ID: 1084212942

View in Genome Browser
Species Human (GRCh38)
Location 11:67632193-67632215
Sequence TGTCCACACAGGGGCCCTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 255
Summary {0: 1, 1: 0, 2: 2, 3: 44, 4: 208}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084212927_1084212942 23 Left 1084212927 11:67632147-67632169 CCCTGAGCCCCATATTGTCTTAG 0: 1
1: 0
2: 1
3: 12
4: 104
Right 1084212942 11:67632193-67632215 TGTCCACACAGGGGCCCTGTGGG 0: 1
1: 0
2: 2
3: 44
4: 208
1084212930_1084212942 16 Left 1084212930 11:67632154-67632176 CCCCATATTGTCTTAGGCATGTC 0: 1
1: 0
2: 0
3: 8
4: 95
Right 1084212942 11:67632193-67632215 TGTCCACACAGGGGCCCTGTGGG 0: 1
1: 0
2: 2
3: 44
4: 208
1084212932_1084212942 14 Left 1084212932 11:67632156-67632178 CCATATTGTCTTAGGCATGTCTG 0: 1
1: 0
2: 2
3: 14
4: 137
Right 1084212942 11:67632193-67632215 TGTCCACACAGGGGCCCTGTGGG 0: 1
1: 0
2: 2
3: 44
4: 208
1084212931_1084212942 15 Left 1084212931 11:67632155-67632177 CCCATATTGTCTTAGGCATGTCT 0: 1
1: 0
2: 0
3: 6
4: 135
Right 1084212942 11:67632193-67632215 TGTCCACACAGGGGCCCTGTGGG 0: 1
1: 0
2: 2
3: 44
4: 208
1084212928_1084212942 22 Left 1084212928 11:67632148-67632170 CCTGAGCCCCATATTGTCTTAGG 0: 1
1: 0
2: 0
3: 7
4: 95
Right 1084212942 11:67632193-67632215 TGTCCACACAGGGGCCCTGTGGG 0: 1
1: 0
2: 2
3: 44
4: 208

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084212942 Original CRISPR TGTCCACACAGGGGCCCTGT GGG Intronic
900288066 1:1911244-1911266 TGTCCCCACCAGGGCCCTGCCGG + Intergenic
900693417 1:3995455-3995477 TGACCTCACAGTGGCCCTGTAGG - Intergenic
901177728 1:7316942-7316964 TGTTCACTCAGTGGCCATGTGGG + Intronic
903382463 1:22906615-22906637 TGTCCACTCACGGGGCCTGCAGG - Intronic
904293798 1:29504835-29504857 TGACCACCCGGGGGTCCTGTGGG - Intergenic
907337907 1:53712495-53712517 TGTACACACAGGAGACCTGCAGG - Intronic
907679810 1:56552623-56552645 AGTCCTCACAGGGTCCCTGTAGG - Intronic
911951773 1:104182364-104182386 TGTCCTGGGAGGGGCCCTGTGGG + Intergenic
915839027 1:159200946-159200968 AGTCCCCACAGGGCCCCTGGGGG - Exonic
915953690 1:160206271-160206293 TGTCCACTCAGCTGTCCTGTCGG - Intronic
917788663 1:178486209-178486231 TGGCCAGACAGGACCCCTGTAGG + Intergenic
919859783 1:201731892-201731914 CCTCCACAGAGGGGCCCTGGGGG + Intronic
922671314 1:227510354-227510376 TGTACAGACAGGGGCCCAGGAGG + Intergenic
1062763460 10:44933-44955 TGTACAGACAGGGGCCCAGGAGG - Intergenic
1063450627 10:6147770-6147792 GGTCCATACAGGGGACCTGACGG + Intronic
1064228114 10:13505401-13505423 TATCCACACAGGTTTCCTGTAGG - Intronic
1064242716 10:13645629-13645651 TGTAGACACATGGGCCCTTTGGG + Exonic
1064742682 10:18449572-18449594 TGTCCTCACAAGGACCCTATGGG + Intronic
1069657315 10:70099558-70099580 TGACCCCACAGGAACCCTGTCGG - Intronic
1072669548 10:97419376-97419398 TGTCCTCACAGGAATCCTGTGGG + Intronic
1073283344 10:102370696-102370718 TGTCTACACAGGGATCGTGTGGG + Exonic
1075730364 10:124632013-124632035 TGTGCAAACAGAGGCCCAGTTGG - Intronic
1083619787 11:64043188-64043210 TGTCCACAGAAGGGCTTTGTGGG + Intronic
1084212942 11:67632193-67632215 TGTCCACACAGGGGCCCTGTGGG + Intronic
1087847720 11:102992285-102992307 TTTCCACAGAGGGGCCATATTGG - Intergenic
1089119824 11:116125648-116125670 TGTCCACCCTGGGGCTCTGCTGG + Intergenic
1089698020 11:120227683-120227705 CCTCCACACAGGGGACCTGAGGG - Intronic
1089752637 11:120662302-120662324 TTTCCAGCCAGGGGCCCTGCTGG + Intronic
1092515918 12:9212213-9212235 TGCCCACTCAGGGACCCAGTGGG - Intergenic
1095103580 12:38205817-38205839 TGTACAGACAGGGGCCCAGGAGG + Intergenic
1096477745 12:51918718-51918740 TGTCCTCACAACAGCCCTGTGGG - Intronic
1096743364 12:53710374-53710396 GGTCCACACAGGGGCCCTGAAGG + Intronic
1100281237 12:93120224-93120246 TGTCCACAGTGGGCCCCTGCTGG - Intergenic
1104378491 12:128286337-128286359 TGTCTAAGCAGGGGCCCTGGAGG - Intronic
1104612686 12:130242553-130242575 TGTCCACACAGCAGCCCTGGTGG + Intergenic
1104993242 12:132638589-132638611 TGTCCACAAGGGGCCTCTGTGGG + Intronic
1112496691 13:99910932-99910954 TGTCCACACAGAGGGCCAGCTGG - Intergenic
1113548676 13:111175202-111175224 TGTGCACTGAGGGCCCCTGTGGG + Intronic
1113715295 13:112501420-112501442 TGTCCACACAGGGCACCTGCAGG + Intronic
1116692731 14:48131205-48131227 CATCCACACTGGGGGCCTGTCGG - Intergenic
1118609342 14:67527999-67528021 TGTCCACAGTGGGCCACTGTAGG - Intronic
1119148055 14:72334128-72334150 TGTCCAGAAAGAGGCCCCGTGGG + Intronic
1119743247 14:77027540-77027562 GGTCAAGACAGTGGCCCTGTCGG - Exonic
1121565893 14:94908813-94908835 TGTCCGAACCAGGGCCCTGTAGG + Intergenic
1122595409 14:102887003-102887025 AGGCCACACAGGGGCCCTTCTGG - Intronic
1122602042 14:102926436-102926458 TATCCACACAGTGGCTCTGCAGG + Intronic
1123829881 15:24124319-24124341 TGTCCACACATGGGGCTTTTTGG - Intergenic
1123964140 15:25438703-25438725 TGTCCACACCGGGGGGCTGAGGG + Exonic
1129543061 15:76366980-76367002 GGTCCACAGAGGAACCCTGTAGG + Intronic
1131045483 15:89311510-89311532 TGTCCAAGATGGGGCCCTGTTGG - Intronic
1132271220 15:100527518-100527540 CCTCCACACAAGGACCCTGTAGG + Intronic
1132408883 15:101561854-101561876 TGTCCAAAACGGGGCCCTCTGGG - Intergenic
1132662561 16:1068157-1068179 TGGCCAGAGAGGGGGCCTGTCGG + Intergenic
1132663323 16:1071075-1071097 TGGCCAGAGAGGGGACCTGTCGG - Intergenic
1132753051 16:1467659-1467681 CGTCCAAACAGGCACCCTGTGGG + Intronic
1132868344 16:2104631-2104653 GCTCCACACAGGGGCCCAGCAGG - Exonic
1133166977 16:3954735-3954757 AGTCCACACAGGGGAGCTCTTGG + Intronic
1134478719 16:14598771-14598793 TGTAAACACAGGGGCGCTGTAGG - Intronic
1134523385 16:14928370-14928392 GCTCCACACAGGGGCCCAGCAGG + Intronic
1134710979 16:16326854-16326876 GCTCCACACAGGGGCCCAGCAGG + Intergenic
1134948604 16:18341755-18341777 GCTCCACACAGGGGCCCAGCAGG - Intergenic
1136270565 16:29146026-29146048 TGTCCCCACAGGGCCCATGTTGG + Intergenic
1136399653 16:30010566-30010588 TGTCCCCCAAGGGGCCCTGCAGG + Intronic
1136646573 16:31624343-31624365 TGTCCACACAGGGACCCTCAGGG + Intergenic
1138729773 16:59182309-59182331 GGTCCACACATGTGCACTGTTGG + Intergenic
1138880930 16:61014439-61014461 TGGCCTCACAGGGGTCCTCTGGG + Intergenic
1139469073 16:67168820-67168842 TGTCTGCACAGGGGGCCTCTGGG + Exonic
1140835591 16:78791081-78791103 CCTCCACACAGGGCCCCTGAAGG + Intronic
1142074153 16:88107837-88107859 TGTCCCCACAGGGCCCATGTTGG + Intronic
1142218275 16:88840595-88840617 TGTCCACCCTAGGGGCCTGTTGG - Intronic
1144620924 17:16818097-16818119 TGTCCACACAGGGGGCCTCCTGG + Intergenic
1148552460 17:48558632-48558654 AGTCCAAACAGGGGCCCTTAGGG - Intronic
1150415925 17:64988783-64988805 TGGGCACAGAGGGGCCCTGAGGG + Intergenic
1151227684 17:72658802-72658824 CATCCACACAAGAGCCCTGTCGG - Intronic
1152300903 17:79495001-79495023 TGTCCACGCAGTGGCCATCTGGG + Intronic
1152435062 17:80271457-80271479 TGTCCAGACAGGGGCGCAGCTGG + Intronic
1152608073 17:81302954-81302976 TGGCCACACGGGGGCCATCTAGG + Intergenic
1152674998 17:81635452-81635474 TCTCCAGTCAGGGGCCCTCTTGG - Intronic
1152859192 17:82685642-82685664 TGGGCACCCAGGGACCCTGTGGG - Intronic
1152956369 18:45264-45286 TGTACAGACAGGGGCCCAGGAGG - Intergenic
1155503330 18:26508399-26508421 TGTTCAAACAGGAGCCCTGGGGG + Intronic
1155946465 18:31857942-31857964 TCTCCACAGAGAAGCCCTGTAGG + Exonic
1157197180 18:45629079-45629101 TGTCCTCACAGGTGCCATGATGG - Intronic
1157538791 18:48483837-48483859 TGTCCACACATGGCCTCTGATGG - Intergenic
1158056379 18:53285615-53285637 TCTCCACACAGAGTCCCTGCTGG + Intronic
1160535396 18:79588871-79588893 TGTCAACTCTGGGGCCCTGCTGG + Intergenic
1160936048 19:1595434-1595456 TGTGCACACAGGAGCCCATTTGG + Intergenic
1161517162 19:4702916-4702938 TGTGGACACTGGGGCCCTCTTGG + Intronic
1162904039 19:13812986-13813008 TGCCTCCTCAGGGGCCCTGTGGG + Exonic
1163376977 19:16939044-16939066 GGCCCCCACAGGGGCCGTGTTGG - Intronic
1163846892 19:19643164-19643186 GGGCTACAGAGGGGCCCTGTGGG + Intronic
1164540738 19:29119893-29119915 TGTACACACAGGAGCCCTGGAGG + Intergenic
1164700449 19:30280794-30280816 TGCCTACACAGGAGCCCTGAAGG - Intronic
1167314862 19:48757322-48757344 CGTGCACACAGGGGCCGTGTGGG - Intronic
1167785188 19:51630205-51630227 TGTCCCCCCAGGGTCCCTGCAGG - Intronic
1167787287 19:51646629-51646651 TGTCCCCCCAGGGTCCCTGCAGG - Exonic
926937679 2:18102938-18102960 TGTCCTCACAACAGCCCTGTAGG + Intronic
927432048 2:23035033-23035055 TGTCCACACAGGTGTCCGGTGGG - Intergenic
927576759 2:24207365-24207387 TGTCCACAGAGGGTCCCAGGAGG + Intronic
927697166 2:25246504-25246526 CCTCCACAGAGGGGCCCAGTGGG - Intronic
927886377 2:26721198-26721220 TGTCCACAGAGGAGTCCTGCAGG - Intronic
928084759 2:28339107-28339129 TGTCCACACAGGGGGCTGGAGGG - Intergenic
932282066 2:70502085-70502107 TTTCCACACAGCAGCCCTGGTGG + Intronic
932680661 2:73821945-73821967 TGTCCACCCATGAGCCCTTTAGG - Intergenic
934993378 2:98936495-98936517 TGTCCGCGCAGCGGCGCTGTCGG + Intergenic
937244637 2:120484808-120484830 TGTCCCCACAGGGGCCAGGGTGG + Intergenic
937909737 2:127069639-127069661 TGTAAACACAGGGGACCTGCAGG + Intronic
941047289 2:160690956-160690978 GGTCCACACAGGGGGATTGTGGG - Intergenic
944432157 2:199645116-199645138 TGGCCTCACAGGGGTCCTTTGGG - Intergenic
945042788 2:205755934-205755956 TTTCCACATAGGGCCCGTGTTGG - Intronic
948480701 2:238248368-238248390 TGTCCTTCCAGCGGCCCTGTGGG - Intronic
948892542 2:240914537-240914559 CGGCCACACGGGGGCACTGTTGG + Intergenic
1168980248 20:1997712-1997734 TGTCCACACCGGGGCTGGGTGGG + Intergenic
1169277855 20:4245686-4245708 GGTTCACACTGGGCCCCTGTAGG - Intronic
1171164584 20:22958669-22958691 AGGACACACAGGGGCCCTATTGG + Intergenic
1171459830 20:25292234-25292256 TGTCCAGCCTGGGCCCCTGTGGG + Intronic
1172749649 20:37241826-37241848 TGTCTGCATAGGAGCCCTGTTGG + Intergenic
1173335366 20:42108218-42108240 TGTCCTCACAAGGACCCTGCAGG - Intronic
1173548755 20:43917411-43917433 TGACCACACTTGGGGCCTGTAGG + Intronic
1174391493 20:50220850-50220872 TGGCCCCACACTGGCCCTGTGGG - Intergenic
1175758450 20:61544988-61545010 TGTCCACTCGGGGCCCCAGTAGG - Intronic
1175831437 20:61967122-61967144 TGGCCACACTGGAGCCCTGGTGG - Intronic
1175906158 20:62380634-62380656 TGTCCCCACCCGGGACCTGTGGG - Intergenic
1175964386 20:62653199-62653221 ATTCCACAGAGGAGCCCTGTGGG + Intronic
1176290286 21:5040347-5040369 TTGCCACACAGGGGCTCTGGTGG + Intronic
1176642292 21:9317429-9317451 GGACCACACAGGGTCCCTGACGG - Intergenic
1177902532 21:26934489-26934511 TGTCCACACATTTGCCCTGCAGG + Exonic
1178755353 21:35344418-35344440 TGTGAACACAGGGGCCTTGTAGG - Intronic
1179057659 21:37951159-37951181 GGTCCAGCCAAGGGCCCTGTTGG + Intergenic
1179430840 21:41319992-41320014 TGTCCTCACAGGGCCTCTGTGGG - Intronic
1179866969 21:44223294-44223316 TTGCCACACAGGGGCTCTGGTGG - Intronic
1180351303 22:11806784-11806806 GGACCACACAGGGTCCCTGACGG - Intergenic
1180386899 22:12185293-12185315 GGACCACACAGGGTCCCTGACGG + Intergenic
1181336990 22:22143695-22143717 TGTCCACATTGCGCCCCTGTAGG - Intergenic
1183335639 22:37244393-37244415 CCTCCACGCAGGGGGCCTGTGGG - Intronic
1183897361 22:40980045-40980067 TGTCCCCACAGCGGGCCTGGTGG - Intergenic
1183951489 22:41355385-41355407 TCTCCACACAGGTGTCCTCTGGG - Intronic
1184285077 22:43465900-43465922 TGTGCACAAAAGGGCCCTGGTGG - Intronic
1184333699 22:43841170-43841192 GGTGCAGACAGGGGCCCTGGAGG + Intronic
1184666625 22:45992703-45992725 TGTCCCCATAGGGCCCCTGCAGG + Intergenic
1184734215 22:46388598-46388620 TGTCCACACAGAGCCCATGGGGG - Intronic
1185170477 22:49290904-49290926 GGTGCACTCAGGGGCCCTGGGGG - Intergenic
1185188640 22:49418621-49418643 TGTTCACAGAAGGGCCCTGCCGG - Intronic
1185294084 22:50044890-50044912 TCTCCCCAAAGGGGCCCCGTGGG - Intronic
950638509 3:14332947-14332969 TGTCCCCACAGGGGCCCAGCTGG + Intergenic
952022494 3:29040416-29040438 TGTCCACACAGAGTCCCTCCTGG + Intergenic
954199954 3:49018264-49018286 GGGCCACACCGGGGCCCTGCAGG + Exonic
954600415 3:51863304-51863326 TGACCACACAGTGGCCCTGGAGG - Exonic
954659502 3:52219423-52219445 TGTCCACTCAGGGCCTCTGGAGG - Intergenic
955217597 3:56997298-56997320 TGTCCACTCACATGCCCTGTGGG + Intronic
961154347 3:124666239-124666261 TGTTCACACAAGGGCCCTGGAGG - Intronic
961339674 3:126209669-126209691 TGTCCACACCGTGGCCTGGTGGG - Intergenic
961561693 3:127734561-127734583 TGGCTGCACAGGGGCCCTGCAGG + Intronic
961640178 3:128360256-128360278 AGTCCAGAGAGGGGCCCTGTGGG - Intronic
961833070 3:129634387-129634409 TGGCTACACAGGGTCCTTGTAGG + Intergenic
962406146 3:135101860-135101882 TGTGCACACAGGGGACCAGGTGG - Intronic
968027101 3:195451574-195451596 AGTCCACACAGGGGCCATCCGGG - Intergenic
1202744597 3_GL000221v1_random:87589-87611 GGACCACACAGGGTCCCTGACGG + Intergenic
968648261 4:1750406-1750428 TGTCCACACCGTGGCTCTGCCGG - Intergenic
968652717 4:1766571-1766593 TGTAGAGGCAGGGGCCCTGTGGG + Intergenic
971396892 4:26236736-26236758 GGACCACACAAGGGCCCTTTTGG + Intronic
972732886 4:41812615-41812637 TGGCCACAGATGGGCCCTGGGGG - Intergenic
973262819 4:48181826-48181848 TTTCCACAGTGGGGCCCTTTAGG + Intronic
977811793 4:101364478-101364500 TGTCCTAGCAGGGACCCTGTAGG + Intergenic
978415862 4:108475244-108475266 TGTGCACACAGGGTACCTCTAGG + Intergenic
985440487 4:189980109-189980131 TGTACAGACAGGGGCCCAGGAGG - Intergenic
987409220 5:17598373-17598395 TGTCCACCCAGGGATCCTCTCGG - Intergenic
987642762 5:20633486-20633508 TGGAGACACAGGGGCCCTTTGGG - Intergenic
988453875 5:31370456-31370478 AGTCCACCCATGGGCCTTGTTGG + Intergenic
988723639 5:33903762-33903784 TGGCCTCACAGGGGTCCTTTGGG - Intergenic
989958834 5:50387068-50387090 TGGAAACACAGGGGCCCTGGTGG - Intergenic
997766494 5:136509645-136509667 TGTTCACACATGGCCCCAGTTGG + Intergenic
998252823 5:140564173-140564195 TGTGCACGGAGGGGCCCGGTGGG - Intronic
1001313126 5:170625228-170625250 TGTGCACACGTGTGCCCTGTGGG - Intronic
1002097379 5:176839496-176839518 TGTCCAGACAGCGGCCCTCCTGG - Intronic
1006249190 6:32766164-32766186 TGTCCCCACAGAGGCCGGGTGGG - Intergenic
1007628430 6:43259524-43259546 CCTCCACACAGGGGCTCTGCAGG - Exonic
1007724934 6:43909955-43909977 TCTCCACCCCGGGGCCTTGTGGG + Intergenic
1007947165 6:45837067-45837089 TGTCCTCACATGGGCCCTGGAGG - Intergenic
1007984818 6:46197254-46197276 TGCCCACACAGAGTCCCTATTGG - Intergenic
1008237111 6:49063715-49063737 TGTCTACACATGTGCCATGTTGG - Intergenic
1013590060 6:111612402-111612424 TGTCCACTGAGGGGCACTGAGGG - Intergenic
1015356755 6:132286376-132286398 TGTCCAGACAGGGGGCTGGTTGG - Intergenic
1015786864 6:136927527-136927549 TGTCGAAGCAGGGGCCCAGTTGG - Intergenic
1017040194 6:150302084-150302106 TGCAGACACAGGGGGCCTGTGGG + Intergenic
1019028255 6:168990612-168990634 GCTCCACACAGGGGCGTTGTGGG + Intergenic
1019028266 6:168990656-168990678 GCTCCACACAGGGGCGCTGTGGG + Intergenic
1019028285 6:168990730-168990752 GCTCCACACAGGGGCGCTGTGGG + Intergenic
1019028302 6:168990789-168990811 GCTCCACACAGGGGCGCTGTGGG + Intergenic
1019028314 6:168990832-168990854 TCTCCACACAGGGACGCTGTGGG + Intergenic
1019028325 6:168990876-168990898 GCTCCACACAGGGGCGCTGTGGG + Intergenic
1019028337 6:168990919-168990941 TCTCCACACAGGGACGCTGTGGG + Intergenic
1019028348 6:168990963-168990985 GCTCCACACAGGGGCGCTGTGGG + Intergenic
1019028360 6:168991006-168991028 TCTCCACACAGGGACGCTGTGGG + Intergenic
1019028375 6:168991065-168991087 GCTCCACACAGGGGCGCTGTGGG + Intergenic
1019028406 6:168991180-168991202 ACTCCACACAGGGGCGCTGTGGG + Intergenic
1019028421 6:168991239-168991261 GCTCCACACAGGGGCGCTGTGGG + Intergenic
1019028452 6:168991354-168991376 GCTCCACACAGGGGCGCTGTGGG + Intergenic
1019028466 6:168991413-168991435 GCTCCACACAGGGGCGCTGTGGG + Intergenic
1019028483 6:168991472-168991494 GCTCCACACAGGGGCACTGTGGG + Intergenic
1019028495 6:168991515-168991537 TCTCCACACAGGGACGCTGTGGG + Intergenic
1019028512 6:168991574-168991596 GCTCCACACAGGGGCGCTGTGGG + Intergenic
1019028524 6:168991617-168991639 TCTCCACACAGGGACGCTGTGGG + Intergenic
1019028539 6:168991676-168991698 GCTCCACACAGGGGCGCTGTGGG + Intergenic
1019028554 6:168991735-168991757 GCTCCACACAGGGGCGCTGTGGG + Intergenic
1019028568 6:168991794-168991816 GCTCCACACAGGGGCACTGTGGG + Intergenic
1019028585 6:168991852-168991874 GCTCCACACAGGGGCGCTGTGGG + Intergenic
1020000700 7:4754052-4754074 TGTCCACAAGGCGGCGCTGTGGG - Intronic
1022172092 7:27840524-27840546 TGTGCACACAGGTGCCCTCAAGG - Intronic
1023621967 7:42082537-42082559 AGTCCTCAGCGGGGCCCTGTGGG - Intronic
1023633368 7:42184842-42184864 TGACCCCACAGGGGTCCAGTGGG - Intronic
1025711305 7:63912404-63912426 TGTCCACACAGGGACCCTCAGGG - Intergenic
1026805602 7:73427875-73427897 TGTACACACAGGGTCCATGCAGG - Intergenic
1026830452 7:73607172-73607194 TGGCCACACGGTGGCGCTGTCGG + Intronic
1027963938 7:84981452-84981474 TGACCTCACAGGGGTCCTTTGGG - Intergenic
1030379624 7:108797536-108797558 TGTCAAGAGAGGGACCCTGTGGG - Intergenic
1031575345 7:123409520-123409542 AGATCACACAGGGGCCCTGTAGG - Intergenic
1034874096 7:154709923-154709945 GGTCCACACATGGCCCCTGATGG - Intronic
1035067928 7:156121647-156121669 GCTCCTCACAGGGGCCCTGCTGG - Intergenic
1035780892 8:2227715-2227737 TGTCCAAACACTGGCCCTGAAGG + Intergenic
1035979877 8:4358435-4358457 TGTCCACACAGTCGGCCTGGGGG + Intronic
1036715203 8:11116322-11116344 TGTCAACACAGAGAACCTGTCGG + Intronic
1036750570 8:11441267-11441289 TGTCCTCTCAGGTCCCCTGTTGG + Intronic
1046074332 8:109299136-109299158 TGTCCTCACAGGGGTCCTTCGGG + Intronic
1048304349 8:133273108-133273130 ACTCCACACGGAGGCCCTGTGGG + Intronic
1048622847 8:136153602-136153624 TGTCCTGAGAGGGGCCCAGTGGG + Intergenic
1052250943 9:26396541-26396563 TGTCCACACCGAGTCACTGTCGG - Intergenic
1053007547 9:34614086-34614108 TTTCCACACACTGGTCCTGTAGG + Exonic
1053043008 9:34890668-34890690 TCTCCACACAGGGATCCTTTAGG - Intergenic
1053411094 9:37916598-37916620 TGTCCTCACAGGGCGGCTGTGGG - Intronic
1053416042 9:37947421-37947443 TGTACAGACAGGGGACTTGTGGG - Intronic
1058897550 9:109413340-109413362 TGTGTACACAGGTGCTCTGTAGG + Intronic
1059635214 9:116163699-116163721 TGTCCACACTTGGCCCCTGAGGG - Intronic
1060976090 9:127766116-127766138 CGTTCCCCCAGGGGCCCTGTAGG + Intronic
1061367756 9:130181487-130181509 ATTCCACCCAGGAGCCCTGTGGG + Intronic
1061756319 9:132815005-132815027 TGCCCACAGAGGAGCCCTGCAGG + Intronic
1061757734 9:132827084-132827106 TGGCCATGCAGGGGCCCTGTGGG + Intronic
1061761365 9:132854269-132854291 TGTCCTCACAGGAACCCTATTGG - Intronic
1062093711 9:134691965-134691987 TGTCCCCACGGGGCCCCTGAAGG + Intronic
1062331813 9:136048202-136048224 GGCCCACCCAGGGCCCCTGTTGG - Intronic
1062741834 9:138179515-138179537 TGTACAGACAGGGGCCCAGGAGG + Intergenic
1203688787 Un_GL000214v1:22714-22736 GGACCACACAGGGTCCCTGATGG - Intergenic
1203713226 Un_KI270742v1:117538-117560 GGACCACACAGGGTCCCTGACGG + Intergenic
1203647488 Un_KI270751v1:81339-81361 GGACCACACAGGGTCCCTGATGG + Intergenic
1186522709 X:10220391-10220413 TGTCCCCAAAGGGGCCATCTGGG + Intronic
1187267109 X:17745088-17745110 TGTCCACAGAGGGGCACTGTTGG + Intronic
1187317545 X:18210674-18210696 TGTCCACAGAGTGTCACTGTTGG - Intronic
1192318567 X:70069808-70069830 TGTCCCCAGAGGGGCACTTTTGG - Intergenic
1195149980 X:102057464-102057486 TGTCAAGAGAGGGGCCCAGTGGG + Intergenic
1196915067 X:120525624-120525646 TTCCCAAACAGGGGCTCTGTGGG + Intronic
1197776686 X:130122680-130122702 TGTCCACACAGCAGCTCTGTAGG + Intergenic
1202180200 Y:22133250-22133272 TGACCTCACAGGGGCTCTCTAGG + Intergenic
1202211160 Y:22453149-22453171 TGACCTCACAGGGGCTCTCTAGG - Intergenic
1202379564 Y:24263463-24263485 TGTCCACATAGGTGACCTCTAGG + Intergenic
1202491218 Y:25406658-25406680 TGTCCACATAGGTGACCTCTAGG - Intergenic