ID: 1084204468

View in Genome Browser
Species Human (GRCh38)
Location 11:67583890-67583912
Sequence GCTGCGGGTTGGCCCCATGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 114}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084204468_1084204485 30 Left 1084204468 11:67583890-67583912 CCAGCATGGGGCCAACCCGCAGC 0: 1
1: 0
2: 1
3: 7
4: 114
Right 1084204485 11:67583943-67583965 GCCCACCTCGAGACCCGGGACGG 0: 1
1: 0
2: 0
3: 10
4: 80
1084204468_1084204484 26 Left 1084204468 11:67583890-67583912 CCAGCATGGGGCCAACCCGCAGC 0: 1
1: 0
2: 1
3: 7
4: 114
Right 1084204484 11:67583939-67583961 CCTCGCCCACCTCGAGACCCGGG 0: 1
1: 0
2: 0
3: 16
4: 165
1084204468_1084204477 1 Left 1084204468 11:67583890-67583912 CCAGCATGGGGCCAACCCGCAGC 0: 1
1: 0
2: 1
3: 7
4: 114
Right 1084204477 11:67583914-67583936 TCAGGCCCGGGCTCCCGGCAGGG 0: 1
1: 0
2: 1
3: 14
4: 216
1084204468_1084204475 -4 Left 1084204468 11:67583890-67583912 CCAGCATGGGGCCAACCCGCAGC 0: 1
1: 0
2: 1
3: 7
4: 114
Right 1084204475 11:67583909-67583931 CAGCATCAGGCCCGGGCTCCCGG 0: 1
1: 0
2: 3
3: 28
4: 312
1084204468_1084204482 25 Left 1084204468 11:67583890-67583912 CCAGCATGGGGCCAACCCGCAGC 0: 1
1: 0
2: 1
3: 7
4: 114
Right 1084204482 11:67583938-67583960 TCCTCGCCCACCTCGAGACCCGG 0: 1
1: 0
2: 0
3: 8
4: 129
1084204468_1084204476 0 Left 1084204468 11:67583890-67583912 CCAGCATGGGGCCAACCCGCAGC 0: 1
1: 0
2: 1
3: 7
4: 114
Right 1084204476 11:67583913-67583935 ATCAGGCCCGGGCTCCCGGCAGG 0: 1
1: 0
2: 1
3: 8
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084204468 Original CRISPR GCTGCGGGTTGGCCCCATGC TGG (reversed) Intronic
900975695 1:6014899-6014921 GCTGTGGCTTGGACCCATGTGGG + Intronic
901689814 1:10965390-10965412 GCGGCTGGTTGTCCCCTTGCAGG + Intronic
905270999 1:36787392-36787414 GCTGCGGGTTTGCCCCATGAAGG + Intergenic
907367682 1:53976063-53976085 GCTGCCGGTTGCCCCCAGCCCGG - Intergenic
908474035 1:64470921-64470943 GCTGGGGGTCGTCACCATGCAGG + Exonic
915313018 1:155013825-155013847 GCTGCTCCTTGGCCCCATGGGGG + Intronic
920376957 1:205513924-205513946 GCTGCTGTTGGGCCACATGCTGG + Intronic
924656551 1:245977807-245977829 TCTGAAGGTTGGCCCCATGCAGG + Intronic
1067224361 10:44365841-44365863 GCTGCCAGTCAGCCCCATGCTGG - Intergenic
1069318177 10:67134367-67134389 GCTACAGGTTGGCACCATGATGG + Intronic
1069801942 10:71087086-71087108 GCTGAGGGTTGGGCAGATGCTGG + Intergenic
1069872550 10:71542090-71542112 GCAGTGGCTTGGTCCCATGCAGG + Intronic
1070195345 10:74151445-74151467 CCTGCGTGTTGGCCCCAAGCTGG - Intronic
1070605263 10:77893925-77893947 CCTGTGGGAAGGCCCCATGCGGG - Intronic
1074884309 10:117682922-117682944 TCTGGGGGTGGGCCCCAGGCAGG - Intergenic
1075709089 10:124521216-124521238 GCTGTGTGCTGGCCCCAGGCTGG - Intronic
1075762877 10:124870121-124870143 GTGGGGGGCTGGCCCCATGCAGG + Intergenic
1077116749 11:888703-888725 GTCGTGGGTGGGCCCCATGCAGG + Intronic
1080083737 11:28253589-28253611 GCTGGGGGTTGGGGCCATGAGGG - Intronic
1080099183 11:28439584-28439606 CCTGTGGGTGGGCCCAATGCGGG + Intergenic
1080660924 11:34295318-34295340 GTTGGGGGTTGGCCACAGGCAGG + Intronic
1083316423 11:61817178-61817200 GCTGCGGGGTGGCCGCAGGAAGG + Intronic
1084204468 11:67583890-67583912 GCTGCGGGTTGGCCCCATGCTGG - Intronic
1088883503 11:113989652-113989674 GCTGCGCGTGGGCTCCGTGCTGG + Exonic
1090835319 11:130449491-130449513 GCTGCGGGGTGGCCTCGGGCTGG + Exonic
1094107873 12:26832965-26832987 GCTGCGGCTTGGCCCCGGTCTGG - Exonic
1095728558 12:45478455-45478477 TTTGCAGGTTGGCTCCATGCAGG - Intergenic
1097307332 12:58083977-58083999 GATGCAGGTTGGCCACATGAGGG + Intergenic
1097392371 12:59031371-59031393 GCTGGGGTTTGGCTCCAGGCTGG + Intergenic
1103351588 12:120287428-120287450 GGTGGGGGTTGGCCTCATGGCGG + Intergenic
1103721486 12:122977871-122977893 GCTGCGAGGTGGCCCCATCGTGG + Intronic
1106006361 13:25773576-25773598 GCTGCTGGTGGGTCCCAAGCTGG - Intronic
1114620690 14:24094446-24094468 GGTGCGGGTGGGCCCCGGGCCGG - Intronic
1119259330 14:73228228-73228250 GCTGGAGGTGGGCCCCATCCAGG - Intergenic
1121559398 14:94863608-94863630 ACTGGGGGTTGGCACCAAGCTGG - Intergenic
1122895306 14:104753692-104753714 TCTTCGGGTTGACTCCATGCAGG - Intronic
1125522059 15:40353785-40353807 GCTGCGTGTTGCCCTCATGCAGG - Intronic
1127973806 15:63982682-63982704 GAGGCGGGTTGGCCTTATGCTGG - Intronic
1128638329 15:69317428-69317450 GCTGAGGTCTGGGCCCATGCCGG + Intronic
1130024190 15:80257113-80257135 GCTGTGGCTTGGCTCCATGTTGG + Intergenic
1132654345 16:1035667-1035689 ACTGAGGCTTGGCGCCATGCAGG + Intergenic
1132670514 16:1100555-1100577 TCTCCGGGTGGGCCCCATCCTGG + Intergenic
1132677312 16:1126117-1126139 GTGGCGGGTTGGCCCCATCAGGG + Intergenic
1136408774 16:30064778-30064800 GCCGCAGGTGGGCCCCTTGCAGG + Intronic
1140193576 16:72838353-72838375 GCTGCGTGTTCGGCCCCTGCTGG + Intronic
1142693996 17:1623443-1623465 GCTGAGGGCTTGCCACATGCTGG - Intronic
1144640770 17:16935396-16935418 GCTGCTGGGTGACCTCATGCAGG - Intronic
1146355150 17:32127366-32127388 GCTGCAGGCTGCCCCCCTGCTGG - Intergenic
1150611624 17:66738121-66738143 GCTAAGTGTTGGCCCCATGATGG - Intronic
1160450901 18:78965396-78965418 GGAGCGGGTTGGTCCCAGGCAGG - Intergenic
1161043452 19:2122080-2122102 GGTGCAGGCTGCCCCCATGCCGG + Intronic
1161513228 19:4683148-4683170 GCGGCGGGGGGGCCCCAGGCCGG - Intronic
1163471581 19:17500417-17500439 GCTCCGGGTGGGGACCATGCGGG - Intronic
1163988118 19:20971685-20971707 TCTGTGGATTGGGCCCATGCAGG - Intergenic
1166229025 19:41414804-41414826 TCTGAGGGTAGTCCCCATGCAGG - Intronic
925279655 2:2674282-2674304 TCTGAGGGTTTGCCCCATGTAGG + Intergenic
926093520 2:10065512-10065534 GCTGCAGGTGGGCCCGCTGCTGG + Intronic
927847714 2:26479979-26480001 GCTGAGGGTTGGCCCCTTTATGG + Intronic
929430176 2:41879828-41879850 GCTGCAGGGTGGGCCCATGGTGG - Intergenic
932467214 2:71931593-71931615 GCTGAGAGATGGCCCAATGCAGG - Intergenic
934068760 2:88364519-88364541 GCTGATGGCTGGCCCCAGGCAGG - Intergenic
935202080 2:100865966-100865988 GCTGAGGGTTGGGTCCAGGCTGG - Intronic
935361706 2:102251116-102251138 GCTGCGGGGTGGCGCCGAGCGGG + Intergenic
938473196 2:131585235-131585257 GCTCTGGGTTGTCCCCATGTTGG - Intergenic
943129721 2:183840211-183840233 TGTGCTGGTTGGCCCCCTGCTGG - Intergenic
947723171 2:232381374-232381396 GCCGCGGGGTGGCCCCCTGAGGG + Intronic
948348670 2:237320734-237320756 GCTGAGGGGTGGCCCAAAGCTGG + Intergenic
948599310 2:239099447-239099469 GCTGCCTGTGGGCCCCATGAGGG - Intronic
1169138679 20:3213886-3213908 GCTGAGGGCTGGCCCCAGCCTGG + Intronic
1172113690 20:32561694-32561716 GCTGGGATTTGGGCCCATGCTGG - Intronic
1172167073 20:32906082-32906104 GCTACGTGTGGTCCCCATGCAGG - Intronic
1173808005 20:45938836-45938858 GCTGCTGTGTGGCACCATGCTGG + Intronic
1174206949 20:48847071-48847093 GGTGTGGGTAGGCCCCTTGCTGG - Intergenic
1175260768 20:57672821-57672843 GCTGGGGGTTGGATCCAGGCAGG - Intronic
1178521705 21:33292495-33292517 GGTGCATGTTGGCCACATGCAGG - Intronic
1178724309 21:35037452-35037474 GCTGTGGGGTGGCACCAAGCTGG - Intronic
1179084158 21:38202945-38202967 GGTGCTGGTTGGCCTCCTGCTGG + Intronic
1180226762 21:46398085-46398107 GCTGCGGCTTGGCCGCCTGGCGG - Exonic
1185324435 22:50218795-50218817 CGTGCGGGGTGTCCCCATGCAGG + Exonic
950955449 3:17048017-17048039 TCTGCTGGTTTTCCCCATGCAGG - Intronic
953082464 3:39633676-39633698 GCTGCATGGAGGCCCCATGCTGG - Intergenic
953171446 3:40511334-40511356 GCTGAGGGCTGGCCTCATGGTGG + Intronic
954298580 3:49687316-49687338 GCTGGGGGAAGGCCCCAGGCCGG + Intronic
954639638 3:52090378-52090400 GCCGCGTGTTGGGCCTATGCCGG + Intronic
961387342 3:126530046-126530068 GCTGGGGGCTGGCCCCAAACAGG - Intronic
962842939 3:139252022-139252044 GCTGAGGGGTGTCCCCAAGCTGG - Intronic
963613003 3:147495724-147495746 GCTGCGGGGTTGCACCATGTTGG - Intronic
968832276 4:2939058-2939080 GCTGGGGGTTGGAGCCAGGCAGG - Intronic
969283985 4:6190998-6191020 GCTGCTGTTTGTCCCCATCCTGG - Intronic
977578666 4:98701349-98701371 GCTGCTGCTTGCCTCCATGCCGG + Intergenic
985937787 5:3110045-3110067 GCTGCGTGCTGGCCCCAAGCTGG - Intergenic
998060687 5:139116488-139116510 GCTGCATGTTGGCCCCATGTGGG - Intronic
1003961535 6:11213535-11213557 GCTTCTGATTGGTCCCATGCAGG - Exonic
1005947056 6:30602569-30602591 TATGCGGGGTGGCCCAATGCGGG - Exonic
1007825161 6:44594758-44594780 GCTGCTGGCTGGCCCCAGGACGG - Intergenic
1008053417 6:46922771-46922793 GCTTCGGGTGAGTCCCATGCAGG + Intronic
1013142064 6:107347147-107347169 GCTGCAAGCTGGGCCCATGCAGG - Intronic
1015099902 6:129464723-129464745 GCTGCTGTATGGCTCCATGCTGG - Intronic
1019503986 7:1381383-1381405 TCTGCGGGCTGACCCCAGGCTGG - Intergenic
1019688306 7:2394839-2394861 GCTGCAGGTTGGCGCCCTGTGGG - Intergenic
1020116197 7:5477901-5477923 GCTGAGGGCTGGGCCCCTGCCGG - Intronic
1032947226 7:136868801-136868823 GCTGCGGGTTGGCCAGAGCCTGG + Exonic
1034355087 7:150445138-150445160 GCTGCGGGAAGGCCACATGGGGG + Intergenic
1035471568 7:159112983-159113005 GCTGGGGTCTGGCCCCAGGCAGG - Intronic
1037740915 8:21608626-21608648 GCTTTGGGTTGGCCTCATGAAGG + Intergenic
1040444115 8:47476425-47476447 GCTGCTTATTGGCCGCATGCTGG - Intronic
1041032691 8:53754436-53754458 GCTGCAGGTTGGCCTTATCCTGG - Intronic
1041461731 8:58119090-58119112 GCTTTGGGTTGGCTCCATTCTGG - Intronic
1048182622 8:132210162-132210184 GCTCTGGGTGGGGCCCATGCTGG + Intronic
1048396656 8:134020417-134020439 GCTGTGTGTTGGCCCCATCCAGG + Intergenic
1049578405 8:143400092-143400114 GCTGAGGGTTGGGCCCAGGCAGG + Intergenic
1049689404 8:143952105-143952127 GCTGCTTGTTGGCCGCCTGCCGG - Intronic
1050388129 9:5111607-5111629 GGTGGGCTTTGGCCCCATGCTGG + Intronic
1057108598 9:92445286-92445308 GGTGCGTGGTAGCCCCATGCAGG + Intronic
1057227681 9:93301120-93301142 GCTTTGGGATGGCCCCAAGCAGG - Intronic
1057831371 9:98409655-98409677 GCTGCAGGTTGCCCCCAGGGAGG - Intronic
1058663079 9:107283614-107283636 GCTGCGCGGCGGCACCATGCAGG + Exonic
1061406487 9:130395341-130395363 GCTGCAGGTGGGCGCCAGGCAGG + Intronic
1061509561 9:131052324-131052346 GGTGTGGGTGGGCCCCCTGCAGG + Intronic
1062364311 9:136201772-136201794 GCTGCGGTTTTGCCGGATGCGGG - Intronic
1199679070 X:150213138-150213160 GCAGGGGGTGGGCCCCAAGCTGG + Intergenic
1200011302 X:153122944-153122966 GGTGCAGGTTGGCCTCAAGCAGG + Intergenic
1200028297 X:153276978-153277000 GGTGCAGGTTGGCCTCAAGCAGG - Intergenic