ID: 1084204417

View in Genome Browser
Species Human (GRCh38)
Location 11:67583690-67583712
Sequence ACTCCCGCCGGCCCCAGCCC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 576
Summary {0: 1, 1: 0, 2: 4, 3: 57, 4: 514}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084204417_1084204430 26 Left 1084204417 11:67583690-67583712 CCGGGGCTGGGGCCGGCGGGAGT 0: 1
1: 0
2: 4
3: 57
4: 514
Right 1084204430 11:67583739-67583761 GGCGCCGTGACTCAGCACTGGGG 0: 1
1: 0
2: 4
3: 25
4: 214
1084204417_1084204429 25 Left 1084204417 11:67583690-67583712 CCGGGGCTGGGGCCGGCGGGAGT 0: 1
1: 0
2: 4
3: 57
4: 514
Right 1084204429 11:67583738-67583760 CGGCGCCGTGACTCAGCACTGGG 0: 1
1: 0
2: 0
3: 6
4: 46
1084204417_1084204422 1 Left 1084204417 11:67583690-67583712 CCGGGGCTGGGGCCGGCGGGAGT 0: 1
1: 0
2: 4
3: 57
4: 514
Right 1084204422 11:67583714-67583736 CGCGGGACCCTCCAGAAGAGCGG 0: 1
1: 0
2: 0
3: 10
4: 86
1084204417_1084204428 24 Left 1084204417 11:67583690-67583712 CCGGGGCTGGGGCCGGCGGGAGT 0: 1
1: 0
2: 4
3: 57
4: 514
Right 1084204428 11:67583737-67583759 CCGGCGCCGTGACTCAGCACTGG 0: 1
1: 0
2: 0
3: 3
4: 64
1084204417_1084204423 5 Left 1084204417 11:67583690-67583712 CCGGGGCTGGGGCCGGCGGGAGT 0: 1
1: 0
2: 4
3: 57
4: 514
Right 1084204423 11:67583718-67583740 GGACCCTCCAGAAGAGCGGCCGG 0: 1
1: 0
2: 2
3: 11
4: 138
1084204417_1084204431 29 Left 1084204417 11:67583690-67583712 CCGGGGCTGGGGCCGGCGGGAGT 0: 1
1: 0
2: 4
3: 57
4: 514
Right 1084204431 11:67583742-67583764 GCCGTGACTCAGCACTGGGGCGG 0: 1
1: 0
2: 0
3: 13
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084204417 Original CRISPR ACTCCCGCCGGCCCCAGCCC CGG (reversed) Exonic