGAGGCAGCGGCTGGAGG + Intronic
1001529886 5:172454396-172454418 GCGCGGGGTGCAGGGAGCGCTGG + Exonic
1001848840 5:174945108-174945130 GGCCTGGGTGCAGTGGCCCCTGG + Intergenic
1001928720 5:175658079-175658101 GCCCGGAGCGCAGCCGGCGCGGG + Exonic
1002224957 5:177713845-177713867 GCCCGAGGAGCAGCTTCCGCAGG + Intronic
1002257783 5:177971348-177971370 GCCCGGGCTGGAGCGTCCCCGGG + Intergenic
1002341423 5:178518832-178518854 GCCCGGGAGGCAGCGGCTGGAGG - Intronic
1002640632 5:180629065-180629087 GCCGGGGCTGCAGGGGCCGTGGG - Intronic
1002895566 6:1378319-1378341 GCCCCGGCAGCGGCGGCCGCCGG - Intergenic
1002927161 6:1611248-1611270 GCCCGGGGGGCTGCTCCCGCTGG - Exonic
1003051530 6:2785105-2785127 GCACGGGGGGCAGTGGCCCCTGG - Exonic
1004044673 6:12012375-12012397 GACCGGGGAGCGGCGGCCGCCGG + Exonic
1004387937 6:15188433-15188455 GCCCGGGAGGCAGCGGCTGGAGG + Intergenic
1006492119 6:34396966-34396988 GCCCGGGAGGCAGCGGCTGGAGG + Intronic
1007614275 6:43171365-43171387 CCCCGGGGGGCAGGGGCTGCTGG - Exonic
1007630312 6:43269755-43269777 GCCCGAGGAGCCGCCGCCGCCGG - Intronic
1007674439 6:43581582-43581604 GCCCGGGAGGCAGCGGCTGGAGG - Intronic
1008673091 6:53793806-53793828 GCCAGCGTGGCAGCGGCCGCAGG + Intergenic
1011405434 6:87010837-87010859 GCCCGGGAGGCAGCGGCTGGAGG - Intronic
1013119133 6:107125919-107125941 GCCCGGAGGGCAGAGGCCCCTGG - Intergenic
1015476528 6:133664276-133664298 GCCCGGGAGGCAGCGGCTGGAGG + Intergenic
1015626255 6:135182747-135182769 GCGCGGGGACCAGCGCCCGCAGG - Intronic
1016010793 6:139135631-139135653 GCCGCGGGGGCTGCGGCCGCGGG + Exonic
1019032319 6:169024172-169024194 GCCCGGGGAGGGGTGGCCGCCGG + Intergenic
1019325637 7:436903-436925 GCCCAGGGTGCACCGACCGAGGG + Intergenic
1019395419 7:815797-815819 GCCTGGGGAGGAGGGGCCGCGGG + Intergenic
1019471600 7:1224232-1224254 TCCCGGGGTGCAGCTGCTTCGGG + Intergenic
1019642879 7:2114047-2114069 GGCCTGGGTGCAGCAGGCGCGGG - Intronic
1020105722 7:5421411-5421433 GCCCGGGGCGCACAGGCGGCCGG + Exonic
1020252887 7:6483803-6483825 ACCCGGGGGGCAGCGGCCTGCGG - Intronic
1020616639 7:10466457-10466479 GCCCGGGAGGCAGCGGCTGGAGG - Intergenic
1021452774 7:20798054-20798076 GCCCGGGCTGCGGCGGCCGCGGG + Intergenic
1021872137 7:25017941-25017963 GCCCGGGAGGCAGCGGCTGGAGG + Intergenic
1021969233 7:25950945-25950967 GGCCGGGGTGCACGGGCGGCTGG + Intergenic
1022020904 7:26398627-26398649 GCCCCGGGAGCCGCGGCGGCCGG - Intergenic
1022088159 7:27088475-27088497 GCTCGGGCAGCGGCGGCCGCGGG - Intergenic
1022113758 7:27246182-27246204 GCCCGGGGTAGAGCGGCGGGTGG - Exonic
1022698007 7:32728685-32728707 GGCCGGGGGGCCGCCGCCGCGGG + Intergenic
1023000314 7:35801414-35801436 GCCCGGGGCGCGGCAGCGGCGGG + Intronic
1023638580 7:42237094-42237116 GCGCGGGGTGCGCCCGCCGCGGG + Intronic
1023831459 7:44040928-44040950 GTGCGGGGCGCAGCGGCAGCGGG - Intergenic
1023879406 7:44309683-44309705 GCCCGGGCAGGAGCGCCCGCGGG + Intronic
1024068797 7:45768686-45768708 GCCGGGGCTGCAGCTGGCGCTGG + Intergenic
1025834321 7:65080973-65080995 GCCAGGGCTGCAGCTGGCGCTGG + Intergenic
1025904091 7:65770493-65770515 GCCAGGGCTGCAGCTGGCGCTGG + Intergenic
1026765056 7:73155089-73155111 GCGCGGGGGGCGGCGGCGGCCGG - Intergenic
1027041529 7:74964844-74964866 GCGCGGGGGGCGGCGGCGGCCGG - Exonic
1027082113 7:75237525-75237547 GCGCGGGGGGCGGCGGCGGCCGG + Intergenic
1028762337 7:94509914-94509936 GTCGGGGGCGCCGCGGCCGCGGG + Exonic
1029109565 7:98205725-98205747 GCCTGGGAGGCCGCGGCCGCGGG - Exonic
1029390694 7:100272071-100272093 GCGCGGGGGGCGGCGGCGGCCGG + Exonic
1029609303 7:101618232-101618254 GCCCAGGGTGCAGCGAGGGCAGG + Intronic
1029741783 7:102495230-102495252 TTGCGGGGTGCAGCGGCAGCGGG - Intronic
1029759774 7:102594399-102594421 TTGCGGGGTGCAGCGGCAGCGGG - Intronic
1029777136 7:102690309-102690331 TTGCGGGGTGCAGCGGCAGCGGG - Intergenic
1030193340 7:106830999-106831021 GCCCGGCGAGGAGCGGCCGGGGG - Intergenic
1031483179 7:122302017-122302039 GCCCGGGCTGCAGGGGCCCCGGG + Exonic
1034447863 7:151122613-151122635 GCCTGGGGAGCGGCGGCAGCGGG - Intronic
1034483592 7:151341937-151341959 GCCAGGGGTGGAGCGGCCGCGGG + Intronic
1034558175 7:151863040-151863062 TCCTGGGGTGCAGGGGGCGCTGG + Intronic
1034558183 7:151863067-151863089 TCCCTGGGTGCAGGGGGCGCTGG + Intronic
1035373407 7:158393075-158393097 ACCTGGGGTGCAGAGGCCCCTGG - Intronic
1035508116 8:150619-150641 GCCCGGGAGGCAGCGGCTGGAGG - Intergenic
1036785301 8:11681473-11681495 GCGCGGGGTGCGGCGCTCGCGGG + Intronic
1039618324 8:38974545-38974567 ACCCGGGGCGCAGCGGCTGGAGG - Exonic
1042040054 8:64580806-64580828 CACCTCGGTGCAGCGGCCGCCGG + Exonic
1042048808 8:64685171-64685193 GCCCGGGAGGCAGCGGCTGGAGG + Intronic
1042155562 8:65841538-65841560 GCCCGCCCTGCCGCGGCCGCCGG + Exonic
1044660459 8:94590201-94590223 GCCCGGGAGGCAGCGGCTGGAGG + Intergenic
1045476884 8:102560790-102560812 GCACGGGTTGCAGGGGCTGCAGG - Exonic
1047848278 8:128827156-128827178 GCCCGGGAGGCAGCGGCTGGAGG - Intergenic
1048073326 8:131042311-131042333 TCCCGGGGTGCAGGGTCTGCAGG + Exonic
1048553981 8:135457626-135457648 GCCCGGAGCGCGGGGGCCGCCGG + Exonic
1049279134 8:141735336-141735358 GCCTGGGGCACAGCTGCCGCTGG + Intergenic
1049663938 8:143834833-143834855 GCCCAGGGAGCAGCTGCCCCAGG + Exonic
1049721030 8:144115646-144115668 GCCCGGAGAGCCGCCGCCGCTGG + Exonic
1049721181 8:144116206-144116228 GCCGCGGGGGCAGCGGGCGCGGG - Exonic
1049778832 8:144418258-144418280 GCCGGGGGTGCAGAGCCTGCTGG + Intergenic
1052192701 9:25677787-25677809 GCTCGAGGTGCAGCTGCAGCAGG + Exonic
1052888810 9:33676928-33676950 GCCCGGGCTCCGGAGGCCGCTGG - Intergenic
1053256044 9:36616044-36616066 GCCCGGGAAGCAGCGGCTGGAGG - Intronic
1053457062 9:38241537-38241559 GCCCGGGAGGCAGCGGCTGGAGG + Intergenic
1055266209 9:74498355-74498377 GCCCGGCGCGCAGTGGTCGCCGG + Intronic
1055266225 9:74498390-74498412 GCGCGGGGCGCACCGGCCGGGGG + Intronic
1055483422 9:76732781-76732803 GCCCAGGGTCCAGTGGCTGCTGG - Intronic
1057180111 9:93025176-93025198 GCCCAGGGTTCAGCTGCCTCAGG + Intronic
1059210854 9:112513697-112513719 GCCCGGGAGGCAGCGGCTGGAGG + Intronic
1060064773 9:120495050-120495072 GCCCGGGAGGCAGCGGCTGGAGG + Intronic
1060096267 9:120793359-120793381 GGACCGGGAGCAGCGGCCGCAGG - Exonic
1060893488 9:127202900-127202922 GGCCGCAGGGCAGCGGCCGCAGG + Intronic
1060974189 9:127755013-127755035 GCCCCGGGCGGAGCGGCCGGGGG + Intronic
1060979945 9:127786065-127786087 GCCTGGAGTGCGGCGGCGGCGGG + Exonic
1061263785 9:129494219-129494241 CCCCAGGGTGCTGCGGCAGCTGG - Intergenic
1061559770 9:131394598-131394620 GGCCGGGCTGCAGAGGCCGGAGG + Intronic
1061578170 9:131520698-131520720 GCTCGGGGTGGGGCGGCCTCTGG - Intronic
1061862947 9:133477210-133477232 ACCCTGGGAGCAGCGGCCGGAGG - Exonic
1061898102 9:133658859-133658881 TCCCGGTGTGCAGCGGGTGCGGG + Exonic
1061984097 9:134119072-134119094 GCCCGGGAGGCAGCGGCTGGAGG - Intergenic
1062084430 9:134641577-134641599 GCCCGGGGCGGAGCGGACGTGGG - Intergenic
1062220210 9:135410997-135411019 GCCCGGGCTGCAGCTGCGGCAGG + Intergenic
1062429600 9:136521130-136521152 GGCCTGGGTGCAGGGGCCGCCGG + Intronic
1062430819 9:136526194-136526216 CCCCGAGGTGGAGCGGCCGCTGG + Intronic
1062501941 9:136855441-136855463 GCCCAGGAGGCAGCGGCTGCAGG - Exonic
1062513372 9:136920257-136920279 GCACGAGGTGCAGTGGCTGCGGG + Exonic
1062542060 9:137045886-137045908 GCCCTGCGTGGAGCCGCCGCCGG - Exonic
1062549064 9:137077742-137077764 GCTCTGGGGGCAGGGGCCGCAGG - Exonic
1062579731 9:137223903-137223925 GGCAGGGGTGCAGCGGGCACTGG - Intergenic
1062592082 9:137278717-137278739 GCTCGGGGGGCCGCGGCAGCAGG - Exonic
1203471083 Un_GL000220v1:115668-115690 GGCCCGGGTGGAGCCGCCGCAGG + Intergenic
1203478904 Un_GL000220v1:159640-159662 GGCCCGGGTGGAGCCGCCGCAGG + Intergenic
1185450776 X:280185-280207 GCCCAGGGTCCCGGGGCCGCGGG - Intronic
1185465476 X:351987-352009 GCCGGGGGTGCAGCTGTCTCTGG - Intronic
1187976702 X:24710079-24710101 GCCCGGGAGGCAGCGGCTGGAGG - Intronic
1190285224 X:48957203-48957225 GCGCTGGGCGCAGCGGCGGCGGG - Exonic
1191618318 X:63190345-63190367 GCCCGGGAGGCAGCGGCTGGAGG - Intergenic
1192621074 X:72680831-72680853 GCCCGGGAGGCAGCGGCTGGAGG + Intronic
1195036327 X:100973403-100973425 GCCCGGGAGGCAGCGGCTGGAGG - Intronic
1195803618 X:108737392-108737414 GTCAGGGGTGCAGCGGGCTCGGG - Intergenic
1196404621 X:115348279-115348301 GCCCGGGAGGCAGCGGCTGGAGG - Intergenic
1200213389 X:154356799-154356821 GCCCGGGACGCAGAGGCCCCTGG + Intronic