ID: 1084215504

View in Genome Browser
Species Human (GRCh38)
Location 11:67645115-67645137
Sequence CCCAGCCACAGGGTGTGCTG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1335
Summary {0: 1, 1: 0, 2: 4, 3: 93, 4: 1237}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084215504_1084215517 12 Left 1084215504 11:67645115-67645137 CCGCAGCACACCCTGTGGCTGGG 0: 1
1: 0
2: 4
3: 93
4: 1237
Right 1084215517 11:67645150-67645172 GACCTGGGGACCAGGAAGCAAGG 0: 1
1: 0
2: 1
3: 48
4: 400
1084215504_1084215515 4 Left 1084215504 11:67645115-67645137 CCGCAGCACACCCTGTGGCTGGG 0: 1
1: 0
2: 4
3: 93
4: 1237
Right 1084215515 11:67645142-67645164 CAGCTCCAGACCTGGGGACCAGG 0: 1
1: 0
2: 1
3: 37
4: 376
1084215504_1084215510 -4 Left 1084215504 11:67645115-67645137 CCGCAGCACACCCTGTGGCTGGG 0: 1
1: 0
2: 4
3: 93
4: 1237
Right 1084215510 11:67645134-67645156 TGGGGGCCCAGCTCCAGACCTGG 0: 1
1: 0
2: 0
3: 28
4: 365
1084215504_1084215521 19 Left 1084215504 11:67645115-67645137 CCGCAGCACACCCTGTGGCTGGG 0: 1
1: 0
2: 4
3: 93
4: 1237
Right 1084215521 11:67645157-67645179 GGACCAGGAAGCAAGGGGTTAGG 0: 1
1: 0
2: 1
3: 24
4: 327
1084215504_1084215524 29 Left 1084215504 11:67645115-67645137 CCGCAGCACACCCTGTGGCTGGG 0: 1
1: 0
2: 4
3: 93
4: 1237
Right 1084215524 11:67645167-67645189 GCAAGGGGTTAGGCAGGTGCAGG 0: 1
1: 0
2: 1
3: 14
4: 267
1084215504_1084215520 14 Left 1084215504 11:67645115-67645137 CCGCAGCACACCCTGTGGCTGGG 0: 1
1: 0
2: 4
3: 93
4: 1237
Right 1084215520 11:67645152-67645174 CCTGGGGACCAGGAAGCAAGGGG 0: 1
1: 0
2: 3
3: 35
4: 462
1084215504_1084215518 13 Left 1084215504 11:67645115-67645137 CCGCAGCACACCCTGTGGCTGGG 0: 1
1: 0
2: 4
3: 93
4: 1237
Right 1084215518 11:67645151-67645173 ACCTGGGGACCAGGAAGCAAGGG 0: 1
1: 0
2: 0
3: 37
4: 302
1084215504_1084215523 23 Left 1084215504 11:67645115-67645137 CCGCAGCACACCCTGTGGCTGGG 0: 1
1: 0
2: 4
3: 93
4: 1237
Right 1084215523 11:67645161-67645183 CAGGAAGCAAGGGGTTAGGCAGG 0: 1
1: 0
2: 1
3: 35
4: 374
1084215504_1084215512 -2 Left 1084215504 11:67645115-67645137 CCGCAGCACACCCTGTGGCTGGG 0: 1
1: 0
2: 4
3: 93
4: 1237
Right 1084215512 11:67645136-67645158 GGGGCCCAGCTCCAGACCTGGGG 0: 1
1: 0
2: 4
3: 38
4: 364
1084215504_1084215511 -3 Left 1084215504 11:67645115-67645137 CCGCAGCACACCCTGTGGCTGGG 0: 1
1: 0
2: 4
3: 93
4: 1237
Right 1084215511 11:67645135-67645157 GGGGGCCCAGCTCCAGACCTGGG 0: 1
1: 0
2: 0
3: 23
4: 364

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084215504 Original CRISPR CCCAGCCACAGGGTGTGCTG CGG (reversed) Exonic
900183298 1:1321838-1321860 CCCAGGCACAGTCTGTGCAGGGG - Intronic
900217906 1:1491413-1491435 CCCAGCCACACGGGAGGCTGAGG + Intronic
900484685 1:2916637-2916659 GCCAGCCACAGTGTGTGCACAGG + Intergenic
900807024 1:4774257-4774279 CCCAGCCACAGGGAATGTGGGGG + Intronic
900944252 1:5820888-5820910 CACTGCCACATGGTTTGCTGGGG - Intergenic
901009335 1:6190494-6190516 CCCAGCTACTGGGTAGGCTGAGG - Intronic
901186655 1:7377803-7377825 CCCAGCTACAGGGGAGGCTGAGG + Intronic
901202097 1:7472817-7472839 ACCAGCCACAGAGGCTGCTGTGG - Intronic
901495042 1:9616062-9616084 CCCAGCTACTGGGAGGGCTGAGG - Intergenic
901560087 1:10063150-10063172 CCCAGCCACTGGGGAGGCTGAGG + Intronic
901570514 1:10156353-10156375 CCCAGCTACAGGGGAGGCTGAGG - Intronic
901628057 1:10634799-10634821 ACAAGCCACAGGGAGTGCCGTGG + Intergenic
901792676 1:11662506-11662528 CCCAGCCACAGGCTGGGGTTGGG + Exonic
901816402 1:11795995-11796017 CCCAGCAACAGTGTCTGTTGAGG - Intronic
902028963 1:13407205-13407227 CCCAGCTACTGGGAGGGCTGGGG - Intergenic
902046367 1:13527575-13527597 CCCAGCCACTGGGGAGGCTGAGG + Intergenic
902053012 1:13579005-13579027 TCCAGCCTCAGGCTGGGCTGAGG + Intergenic
902157258 1:14498574-14498596 CCCAGCTACTTGGTGGGCTGAGG + Intergenic
902378770 1:16042855-16042877 CCCATTCACAGGGTGTGGGGAGG + Intergenic
902622263 1:17657383-17657405 CCCAGCCATGTGGAGTGCTGTGG + Intronic
902648481 1:17820681-17820703 CCCAGCTACTGGGGGGGCTGAGG - Intronic
902901966 1:19523769-19523791 CCCAGCCACTGGGGAGGCTGAGG - Intergenic
903068180 1:20712446-20712468 CCCAGCTACCGGGGGCGCTGAGG + Intronic
903112574 1:21148978-21149000 CCCAGCAACTGGGTAAGCTGAGG + Intronic
903236539 1:21954304-21954326 CCCAGCTACTGGGGATGCTGAGG - Intergenic
903455807 1:23485709-23485731 CCCAGCTACTTGGTGGGCTGAGG + Intergenic
903755634 1:25658564-25658586 CCCAGCTACAGGGGAGGCTGAGG - Intronic
903858243 1:26349928-26349950 CCCAGCTACTCGGTGGGCTGAGG - Intronic
904020267 1:27458675-27458697 CCCAGCTGCACGGGGTGCTGAGG + Intronic
904127836 1:28254320-28254342 CCCAGCTACATGGGGGGCTGAGG + Intergenic
904157643 1:28497878-28497900 CCCAGCCACTGGGGAGGCTGAGG + Exonic
904198891 1:28806307-28806329 CCCAGCTACTCGGGGTGCTGAGG + Intergenic
904501840 1:30917251-30917273 CCCAGCTACACGGGGGGCTGAGG + Intergenic
904610869 1:31725602-31725624 CCCAGTCACAAGCTGAGCTGTGG + Intergenic
904651075 1:32006407-32006429 CCCAGCTACACGGGATGCTGAGG - Intergenic
904882129 1:33708715-33708737 CCCAGCTACTGGGTAGGCTGAGG - Intronic
905119636 1:35671889-35671911 CCCAGCCACTGGGGAGGCTGAGG - Intergenic
905560929 1:38926722-38926744 CCCAGCTACTGGGGATGCTGAGG + Exonic
905569820 1:38994619-38994641 CCCAGCCACTGGGGAGGCTGAGG - Intronic
905622794 1:39463372-39463394 CCCAGCCACTTGGGGGGCTGAGG + Intronic
905681101 1:39871462-39871484 CCCAGCTACTTGGGGTGCTGAGG + Intronic
905983284 1:42251832-42251854 CCCAGCTACAGGGGAGGCTGAGG - Intronic
906063317 1:42962342-42962364 CCCAGCCACAGGGGCTACTTAGG - Intergenic
906193861 1:43916696-43916718 CCCAGCCACTCGGGGGGCTGAGG - Intronic
906508142 1:46395054-46395076 CCCAGCTACTGGGGATGCTGAGG - Intronic
906773430 1:48506114-48506136 CTCAGCTACTGGGGGTGCTGAGG - Intergenic
906859902 1:49348300-49348322 CCCAGCTACTGGGTAGGCTGAGG + Intronic
906906509 1:49899924-49899946 CCCAGCTACAGGGGAGGCTGAGG + Intronic
907092000 1:51733657-51733679 CCCAGCCACTTGGGGGGCTGAGG + Intronic
907179667 1:52558432-52558454 CCCAGCCACTCGGGGGGCTGAGG - Intergenic
908159331 1:61391174-61391196 CCCAGCCACTTGGAATGCTGAGG - Intronic
908241114 1:62189715-62189737 CCCAGCCACTGGGGAGGCTGAGG + Intergenic
908264021 1:62361001-62361023 CCCAGCCACTGGGGAGGCTGAGG + Intergenic
908598474 1:65712749-65712771 CCCAGCCACTTGGTAGGCTGAGG + Intergenic
909071709 1:71002145-71002167 CCCAGCCACTGGGGAGGCTGAGG + Intronic
909668754 1:78164984-78165006 CCCAGCCACTAGGTGGGCTGAGG + Intergenic
909702623 1:78544125-78544147 GCCACCCAGAGGGAGTGCTGAGG - Intergenic
910227331 1:84949012-84949034 CCCAGCCACTGGGGAGGCTGAGG + Intronic
910414031 1:86978975-86978997 CCCAGCTACTTGGGGTGCTGAGG - Intronic
910934847 1:92479327-92479349 CCCAGCCAGTGTGGGTGCTGGGG + Intronic
911029250 1:93468544-93468566 CCCAGCTACATGGGGTGCTGAGG - Intronic
911043290 1:93608658-93608680 CCCAGCTCCAGGGTCTGCTAGGG + Intronic
911135383 1:94433760-94433782 CCCAGCTACAGGGGAGGCTGAGG - Intronic
911154328 1:94623873-94623895 TCCAGCCCCAGGCTGTGGTGAGG - Intergenic
911716410 1:101138613-101138635 CCCAGCCAGAGGCTGAGCAGCGG - Intergenic
912133725 1:106633673-106633695 CCCAGCCACTGGGAAGGCTGAGG - Intergenic
912377857 1:109226833-109226855 CCCAGCTACATGGTAGGCTGAGG - Intronic
912978416 1:114350027-114350049 CTCAGGCACAGGGTGTCCTCGGG + Intergenic
913084609 1:115425246-115425268 CTTAGCCACTGGGTGGGCTGTGG - Intergenic
913247628 1:116884208-116884230 CCCAGCCACTGGGGAGGCTGAGG - Intergenic
913442187 1:118909696-118909718 CCCAGCTACTGGGGGCGCTGAGG - Intronic
913520361 1:119639760-119639782 CCCAGCCACTTGGAGGGCTGAGG + Intronic
914228767 1:145745328-145745350 CCCAGCCACTTGGTAGGCTGAGG + Exonic
914387371 1:147183080-147183102 CCCAGCTACATGGGATGCTGAGG + Intronic
914722311 1:150299568-150299590 CCCAGCTACACGGGGGGCTGAGG - Intronic
914738079 1:150437693-150437715 CCCAGCCACTTGGAGGGCTGAGG - Intronic
914757245 1:150570347-150570369 CCCAGCCACTGGGGAGGCTGAGG - Intergenic
914872284 1:151485102-151485124 CCCAGCCACAGGGGAGGCTGAGG - Intergenic
915157368 1:153889294-153889316 CCCAGCTACTCGGTGGGCTGAGG + Intronic
915602341 1:156930206-156930228 CCCAGCTACTGGGTAAGCTGGGG - Intronic
916085172 1:161263695-161263717 CCCAGCTACAAGGGATGCTGAGG - Intronic
916097107 1:161360995-161361017 CCCAGCCACTGGCAGGGCTGAGG + Intronic
916166159 1:161968992-161969014 CCCAGCCACTTGGTAGGCTGAGG + Intergenic
917044379 1:170841806-170841828 CCCAGCTACTGGGGATGCTGAGG - Intergenic
917078285 1:171228901-171228923 CCCAGCTACTGGGTGGGCTGAGG - Intergenic
917229673 1:172822471-172822493 CCCAGCTGCTGGGGGTGCTGAGG + Intergenic
917765920 1:178217089-178217111 CCCAGCTACTCGGTGGGCTGAGG - Intronic
917862452 1:179159996-179160018 CCCAGCTACAGGGAAGGCTGAGG + Intronic
918185047 1:182119640-182119662 CCCAGCTACTCGGTGGGCTGAGG + Intergenic
918291641 1:183114183-183114205 CCCAGCCACTTGGTAGGCTGAGG - Intronic
918330707 1:183457946-183457968 CCCAGCTACTGGGTAGGCTGAGG - Intergenic
919271381 1:195352005-195352027 CCCAGCCACTCGGTAGGCTGAGG - Intergenic
919957837 1:202437214-202437236 CCCAGCTACTCGGTGGGCTGAGG + Intronic
920984522 1:210873461-210873483 CCCAGCTACATGGTAGGCTGAGG - Intronic
921051796 1:211516292-211516314 CCCAGCCACTGGGGAGGCTGAGG - Intergenic
921299255 1:213735037-213735059 CCCAGCCACTGGGGAGGCTGAGG - Intergenic
921426156 1:215003309-215003331 CCCAGCTACACGGGGGGCTGAGG - Intergenic
922619464 1:226981124-226981146 CCCGGCGACAAGGGGTGCTGAGG + Intronic
923091113 1:230741938-230741960 CCCAGCCACTGGGGAGGCTGAGG + Intergenic
923092718 1:230752285-230752307 GCCAGTCACAGGGGGTTCTGCGG - Intronic
923413237 1:233730625-233730647 GCCTGCCACAGAGTTTGCTGCGG + Intergenic
923577080 1:235169354-235169376 CCCAGCTACTGGGGGGGCTGAGG - Intronic
923707095 1:236352730-236352752 CCCAGCTACAGGGGAGGCTGAGG + Intronic
923736308 1:236611356-236611378 CCCAGCCACTGGGGAGGCTGAGG + Intergenic
923908106 1:238408491-238408513 CCCAGCCACTTGGGATGCTGAGG + Intergenic
924099002 1:240584377-240584399 CCCAGCTACAGGGGAGGCTGAGG + Intronic
924250485 1:242128187-242128209 CCCAGCCACTTGGTCAGCTGAGG + Intronic
924366070 1:243295351-243295373 CCCAGCTACTTGGGGTGCTGAGG - Intronic
1063124594 10:3127443-3127465 CCCCACCTCAGGGTGGGCTGCGG + Intronic
1063372524 10:5531185-5531207 CCCAGACACAAGGGGTCCTGTGG - Intergenic
1063448891 10:6138045-6138067 CCCAGCCACTGGGAAGGCTGAGG - Intergenic
1063662468 10:8043846-8043868 CCTACCCCCAGGGTGTGCAGCGG + Intergenic
1063710088 10:8468858-8468880 CCCAGCCACTGGGTAGGCTGAGG + Intergenic
1063921937 10:10941876-10941898 CCCAGCCACTGGGGAGGCTGGGG + Intergenic
1064164001 10:12971549-12971571 CCCAGGCACAGAGGCTGCTGGGG - Intronic
1064205141 10:13316992-13317014 CCCAGCTACTGGGTAGGCTGAGG - Intergenic
1064329931 10:14383848-14383870 CCCAGCCACTGGGGAGGCTGAGG + Intronic
1064542617 10:16420438-16420460 CCCAGCTACTGGGGATGCTGAGG - Intergenic
1064582408 10:16807905-16807927 CCCAGCCACTGGGGAGGCTGAGG + Intronic
1064826895 10:19413833-19413855 CCCAGCCACTTGGGGGGCTGAGG + Intronic
1064988905 10:21238592-21238614 CCCAGCTACTGGGGATGCTGAGG + Intergenic
1065015078 10:21455332-21455354 CCCAGCCACTGGGGAGGCTGAGG - Intergenic
1065079442 10:22113084-22113106 CCCAGCTACAGGGGAGGCTGAGG - Intergenic
1065220169 10:23488573-23488595 CCCAGCCACATGGGAGGCTGAGG - Intergenic
1065732309 10:28720853-28720875 CCCAGCCACTTGGTAGGCTGAGG - Intergenic
1065835174 10:29650831-29650853 CCCAGCCACATGGGAGGCTGAGG + Intronic
1065945402 10:30601446-30601468 CCCAGCTACATGGGGGGCTGAGG + Intergenic
1066185275 10:33004691-33004713 CCCAGCTACTCGGTGGGCTGAGG - Intronic
1066334392 10:34461488-34461510 CCCAGCTACTGGGGGGGCTGAGG + Intronic
1066375330 10:34853136-34853158 CCCAGCTACCTGGAGTGCTGAGG - Intergenic
1066379574 10:34889858-34889880 CTCAGCAACTGGGGGTGCTGAGG + Intergenic
1066394486 10:35005622-35005644 CCCAGCTACTAGGTGGGCTGAGG + Intergenic
1066976348 10:42371364-42371386 CCCAGCCACACGGGAGGCTGAGG - Intergenic
1067040981 10:42953133-42953155 CTCAGCCTGAGTGTGTGCTGTGG - Intergenic
1067286199 10:44909151-44909173 CCCAGACAGGGTGTGTGCTGAGG - Intergenic
1067582176 10:47452737-47452759 CAAAGCCACGGGGAGTGCTGAGG - Intergenic
1067715899 10:48691078-48691100 CCCTGCCTCAGGCTGTGATGAGG - Intronic
1067774313 10:49151245-49151267 CCTAGCCACAGGGTGAGCACAGG + Intergenic
1067834578 10:49630355-49630377 GCCAGCCACATGGAATGCTGTGG + Intronic
1067985284 10:51136998-51137020 CCCAGCTACTGGGTAGGCTGAGG - Intronic
1068190844 10:53650745-53650767 CCCAGCCACTGGGGAGGCTGAGG - Intergenic
1068747356 10:60548325-60548347 CCCAGCCACTGGGAAGGCTGAGG - Intronic
1069010016 10:63362117-63362139 CCCAGCTACTAGGGGTGCTGAGG + Intronic
1069049498 10:63777655-63777677 CCCAGCTACTGGGGGTGCTGAGG + Intergenic
1069334280 10:67329253-67329275 CCCAGCTACTTGGAGTGCTGAGG + Intronic
1069663911 10:70142568-70142590 CCCAGACAGAGGGTGCACTGGGG + Intronic
1069809356 10:71146952-71146974 CCTAGCCCTAGGATGTGCTGAGG - Intergenic
1069867989 10:71515756-71515778 ACAAGCCACAGGCTGTGCTAAGG - Intronic
1070031778 10:72684042-72684064 CCCAGCCACTGGGGAAGCTGAGG - Intergenic
1070544341 10:77440932-77440954 CCCAGCCACTCGGAGGGCTGAGG - Intronic
1070721292 10:78758918-78758940 CCCATCTACTGGGGGTGCTGAGG + Intergenic
1071501541 10:86207745-86207767 CCCAGCTACAGGGGAGGCTGAGG - Intronic
1071604067 10:86972544-86972566 TCCAGCCACAAGGTGTCCAGAGG - Intronic
1071917555 10:90312448-90312470 CCCAGCTACTGGGTAGGCTGAGG - Intergenic
1071998851 10:91174389-91174411 CCCAGCCACTGGGGAGGCTGAGG + Intronic
1072055079 10:91746999-91747021 CCCAGCCACTGGGGAGGCTGAGG + Intergenic
1072658466 10:97347283-97347305 CCCAGCCACTGGGGTGGCTGAGG - Intergenic
1072699202 10:97627916-97627938 CCCAGCATCAGAGTGTGCTGGGG + Intronic
1073157528 10:101359714-101359736 CCCAGCTACAGGGGAGGCTGAGG - Intronic
1073158300 10:101367184-101367206 CCCAGCCACTGGGGAGGCTGAGG - Intronic
1073188092 10:101629397-101629419 CTCAGCTACTGGGGGTGCTGAGG - Intronic
1073198825 10:101717999-101718021 CCCAGCTACACGGGATGCTGAGG + Intergenic
1073239969 10:102050739-102050761 CCCAGCCACTTGGGATGCTGAGG + Intronic
1073302653 10:102480449-102480471 CCCACCCCCAGGGTGCCCTGAGG - Exonic
1073466118 10:103695390-103695412 CCCAGCCACAAGGGAGGCTGAGG + Intronic
1073635711 10:105196487-105196509 CCCAGCTACTGGGTAGGCTGAGG + Intronic
1073782983 10:106859507-106859529 CCCAGCCACTGGGGAGGCTGAGG - Intronic
1074074791 10:110113160-110113182 CCCAGCCACATGGGAGGCTGAGG + Intronic
1074496439 10:113983737-113983759 CCCAGCCACAGGATGTGGTAGGG + Intergenic
1074685089 10:115954609-115954631 CCCAGCTACTGGGTAGGCTGAGG - Intergenic
1074782208 10:116810101-116810123 CCAAGCCATGGGGGGTGCTGGGG + Intergenic
1074992785 10:118725350-118725372 CCCAGCTACTTGGGGTGCTGAGG + Intronic
1075242222 10:120789494-120789516 GCCAACCAGAGGGTGTGCTGTGG - Intergenic
1075392944 10:122106101-122106123 CCCAGCCACTGGGGAGGCTGAGG - Intronic
1075701405 10:124471882-124471904 CCCAGCTACTGGGTAGGCTGAGG - Intronic
1075747372 10:124737072-124737094 CTGAGCCACAGGTTGTGCTGAGG + Intronic
1075862502 10:125689233-125689255 CCCAGCCACCTGGGGGGCTGAGG + Intergenic
1076187043 10:128458227-128458249 CTCAGGCAGAGGGTGGGCTGTGG + Intergenic
1076268991 10:129134061-129134083 CACTGCAAGAGGGTGTGCTGAGG + Intergenic
1076478310 10:130767675-130767697 CCCAGCCCCAGGCTCTGCAGAGG + Intergenic
1076625800 10:131821003-131821025 CCAAGACACAGGGTGGCCTGTGG + Intergenic
1076679247 10:132163203-132163225 TCCAGCTCCAGGATGTGCTGGGG - Exonic
1077081687 11:727239-727261 CCCAGCCCCAGGGAGTTCTGTGG - Exonic
1077110053 11:858348-858370 CACAGCCCCAGGGTGGGCAGGGG - Intronic
1077123077 11:919742-919764 CCCAGCTACTGGGTAGGCTGAGG - Intergenic
1077181544 11:1219311-1219333 CCAGGCCCCAGGCTGTGCTGGGG - Intergenic
1077329879 11:1979564-1979586 CACTGCCACCGGCTGTGCTGAGG - Intronic
1077472706 11:2771768-2771790 CTCAGCGACAGGGCCTGCTGGGG - Intronic
1077599050 11:3560595-3560617 CCCAGCTACAGGGGAGGCTGAGG - Intergenic
1077867252 11:6233456-6233478 CCCAACTACAGGGTGTGGAGAGG + Intronic
1078848199 11:15140692-15140714 CCCAGCTACAGGGGAGGCTGAGG - Intronic
1079469350 11:20763692-20763714 CCGAGCCACAGCGAGGGCTGAGG + Intronic
1079693613 11:23451129-23451151 CCCAGCTACATGGGGAGCTGTGG + Intergenic
1080039444 11:27743907-27743929 CCTAGCTACAGGGGGAGCTGAGG + Intergenic
1080531951 11:33185104-33185126 CCCAGCCACTTGGGGAGCTGAGG - Intergenic
1080532061 11:33186503-33186525 CCCAGCTACAGGGGAGGCTGAGG - Intergenic
1080596006 11:33774616-33774638 CCCGCCCTCAGGGTGGGCTGAGG + Intergenic
1080646551 11:34192175-34192197 CCCAGCTACTGGGGGGGCTGAGG + Intronic
1080949706 11:37017590-37017612 CCCAGCTACTGGGTGGGCTGAGG - Intergenic
1081240343 11:40697950-40697972 CCCAGCTACAGGGGAGGCTGAGG + Intronic
1081510778 11:43770618-43770640 CCCAGCCACTGGGGAGGCTGAGG + Intronic
1081615462 11:44588136-44588158 GCCTGCCACATGGTCTGCTGTGG - Intronic
1081703194 11:45164653-45164675 TCCAGCCTCAGGATCTGCTGTGG - Intronic
1081871934 11:46386963-46386985 GCCAGCCACAGGAGGAGCTGTGG + Intergenic
1081926320 11:46831978-46832000 CCCAGCCACATGAGATGCTGAGG - Intronic
1081978745 11:47253072-47253094 CCCAGCCACTTGGGGGGCTGAGG - Intronic
1082243277 11:49892368-49892390 CCCAGGCACAGGGAGCTCTGGGG + Intergenic
1082807123 11:57458536-57458558 CCCAGCGACAGATTGTGCCGCGG + Intergenic
1083216069 11:61220957-61220979 CCCAGCTACTGGGTAGGCTGAGG - Intergenic
1083218953 11:61239783-61239805 CCCAGCTACTGGGTAGGCTGAGG - Intergenic
1083274009 11:61586859-61586881 ACCAGCCACAGGAAATGCTGGGG - Intergenic
1083390227 11:62343610-62343632 CCCAGCCACTCGGGATGCTGAGG + Intronic
1083613157 11:64014000-64014022 CCAAGACACAGGGTGATCTGTGG - Intronic
1083631220 11:64096529-64096551 CCCAGCTACTCGGTGGGCTGAGG - Intronic
1083784922 11:64939043-64939065 CCCAGCTACTGGGGGTGCTGAGG - Intronic
1083891259 11:65596795-65596817 CCCAGCCCTAGGGTATGGTGTGG + Intronic
1084170078 11:67396810-67396832 CCCAGGGACAGGCTGGGCTGGGG - Intronic
1084215504 11:67645115-67645137 CCCAGCCACAGGGTGTGCTGCGG - Exonic
1084385875 11:68842324-68842346 CCGATCCACAGGGAGTGGTGGGG + Intronic
1085028560 11:73255698-73255720 CCCAGCTACAGGGGAGGCTGAGG - Intergenic
1085065575 11:73492524-73492546 CCCAGCTACACGGGGGGCTGAGG + Intronic
1085115469 11:73927801-73927823 CCAGGCAACAGGGAGTGCTGAGG - Intergenic
1085121491 11:73970177-73970199 CACAGCCTCAGGGTGTGCAGGGG + Exonic
1085185629 11:74573802-74573824 CCCAGCTACAGGGGAGGCTGAGG - Intronic
1085498686 11:76996839-76996861 CCCAGCTACAGGGGAGGCTGAGG - Intronic
1085863700 11:80263036-80263058 CCCAGCCACAGAGTTTCCAGAGG + Intergenic
1085872822 11:80370734-80370756 CCCAGCCACATGGGAGGCTGAGG - Intergenic
1086323030 11:85670417-85670439 CCCAGCCACTCGGTAGGCTGAGG - Intronic
1086350337 11:85937547-85937569 CCCAGCCACATGGGAGGCTGAGG + Intergenic
1086371118 11:86156642-86156664 CCCAGACACAAGGTAAGCTGAGG + Intergenic
1087039012 11:93780661-93780683 CCCAGCTACTGGGGATGCTGAGG + Intronic
1087080222 11:94162986-94163008 CCCAGCTACTTGGTGGGCTGTGG - Intronic
1087282535 11:96227984-96228006 CCCAGCCACTCGGGGGGCTGAGG + Intronic
1087580688 11:100048013-100048035 CCCAGCTACTGGGGGTGCTGAGG + Intronic
1087750166 11:101998457-101998479 CCCAGCTACTTGGGGTGCTGAGG + Exonic
1087808935 11:102589252-102589274 CCCAGACAGAGGGTGAGGTGCGG - Intronic
1088038946 11:105352916-105352938 CCCAGCTACATGGTAAGCTGAGG - Intergenic
1088226352 11:107624533-107624555 CCCAGCTACAGGGGAGGCTGAGG + Intronic
1088502975 11:110501634-110501656 CCCAGCTACTGGGGATGCTGAGG + Intergenic
1088583614 11:111338107-111338129 CCCAGCTACTTGGTGAGCTGAGG - Intergenic
1089024906 11:115259419-115259441 CCCAGCCACTTGGGGGGCTGAGG - Intronic
1089759440 11:120712246-120712268 TCCAGCCATGCGGTGTGCTGGGG + Intronic
1089764767 11:120755204-120755226 TACAGCCACAGTGTGTGGTGAGG + Intronic
1089770617 11:120799961-120799983 CCCAGCTACTCGGGGTGCTGAGG - Intronic
1089814004 11:121156457-121156479 CCCAGCCACTCGGTAGGCTGAGG - Intronic
1089898814 11:121960162-121960184 CCCAGCCACTGGGGAAGCTGAGG + Intergenic
1090611558 11:128475665-128475687 CCCAGCCACTTGGTAGGCTGAGG - Intronic
1090836517 11:130458126-130458148 CCCAGCCACAGAGGCGGCTGCGG + Intronic
1202812857 11_KI270721v1_random:34743-34765 CACTGCCACCGGCTGTGCTGAGG - Intergenic
1091390440 12:122972-122994 CCTGGACACAGGCTGTGCTGTGG + Intronic
1091427528 12:404198-404220 CCCAGCCACTGGGGAGGCTGAGG + Intronic
1091455159 12:601430-601452 CCCAGCTACAGGGGAGGCTGAGG + Intronic
1091478514 12:801522-801544 CCCAGCTACTGGGTAGGCTGAGG - Intronic
1091733596 12:2900105-2900127 CCCAGCTACAGGGGAGGCTGAGG + Intronic
1091750434 12:3018665-3018687 CTGGGCCCCAGGGTGTGCTGGGG + Intronic
1091939757 12:4468188-4468210 CCCAGCTACAGGGGTGGCTGAGG - Intergenic
1092221778 12:6718647-6718669 CCCAGCTACTGGGGGGGCTGAGG + Intergenic
1092425195 12:8369932-8369954 CCCAGCTACAGGGGAGGCTGAGG - Intergenic
1092455895 12:8642367-8642389 CCCAGCTACTGGGTATGCTGAGG - Intronic
1092459776 12:8676186-8676208 CCCAGCTACTGGGAGAGCTGAGG - Intergenic
1092511518 12:9162075-9162097 CCCAGCTACATGGGGGGCTGGGG - Intronic
1093965229 12:25317070-25317092 CCCAGCTACTGGGTAGGCTGAGG + Intergenic
1094455688 12:30630292-30630314 CCCAGCAGCAGGGTGAGCAGAGG + Exonic
1095170784 12:39033584-39033606 CCCAGCCACAAGGGAGGCTGAGG - Intergenic
1096154672 12:49335301-49335323 CCAAGCCACAGACTCTGCTGAGG + Intronic
1096172231 12:49481242-49481264 CCCAGCTACTGGGAATGCTGAGG + Intronic
1096533822 12:52258381-52258403 GGCAGCCACAGCGTGTGCGGGGG - Intronic
1096538731 12:52291308-52291330 GGCAGCCACAGCGTGTGCGGAGG - Exonic
1096540046 12:52302052-52302074 GGCAGCCACAGCGTGTGCGGAGG + Exonic
1096543379 12:52321163-52321185 GGCAGCCACAGCGTGTGCGGGGG - Exonic
1096871267 12:54593938-54593960 CCCAGCCACAGGACGGGATGAGG + Intergenic
1097073725 12:56376562-56376584 CCCAGCTACAGGGGAGGCTGAGG - Intergenic
1097092590 12:56519046-56519068 CCCAGCTACAGGGTGGGGAGGGG + Intergenic
1097794841 12:63850544-63850566 CCCAGCTACTTGGGGTGCTGAGG - Intronic
1097869610 12:64589884-64589906 CCCAGCTACTGGGGATGCTGAGG + Intergenic
1098167228 12:67710883-67710905 ACCAGATTCAGGGTGTGCTGTGG + Intergenic
1098246122 12:68519752-68519774 CCCAGCTACAGGGGAGGCTGAGG - Intergenic
1098278047 12:68833008-68833030 CCCAGCCACTGGGGAGGCTGAGG + Intronic
1098280942 12:68862348-68862370 CCCAGCTACTTGGGGTGCTGAGG - Intronic
1098605415 12:72383490-72383512 CCCAGCTACTGGGTAGGCTGAGG - Intronic
1098944194 12:76572519-76572541 CCCAGCTACTAGGTATGCTGAGG + Intergenic
1099439469 12:82683920-82683942 CCCAGCTACTGGGGATGCTGAGG + Intergenic
1099615774 12:84933584-84933606 CCCAGCTACATGGGGTGCTGAGG - Intergenic
1099906603 12:88778693-88778715 CCCAGCTACTGGGTAGGCTGAGG + Intergenic
1100061294 12:90579139-90579161 CCCAGCTACAGGGGAGGCTGAGG + Intergenic
1100424499 12:94471358-94471380 CCCAGCTACGGGGGGTGCTGAGG - Intergenic
1100460444 12:94794213-94794235 CCCAGCTACTTGGTGGGCTGGGG - Intergenic
1100990259 12:100244294-100244316 CCCAGCCACTCGGGGGGCTGAGG - Intronic
1101528764 12:105555978-105556000 CCCAGCGTCAGGGCTTGCTGGGG + Intergenic
1101550467 12:105756684-105756706 CCCAGCTACATGGGATGCTGAGG - Intergenic
1102126274 12:110483700-110483722 CCCAGCTACTTGGGGTGCTGAGG + Intronic
1102145301 12:110650807-110650829 CCCAGCCACTGGGGAGGCTGAGG - Intronic
1102271763 12:111542580-111542602 CCCAGCTACTTGGTGGGCTGAGG - Intronic
1102312551 12:111858012-111858034 CCCAGCTACTGGGTAGGCTGAGG - Intronic
1102434736 12:112912222-112912244 CCCAGCTACTGGGTAGGCTGAGG + Intronic
1102877038 12:116456919-116456941 CCCATCTGCAGTGTGTGCTGAGG - Intergenic
1103006908 12:117428303-117428325 CCCAGCCACTGGGGAGGCTGAGG + Intronic
1103092166 12:118104840-118104862 CCCAGCTACTGGGTAGGCTGAGG + Intronic
1103625971 12:122220057-122220079 CCCAGCCACTGGGGAAGCTGAGG - Intronic
1103660412 12:122510412-122510434 CCCAGCTACAGGGGAGGCTGAGG + Intronic
1103681792 12:122699980-122700002 CCCAGCTACTGGGGGGGCTGAGG + Intergenic
1104006408 12:124895882-124895904 CCCAGCCACTGGGGAGGCTGAGG + Intergenic
1104219492 12:126768064-126768086 CCCAGCTACATGGTAGGCTGAGG - Intergenic
1104338323 12:127922290-127922312 CCCAGCCACTTGGTAGGCTGAGG - Intergenic
1104455977 12:128912776-128912798 CCCAGCTACTGGGGGGGCTGAGG - Intronic
1104828807 12:131733949-131733971 CCCTGCCCCAGGGTGGGCTCAGG - Intronic
1104971692 12:132533722-132533744 CCCAGAGTCAGGCTGTGCTGAGG - Intronic
1105045015 12:132995765-132995787 CCCAGCTACTGGGTAGGCTGAGG - Intronic
1105057275 12:133113836-133113858 CCCAGCCACTAGGGATGCTGGGG - Exonic
1105208955 13:18246764-18246786 CACTGCCACGGGGTCTGCTGGGG - Intergenic
1105521423 13:21134627-21134649 CCCAGCCACATGGGAGGCTGAGG + Intergenic
1106783107 13:33079485-33079507 CCCAGCTACTGGGGGGGCTGAGG + Intergenic
1107325997 13:39243488-39243510 CCCAGCTACTGGGTAGGCTGAGG - Intergenic
1107390166 13:39955355-39955377 CCCAGCCACTGGGGAGGCTGAGG - Intergenic
1107503911 13:41011557-41011579 CCCAGCCACTTGGGGAGCTGAGG - Intronic
1107559643 13:41547615-41547637 CCCAAGCACAGAGTGTGCTCAGG + Intergenic
1107924084 13:45241035-45241057 CCCAGCCACAAGGGCAGCTGAGG + Intronic
1109725863 13:66341206-66341228 CCCAGCTACGGGGGATGCTGAGG - Intronic
1110222501 13:73088673-73088695 CCCAGCTACTGGGGGTGCTGAGG + Intergenic
1110850488 13:80239317-80239339 CCCAGGCACAGAGTGAGATGGGG + Intergenic
1111511037 13:89262926-89262948 CCCAGCTACAGGGGAGGCTGAGG + Intergenic
1111814951 13:93140439-93140461 CCCAGCTACTGGGGATGCTGAGG - Intergenic
1111977023 13:94977095-94977117 CCCAGCTACAGGGGAGGCTGAGG + Intergenic
1112493545 13:99887635-99887657 CCCAGCCACATGGGAGGCTGAGG + Intronic
1112624526 13:101089011-101089033 CCCAGCTACTGGGTTGGCTGAGG - Intronic
1113112442 13:106838183-106838205 CCCAGCCACTCGGTAGGCTGAGG + Intergenic
1113137697 13:107112386-107112408 CCCAGCCACTTGGGATGCTGAGG - Intergenic
1113555517 13:111230741-111230763 ACGAACCACAGGGTGTTCTGGGG + Intronic
1113848024 13:113403543-113403565 CTCAGCCCCAGGGTGGTCTGGGG + Intergenic
1114599388 14:23942126-23942148 GCCAGCCCCAGAGAGTGCTGAGG + Intergenic
1114668235 14:24394032-24394054 CCCAGGCACAGTGTCTGCTAAGG - Intergenic
1115109258 14:29801802-29801824 CCCAGCTACTGGGGATGCTGAGG - Intronic
1115253993 14:31379055-31379077 CCCAGCTACAGGGGAGGCTGAGG - Intronic
1115279131 14:31641065-31641087 CCCAGCTACAGGGGAGGCTGAGG - Intronic
1115365948 14:32557200-32557222 CCCAGCTACTGGGTAGGCTGAGG - Intronic
1115558665 14:34563441-34563463 CCCAGCTACTCGGTATGCTGAGG + Intronic
1116206929 14:41880041-41880063 CCCAGCTACTGGGGATGCTGAGG - Intronic
1116317370 14:43415583-43415605 CCCAGCTACATGGTAGGCTGAGG + Intergenic
1116464428 14:45214865-45214887 CCCAGCTACTGGGGATGCTGAGG - Intronic
1116902899 14:50378647-50378669 CCCAGCCACTGGGGAGGCTGAGG - Intronic
1116925499 14:50631142-50631164 CCCAGCCACTGGGGAGGCTGAGG + Intronic
1117004675 14:51408273-51408295 CCCAGCTACTAGGGGTGCTGAGG - Intergenic
1117139695 14:52776054-52776076 CCCAGCCACATGGGAGGCTGAGG + Exonic
1117559720 14:56924523-56924545 CCCAGCTACTTGGGGTGCTGAGG - Intergenic
1117672997 14:58126916-58126938 CCCAGCCACATGGGAGGCTGAGG - Intronic
1117800977 14:59444688-59444710 CCCAGCTACTGGGGGGGCTGAGG + Intronic
1118826122 14:69383443-69383465 CCAAATCACAGGATGTGCTGTGG + Intronic
1119238312 14:73038162-73038184 CCCAGCCACATGGGAGGCTGAGG + Intergenic
1119288806 14:73478091-73478113 CCCAGCTACTAGGTGGGCTGAGG - Intergenic
1119453769 14:74736294-74736316 CCCAGCCACTGGGGAGGCTGAGG + Exonic
1119572103 14:75683887-75683909 CCCAGCTACTGGGTAGGCTGAGG - Intronic
1119904565 14:78289796-78289818 CCCAGCCACTGGGAAGGCTGGGG + Intronic
1120244806 14:81994459-81994481 CCCAGCTACTCGGGGTGCTGAGG - Intergenic
1120994928 14:90409865-90409887 CCCAGCTACTGGGGGGGCTGAGG - Intergenic
1121154899 14:91673765-91673787 CCCAGCTACTTGGTATGCTGAGG + Intronic
1121231061 14:92358798-92358820 CCCAGCCACTTGGGATGCTGAGG - Intronic
1121296570 14:92830713-92830735 CCCAGCCACTTGGGGGGCTGAGG - Intronic
1121479712 14:94255275-94255297 ACCAGCAGCAGGATGTGCTGAGG - Intronic
1121570211 14:94941512-94941534 CCCAGCCACAGGCTGGTCAGAGG - Intergenic
1121907609 14:97761377-97761399 CCCAGCCACTTGGTAGGCTGAGG + Intronic
1122062167 14:99143365-99143387 CACAGGCACAGGGCATGCTGGGG - Intergenic
1122200664 14:100120705-100120727 CGCAGCCACAAGGTGGCCTGGGG + Intronic
1122353661 14:101111390-101111412 CCCTTCCCCAGGGTGGGCTGGGG - Intergenic
1122505150 14:102227363-102227385 CCCAGCAGCAGGGAGGGCTGGGG - Intronic
1122703087 14:103603412-103603434 CCCAGCTACTGGGGATGCTGAGG + Intronic
1122794871 14:104201105-104201127 CCCACCCACTGGGTGCACTGTGG - Intergenic
1122799851 14:104224040-104224062 CCCACCTACCCGGTGTGCTGAGG + Intergenic
1122981194 14:105193069-105193091 CCCATGTACAGGGTGGGCTGGGG - Intergenic
1123071333 14:105643933-105643955 TCCTGCCACAGGTGGTGCTGAGG + Intergenic
1123143579 14:106107137-106107159 CCCAGCCACTCGGGATGCTGAGG - Intergenic
1202898671 14_GL000194v1_random:23793-23815 TTCAGCCACAGGGTGTGCCTCGG - Intergenic
1124249946 15:28100669-28100691 CACAGCCACAGGGTGGGCCAGGG + Intergenic
1124359768 15:29027715-29027737 CCCAGCTACTCGGTGGGCTGAGG - Intronic
1124715955 15:32061690-32061712 CCCAGCTACTGGGGATGCTGAGG + Intronic
1124939260 15:34202873-34202895 CCCAGCCACTGGGGAGGCTGAGG + Intronic
1124983698 15:34584917-34584939 CTCAGGCTCAGGGTGTGCAGAGG - Intronic
1125348597 15:38744133-38744155 CCCAGCTACTGGGGGGGCTGAGG - Intergenic
1125501172 15:40241057-40241079 CCCAGCCAAAGGGTGTGACTTGG - Intronic
1125578889 15:40772203-40772225 CAAAGCCACAGGCTGTGCTACGG + Exonic
1125640992 15:41230800-41230822 CCCGGCCGCAGGGGGCGCTGGGG - Intergenic
1125669574 15:41461156-41461178 CCCAGCTACAGGGGAGGCTGAGG - Intronic
1125805457 15:42490112-42490134 CCCAGCTACTGGGTAGGCTGAGG + Intronic
1126458905 15:48894900-48894922 CCCAGCCACAGGGGAGGTTGAGG - Intronic
1126633642 15:50761498-50761520 CCCAGCCACTGGGGAGGCTGAGG + Intronic
1126764709 15:52000688-52000710 CCCAGCCACTGGGGAGGCTGAGG + Intronic
1126808608 15:52378403-52378425 CCCAGCTACTGGGGGGGCTGAGG + Intronic
1127104513 15:55598924-55598946 CCCAGCTGCTGGGGGTGCTGAGG - Intergenic
1127394702 15:58535221-58535243 CCCAGCCCCATGGTGGGGTGGGG - Intronic
1127470468 15:59285471-59285493 CCCAGCCACTCGGGGGGCTGAGG - Intronic
1127777645 15:62279210-62279232 CCCAGCCACTTGGAGGGCTGAGG - Intergenic
1127947262 15:63767580-63767602 CCCAGCCACTGGGGAGGCTGGGG + Intronic
1128064214 15:64754494-64754516 CCCAGCTACAAGGGATGCTGAGG + Intronic
1128201702 15:65814514-65814536 CCCAGCTACTTGGGGTGCTGAGG - Intronic
1128271168 15:66311245-66311267 CCCAGCCACTTGGGGGGCTGAGG + Intronic
1128301116 15:66566970-66566992 CCCAGCTACTTGGGGTGCTGAGG - Intergenic
1128303864 15:66585002-66585024 CCCAGCCACATGGGAGGCTGAGG + Intronic
1128327564 15:66735001-66735023 CCCAGCAGAAGGGTGTGCGGGGG + Intronic
1128429947 15:67582703-67582725 CCCAGCTACTTGGTGGGCTGAGG + Intronic
1128557631 15:68642430-68642452 CCCAGCCACGGGCTGTGCTGGGG + Intronic
1128567152 15:68708474-68708496 CCCAGCCACTTGGGCTGCTGAGG - Intronic
1128861315 15:71076205-71076227 CCCAGCTACTGGGAGGGCTGAGG + Intergenic
1129161626 15:73751241-73751263 CCCAGGGCCAGGGTGGGCTGGGG - Exonic
1129372514 15:75106368-75106390 CCCAGCCACAGGGGCTGTAGGGG + Intronic
1129701161 15:77769387-77769409 CCCAGTCACAGGGGAGGCTGGGG - Intronic
1129981098 15:79871987-79872009 CCCAGCTACTAGGGGTGCTGAGG + Intronic
1130366211 15:83241513-83241535 CCCAGCCACTGGGGAGGCTGAGG + Intergenic
1130573091 15:85066447-85066469 CCCAGCCACTGGGGGCTCTGAGG + Intronic
1130577169 15:85103104-85103126 CCCAGCTACAGGGGAGGCTGAGG + Intronic
1131002539 15:88950228-88950250 CCCAGCCACTGGGTATGCTGGGG + Intergenic
1131092065 15:89630662-89630684 CCCAACCCCAGGGTGAGCTGGGG + Intronic
1131666996 15:94581258-94581280 CTCAGCCATTGGGTGGGCTGTGG + Intergenic
1132325350 15:100964219-100964241 CCCAGCCCCGGGGTGATCTGCGG - Intronic
1132337460 15:101057596-101057618 CCCAGCCACTGGGGAGGCTGAGG + Intronic
1202965767 15_KI270727v1_random:175615-175637 CCCAGCCACTGGGGAGGCTGAGG + Intergenic
1132522617 16:398430-398452 CTCAGACACAGGGTGGGCTCTGG + Intronic
1132731928 16:1366972-1366994 CCCTGCCCCAGGGTCTGCTCCGG - Intronic
1132842988 16:1987287-1987309 CCCAGCAACAGTGTGTCCTGTGG + Exonic
1132945170 16:2528369-2528391 CCCATCCCCAGGGTAAGCTGCGG + Exonic
1133083835 16:3345947-3345969 CCCAGCTACATGGGATGCTGAGG - Intergenic
1133158119 16:3890095-3890117 CCCAGCTACTCGGTGGGCTGAGG - Intergenic
1133746040 16:8687408-8687430 CCCAGCCACACGGGAGGCTGAGG + Intronic
1133748661 16:8707300-8707322 CCCAGCTACAAGGTAGGCTGAGG - Intronic
1133788376 16:8990330-8990352 CCCAGCTACTTGGGGTGCTGAGG + Intergenic
1133928101 16:10210083-10210105 CCCAGCTACTGGGAGGGCTGAGG + Intergenic
1134201060 16:12199318-12199340 CACAGACACAGGCTGTGCTTAGG - Intronic
1134452840 16:14373935-14373957 CCCAGCTACTCGGGGTGCTGCGG - Intergenic
1134476397 16:14577781-14577803 CCCAGCTACTGGGGGGGCTGAGG - Intronic
1134487947 16:14673485-14673507 CCCAGCCACATGGGAGGCTGAGG - Intronic
1134669925 16:16047405-16047427 CCCAGCTACGTGGTGGGCTGAGG - Intronic
1135038966 16:19103004-19103026 CCCAGCCACTTGGGATGCTGAGG - Intergenic
1135277668 16:21127443-21127465 CCCAGCTACTGGGGGCGCTGAGG + Intronic
1135464016 16:22669919-22669941 CCCAGCTACATGGGATGCTGAGG + Intergenic
1135537534 16:23305629-23305651 CCCAGCTACAGGGGAAGCTGAGG + Intronic
1135550828 16:23397023-23397045 CCCAGCTACTTGGGGTGCTGAGG - Intronic
1136038067 16:27555718-27555740 CCCAGCCACTTGGGGGGCTGAGG + Intronic
1136293423 16:29289224-29289246 CCCAACCACTGGGTGGGGTGGGG - Intergenic
1136542919 16:30938388-30938410 CCCAGCCACATGGGAGGCTGAGG + Intronic
1136783289 16:32920472-32920494 CCTGGCCCCAGGCTGTGCTGTGG + Intergenic
1137047631 16:35683955-35683977 CCCAGCTACAGGGGAAGCTGAGG + Intergenic
1137391314 16:48083582-48083604 CCCATCCACGGAGTGAGCTGGGG - Exonic
1137623945 16:49895674-49895696 CCCCACCATAGGGAGTGCTGCGG + Intergenic
1137967918 16:52955174-52955196 CCCAGCCACTGGGGATGCTGAGG + Intergenic
1138026898 16:53528993-53529015 CCCACCCCCATGGTGTGCTAAGG - Intergenic
1138491805 16:57381436-57381458 CACAGCTACAGGCTGTGCTCCGG - Intronic
1138511145 16:57509073-57509095 CCCAGCTACAGGGAAGGCTGAGG + Intergenic
1138578944 16:57927080-57927102 GCCAGACACAGGCAGTGCTGGGG - Intronic
1138754499 16:59466950-59466972 CCCAGCCACTGGGAAGGCTGCGG - Intergenic
1139269260 16:65666638-65666660 CCCAGGCACCTGGTGAGCTGGGG + Intergenic
1139476738 16:67206607-67206629 CCCAGCCCCAGGGCCAGCTGGGG - Intergenic
1139586488 16:67907374-67907396 CCCAGCCACTTGGGGGGCTGAGG - Intronic
1139609825 16:68047894-68047916 CCCAGCTACATGGGATGCTGAGG - Intronic
1139840803 16:69877921-69877943 CCCAGCTACTGGGGGGGCTGAGG - Intronic
1139924465 16:70478540-70478562 CCCGTCCGCAGGATGTGCTGAGG + Exonic
1140148440 16:72336082-72336104 CCCAGCTACTGGGTAGGCTGAGG - Intergenic
1140868830 16:79088240-79088262 CCCATCCACAGGCTGTGCTTAGG - Intronic
1141658387 16:85428486-85428508 CCCTGCCTCACGGGGTGCTGAGG + Intergenic
1142017327 16:87756927-87756949 CCCAGCCACTCGGAGGGCTGAGG - Intronic
1142021050 16:87782860-87782882 CACAGCCTCAGGGGGTCCTGAGG + Intergenic
1142064053 16:88050270-88050292 CCCAGCCACCGGGGAGGCTGAGG - Intronic
1142170939 16:88622478-88622500 CCCAGCCCCACTGTTTGCTGTGG + Intronic
1142289696 16:89187929-89187951 CCCACCCACTGGGTGTCCTCAGG - Intronic
1142320756 16:89381214-89381236 CCCAGCCACTGGGGAGGCTGAGG + Intronic
1142341381 16:89525073-89525095 CCCAGCTACAGGGGAGGCTGAGG - Intronic
1142403031 16:89870968-89870990 CCCAGCTACAGGGGAGGCTGAGG + Exonic
1142429205 16:90017377-90017399 CCCAGCCACTGGGGAGGCTGAGG + Intronic
1203085943 16_KI270728v1_random:1184457-1184479 CCTGGCCCCAGGCTGTGCTGTGG + Intergenic
1142602615 17:1061660-1061682 CCCAGCCACATGGGAGGCTGAGG - Intronic
1142991527 17:3734429-3734451 GTCAGCCACAGGGTGTCCTCGGG + Intronic
1143034086 17:3984538-3984560 CCCAGCTACTGGGGGGGCTGGGG - Intergenic
1143166590 17:4900071-4900093 ACCAGCCCCAGGGTGGGCTTCGG - Exonic
1143202121 17:5120400-5120422 CCGAGTCACAGTGTGTGTTGTGG + Intronic
1143288327 17:5809218-5809240 CACATCCACAGTGAGTGCTGGGG - Intronic
1143486685 17:7259149-7259171 CCCAGGCCCAGGGTGCTCTGGGG - Intronic
1143493887 17:7299697-7299719 CCCAGCTACTGGGGATGCTGAGG + Intergenic
1143552515 17:7639691-7639713 CCCAGCTACTGGGGGGGCTGAGG - Intergenic
1143619020 17:8070633-8070655 CCTAGGCCCAGTGTGTGCTGAGG - Intergenic
1143648622 17:8248671-8248693 CCCAGCTACTTGGTGGGCTGAGG - Intronic
1143893654 17:10120594-10120616 CCCAGCTACTCGGGGTGCTGAGG + Intronic
1144315247 17:14054439-14054461 CCCAGCTACAGGGGAGGCTGAGG - Intergenic
1144531303 17:16041850-16041872 CCCAGCCACTCGGGGGGCTGAGG - Intronic
1144565982 17:16359738-16359760 CCCAGCTACAGGGGCTGCTGAGG - Intergenic
1144598118 17:16588836-16588858 CCCAGCTACAGGGGAGGCTGAGG - Intergenic
1144627299 17:16850758-16850780 CCGAGTCACAGTGTGTGTTGGGG - Intergenic
1144739539 17:17573895-17573917 CCCAGCTACTGGGTTGGCTGAGG - Intronic
1144879139 17:18421954-18421976 CCGAGTCACAGTGTGTGTTGGGG + Intergenic
1144941465 17:18944970-18944992 CCCAGCTACTTGGTGGGCTGAGG + Intergenic
1145102177 17:20086414-20086436 CCCAACCACACTGAGTGCTGTGG - Intronic
1145127830 17:20316480-20316502 CCCAGCCACATGGGAGGCTGAGG - Intronic
1145153095 17:20522433-20522455 CCGAGTCACAGTGTGTGTTGGGG - Intergenic
1145187034 17:20803688-20803710 CCCAGCCACTGGGGAGGCTGAGG + Intergenic
1145910369 17:28538759-28538781 CCCAGGCCCAGGGTGGGCTGAGG - Exonic
1146192407 17:30781092-30781114 CCCAGCCACATGGGAGGCTGAGG - Intronic
1146276722 17:31521099-31521121 CCCAGCCACAGCCCGTGGTGGGG - Intronic
1146363429 17:32198008-32198030 CCCAGCTACTGGGTAGGCTGAGG - Intronic
1146723333 17:35138557-35138579 CCCAGCCACTGGGGAGGCTGAGG - Intronic
1146851816 17:36228560-36228582 CCCAGCCACTGGGGAGGCTGAGG - Intronic
1146867726 17:36352433-36352455 CCCAGCCACTGGGGAGGCTGAGG - Intronic
1147070600 17:37953050-37953072 CCCAGCCACTGGGGAGGCTGAGG - Intergenic
1147082126 17:38032576-38032598 CCCAGCCACTGGGGAGGCTGAGG - Intronic
1147098073 17:38156541-38156563 CCCAGCCACTGGGGAGGCTGAGG - Intergenic
1147411905 17:40259317-40259339 CCCAGCTACTGGGGGCGCTGAGG + Intronic
1147449160 17:40493049-40493071 CCCAGCTACTGGGGATGCTGAGG + Intronic
1147664804 17:42139804-42139826 CCCAGCCACAGGGCTTGTTAGGG + Intronic
1147678145 17:42221260-42221282 CCCAGCCACAGGGAGGGTGGTGG + Intronic
1147687804 17:42297678-42297700 CCCAGCCACAGGGAGGGTGGTGG - Intronic
1147742122 17:42675598-42675620 CCGAGCCACTGGGCCTGCTGGGG + Intronic
1147870032 17:43580702-43580724 CCCAGCCACTTGGGGGGCTGAGG + Intergenic
1148101572 17:45095220-45095242 CCCAGCCACTGGGGAGGCTGAGG - Intronic
1148184278 17:45630577-45630599 CCCAGCTACTGGGGGGGCTGAGG - Intergenic
1148243929 17:46018027-46018049 CCCAGCCACTCGGTTGGCTGAGG + Intronic
1148271495 17:46265592-46265614 CCCAGCCACATGGGAAGCTGAGG - Intergenic
1148451773 17:47783210-47783232 CCCAGCTACTAGGGGTGCTGAGG - Intergenic
1148532329 17:48406147-48406169 CCCAGCCACATGGGAGGCTGAGG + Intronic
1148613425 17:48980619-48980641 CCCAGCTACTTGGTGGGCTGAGG + Intergenic
1148617856 17:49013980-49014002 CCCGGCCTCTGGGTGGGCTGAGG - Intronic
1148738501 17:49878728-49878750 CCCAGCCACTGGGGAGGCTGAGG + Intergenic
1148747334 17:49926060-49926082 CCCAACCCGAGTGTGTGCTGGGG - Intergenic
1148932797 17:51140717-51140739 CCCAGCTACTGGGGGTGCTGAGG + Intergenic
1149139561 17:53414449-53414471 CCCAGCTACTGGGTAGGCTGAGG + Intergenic
1149481956 17:57010719-57010741 CCCAGCTACTGGGGGCGCTGAGG - Intergenic
1149520885 17:57317624-57317646 CCCAGCTACATGGGGGGCTGAGG - Intronic
1149809486 17:59654113-59654135 CCCAGCCACAGAGGAGGCTGAGG - Intronic
1149841645 17:59970234-59970256 CCCAGCTACTGGGGGGGCTGAGG - Intronic
1149864704 17:60144844-60144866 CCCAGCCACCTGGGGGGCTGAGG - Intergenic
1149896149 17:60429938-60429960 CCCAGCTACTGGGGATGCTGAGG - Intronic
1150010498 17:61498280-61498302 CACAGCCACTGTGTGTCCTGAGG + Intergenic
1150042261 17:61876552-61876574 CCCAGCTACTTGGTGGGCTGAGG - Intronic
1150289147 17:63971688-63971710 CCCAGCCTCAGGATGTCCTGGGG + Intronic
1150713136 17:67548473-67548495 CCCAGCTACATGGTAGGCTGAGG + Intronic
1150923105 17:69504389-69504411 CCCAGCTACAGGGGAGGCTGAGG - Intronic
1151560953 17:74869268-74869290 CCCAGCCACAGAGTTTGATTAGG + Intronic
1151575322 17:74950198-74950220 CCTAGAGAGAGGGTGTGCTGGGG - Intergenic
1151689048 17:75669191-75669213 CCCAGCTACTGGGTAGGCTGAGG - Intronic
1151953279 17:77367077-77367099 GCCAGGCAGAGGGTGTGATGGGG + Intronic
1152045682 17:77933785-77933807 CCCAGCTACAGGGGAGGCTGAGG + Intergenic
1152084921 17:78212098-78212120 CCCAGCTACTGGGGGGGCTGAGG + Intergenic
1152127653 17:78456927-78456949 CTCAGCCCCAGGCTCTGCTGAGG + Intronic
1152334357 17:79692003-79692025 CCCAGCAAAAGGTTGTGCTGCGG + Intergenic
1152586411 17:81191393-81191415 GCCAGCCTCAGGGGGTCCTGGGG + Intronic
1152666281 17:81571544-81571566 CCCAGACACACTGTGGGCTGTGG + Intronic
1152681223 17:81669259-81669281 CCCAGCTACTGGGGGGGCTGAGG - Intronic
1152977130 18:232209-232231 CCCAGCTACAGGGGAGGCTGAGG - Intronic
1153033291 18:735039-735061 CCCAGCTACAGGGGAGGCTGAGG + Intronic
1153330250 18:3866459-3866481 CCCAGGTACAGGGTGGGGTGGGG + Intronic
1153673082 18:7430927-7430949 CCCAGCCACTCGGGATGCTGAGG + Intergenic
1154165534 18:12011727-12011749 CAGTGCCACAGGGTGAGCTGTGG + Intronic
1154234634 18:12592945-12592967 CCCAGCCACTGGGGAGGCTGAGG - Intronic
1155060314 18:22222690-22222712 CCCAGCCACTGGGGAGGCTGAGG + Intergenic
1155206692 18:23564441-23564463 CCCAGCCACATGGTTATCTGAGG - Intronic
1155248912 18:23937248-23937270 CCCAGCCACTGGGGAGGCTGAGG + Intronic
1155316494 18:24577128-24577150 CCCAGCCACTAGGGGGGCTGAGG - Intergenic
1155788140 18:29927796-29927818 CCCAGCTACAGGGGATGCTGAGG + Intergenic
1156261234 18:35446507-35446529 CCCAGCTACTGGGTCGGCTGAGG + Intronic
1156471801 18:37381770-37381792 CCAAGCCAGAGGGAGAGCTGGGG - Intronic
1157134678 18:45042263-45042285 CCCAGCCACTTGGTAGGCTGAGG - Intronic
1157319509 18:46623601-46623623 CCCTGCCACAGGGCCTGCAGAGG - Intronic
1157485806 18:48085946-48085968 CTCAGCCACAGGCTGGGCAGCGG + Intronic
1157574321 18:48733507-48733529 CCCAGCCACAGGATGTTCCCTGG - Intronic
1157717709 18:49900374-49900396 CCCAGGCACAGGGTGGGCACAGG - Intronic
1157719715 18:49914322-49914344 CCCCATCACAGGGTGTGCTATGG - Intronic
1158475330 18:57774479-57774501 CCCAGCTACATGGTAGGCTGGGG + Intronic
1158581604 18:58689034-58689056 CCCAGCTATTGGGGGTGCTGAGG + Intronic
1158727953 18:59991934-59991956 CCCAGCTACTGGGGGAGCTGAGG - Intergenic
1158950968 18:62494401-62494423 CCCAGCTACATGGGGGGCTGAGG - Intergenic
1159050191 18:63414548-63414570 CCCAGCCACTGGGGAGGCTGAGG - Intronic
1159720732 18:71887405-71887427 CCCAGCCACTGGGGAGGCTGAGG - Intergenic
1160150047 18:76391801-76391823 CCCAGCCTCATTGTGTGCTTTGG + Intronic
1160174433 18:76580818-76580840 CCCATCCACAGGCTGTGCTCAGG + Intergenic
1160204146 18:76819735-76819757 CCCAGCTACTTGGGGTGCTGAGG - Intronic
1160204208 18:76820352-76820374 CCCAGCTACTTGGGGTGCTGAGG + Intronic
1160443047 18:78907100-78907122 CCCAGCTACAGGGGAGGCTGAGG + Intergenic
1160812284 19:1018022-1018044 CCTAGCCACAGGGAGTAATGGGG - Intronic
1160834142 19:1116714-1116736 CCCAGCAGCAGGAGGTGCTGGGG - Intronic
1160845139 19:1162951-1162973 CCCAGGGACAGCCTGTGCTGGGG + Intronic
1161062475 19:2222122-2222144 GCCAGCAGCAGGGGGTGCTGTGG - Exonic
1161131700 19:2593626-2593648 CCCAGCTACTAGGGGTGCTGAGG + Intronic
1161178744 19:2865165-2865187 CCCAGCTACTGGGGATGCTGAGG + Intergenic
1161564433 19:4992561-4992583 CCCAGCTACTTGGTGGGCTGAGG - Intronic
1162017827 19:7855229-7855251 CCCAGCTACAGGGGAGGCTGAGG - Intronic
1162195228 19:8979526-8979548 TCCACCCACTGTGTGTGCTGGGG + Exonic
1162326183 19:10001259-10001281 CCCAGCCACTGGGAAGGCTGAGG - Intronic
1162424255 19:10584462-10584484 CCCAGCTACTCGGGGTGCTGAGG + Intronic
1162424812 19:10588410-10588432 CCCAGCTACTAGGGGTGCTGAGG - Intergenic
1162564639 19:11438637-11438659 CCCAGCTACTCGGTGGGCTGAGG + Intronic
1162756846 19:12865877-12865899 CCCAGGCCCAGCCTGTGCTGTGG + Intronic
1162764670 19:12911553-12911575 CCCAGCTACAGGGGAGGCTGAGG - Intronic
1163000675 19:14364734-14364756 CCCAGCCACAAGGGAGGCTGAGG + Intergenic
1163052327 19:14693700-14693722 CAGAGCCCCAGGGTCTGCTGTGG - Intronic
1163259800 19:16181965-16181987 CCCAGCTACTGGGTAGGCTGAGG - Intergenic
1163278912 19:16303127-16303149 CCCAGCCACTGGGGAGGCTGAGG + Intergenic
1163339859 19:16698684-16698706 CCCAGCTACACGGGATGCTGTGG - Intergenic
1163647479 19:18498010-18498032 CCCAGCCACTAGGGATGCTGAGG + Intronic
1163647724 19:18499575-18499597 CACAGCCACACGGTGGGCTGAGG - Intronic
1163696738 19:18768124-18768146 CCCAGCCCCTGTGGGTGCTGCGG - Intronic
1163823585 19:19510503-19510525 CCCAGCTACACGGTAGGCTGAGG - Intergenic
1164032545 19:21420865-21420887 CCCAGCCACTCGGGGGGCTGAGG - Intronic
1164051655 19:21589148-21589170 CCCAGCCACATGGGAGGCTGAGG + Intergenic
1164052158 19:21592839-21592861 CCCAGGCACAGGGTGTTCTGTGG - Intergenic
1164203806 19:23041199-23041221 CCCAGCTACAAGGGGGGCTGAGG - Intergenic
1165067222 19:33236245-33236267 CCCAGCCACCGGCAGAGCTGAGG - Intergenic
1165108592 19:33488448-33488470 CCCAGCACCAGGTAGTGCTGGGG + Intronic
1165325604 19:35112687-35112709 CCCAGCTACAGGGGAGGCTGAGG + Intergenic
1165480696 19:36062060-36062082 CCCAGCCACCTGGGGGGCTGAGG - Intronic
1165578963 19:36845922-36845944 CCCAGCTACTGGGTAGGCTGAGG - Intronic
1165815100 19:38637063-38637085 CCCCGCCATGGGGTGTGGTGTGG - Intergenic
1165840021 19:38783162-38783184 CCCAGCTACTGGGTAGGCTGAGG - Intergenic
1165945362 19:39438412-39438434 CCCAGCCACAAGGGAGGCTGAGG + Intronic
1166044230 19:40220181-40220203 TCCAGCTAGAGGATGTGCTGTGG - Intergenic
1166193107 19:41188970-41188992 CCCAGCCACTGGGGTGGCTGAGG - Intergenic
1166649248 19:44558455-44558477 CCCAGCTACAGGGGAGGCTGAGG + Intergenic
1166679537 19:44758402-44758424 CGCAGCCGCAGGGTGAGCCGGGG + Exonic
1166789267 19:45388457-45388479 CCCAGCCATAGGGGAGGCTGAGG + Intronic
1167050620 19:47075684-47075706 GCCAGGCACTGGGGGTGCTGAGG - Intronic
1167063695 19:47168075-47168097 CCCAGCTACTGGGGGCGCTGAGG + Intronic
1167378718 19:49126362-49126384 CCCAGCCACTGGGGAGGCTGAGG - Intronic
1167508626 19:49884130-49884152 CCCAGCCTCGGGGTTTGCTCTGG - Intronic
1167787552 19:51647987-51648009 CCCAGCTACTGGGGGGGCTGAGG + Intergenic
1167808971 19:51811798-51811820 CACTGCCAGAGGGTTTGCTGAGG - Intronic
1167870179 19:52362293-52362315 CCCAGCCACTGGGGCGGCTGAGG + Intronic
1167929616 19:52853573-52853595 CCCAGCTACTAGGTGGGCTGAGG + Intronic
1167963263 19:53124122-53124144 CCCAGCCACTTGGTAGGCTGAGG + Intronic
1168024646 19:53635086-53635108 CCCAGCTACTTGGGGTGCTGAGG - Intronic
1168030240 19:53673714-53673736 CCCAGCTACTGGGGATGCTGAGG - Intergenic
1168217243 19:54935341-54935363 CCCAGCTACAGTGGATGCTGAGG - Intronic
1168485787 19:56760896-56760918 CACAGCCACTGGCTGTCCTGGGG - Intergenic
1168626189 19:57920021-57920043 CCCAGCTACAGGGGAGGCTGAGG + Intergenic
1168678814 19:58298924-58298946 CCCAGCTACAGGGGCGGCTGAGG - Exonic
925212712 2:2063726-2063748 CCCAGCTACTCGGTATGCTGAGG + Intronic
926038884 2:9656855-9656877 CCCAGCTACTTGGGGTGCTGAGG + Intergenic
926201956 2:10807325-10807347 CCCAGCTACTGGGGGTGCTGAGG - Intronic
926653299 2:15370406-15370428 CCCAGCTACTTGGAGTGCTGAGG - Intronic
926707642 2:15847836-15847858 CCCAGCCACTGGGGAGGCTGAGG + Intergenic
926953844 2:18272185-18272207 CCCAGCCCCAGGCTGTGAGGGGG - Intronic
928137123 2:28696018-28696040 CCCAGCTACATGGTAGGCTGAGG + Intergenic
928498404 2:31859965-31859987 CCCAGCTACTCTGTGTGCTGAGG + Intergenic
928531512 2:32196942-32196964 CCCAGCCACATGGGAGGCTGAGG + Intronic
928894096 2:36240989-36241011 AACAGTCCCAGGGTGTGCTGTGG - Intergenic
928965482 2:36970978-36971000 CCCAGCTACTGGGTAGGCTGAGG - Intronic
929118150 2:38462216-38462238 CCCAGCCCAAGGGTGTGGTGTGG - Intergenic
929125441 2:38519230-38519252 CCCAGCCTCAGGATGTCCAGAGG + Intergenic
929413095 2:41719429-41719451 CCCAGCTACTTGGTGGGCTGAGG + Intergenic
929442497 2:41975276-41975298 CCCAGCTACTTGGTGGGCTGAGG + Intergenic
929499654 2:42479528-42479550 CCCAGCCACTTGGGGGGCTGAGG + Intronic
929528524 2:42729210-42729232 CCCAGCTACTGGGTAGGCTGAGG - Intronic
929692977 2:44089951-44089973 CCCAGCTACTGGGTAGGCTGAGG - Intergenic
929784134 2:44976886-44976908 CCCAGCCACATGGGAGGCTGAGG + Intergenic
929904569 2:46034719-46034741 CCCAACCACAGGGAGTCCTTTGG + Intronic
930191956 2:48468697-48468719 CCCAGCTACTTGGTGGGCTGAGG + Intronic
930744002 2:54862221-54862243 CCCAGCTACAGGGGAGGCTGAGG + Intronic
930873606 2:56190682-56190704 CACAGCCTCAGTGTGTGATGAGG + Intronic
931222637 2:60302003-60302025 GTCAGCAACAGGGTGGGCTGAGG - Intergenic
931277064 2:60753441-60753463 CCCAGCCACTGGGGAGGCTGAGG + Intergenic
931415753 2:62078759-62078781 CCCAGCCACTCGGTAGGCTGAGG + Intronic
931467878 2:62507347-62507369 CCCAGCCACTCGGTAGGCTGAGG - Intronic
932046908 2:68358880-68358902 CCCAGCCACTGGGGAGGCTGAGG - Intergenic
933455493 2:82514727-82514749 CCCAGCTACTGGGTAGGCTGAGG - Intergenic
933522691 2:83392929-83392951 CCCAGCTACTGGGTAAGCTGAGG - Intergenic
933596527 2:84288684-84288706 CCCAGCAAGAGGGTGTCCTCAGG - Intergenic
933697396 2:85229890-85229912 CCCAGCTACATGGGCTGCTGCGG + Intronic
933827985 2:86180769-86180791 CCCAGCTACAGGGGAGGCTGAGG + Intronic
934666322 2:96173697-96173719 CCCAGCTACTGGGAGGGCTGAGG + Intergenic
935351723 2:102156625-102156647 CCCAGCCACTGGGGAGGCTGAGG - Intronic
935412697 2:102782188-102782210 CCCAGCCATATGGTAGGCTGAGG + Intronic
935524257 2:104146112-104146134 TCCAGCTACTGGGGGTGCTGAGG - Intergenic
936681087 2:114772271-114772293 CCCAGCTACTCGGTGGGCTGAGG - Intronic
936790475 2:116144998-116145020 CCCAGCCACAGGGGAGGCTGAGG + Intergenic
937329707 2:121018943-121018965 CCCCGCCTCAGGGGCTGCTGCGG - Intergenic
937342205 2:121098514-121098536 CCCAGACACAGGGTGTCATGTGG - Intergenic
937420765 2:121753317-121753339 CCCAGCTACTGGGTAGGCTGAGG + Intronic
938213911 2:129492011-129492033 CCCAGCCACTCGGGGGGCTGAGG - Intergenic
938740068 2:134222718-134222740 CTCAGCCATAGGGAGTCCTGCGG - Intronic
938867031 2:135433269-135433291 CCCAGCTACTTGGGGTGCTGTGG + Intronic
939356728 2:141111928-141111950 CCCAGCTGCTGGGGGTGCTGAGG + Intronic
939438120 2:142204908-142204930 CCCAGCCACTAGGGATGCTGAGG + Intergenic
939691856 2:145273148-145273170 CCCAGCCACATGGGAAGCTGAGG - Intergenic
939982658 2:148799525-148799547 CCCAGCCACATGGGAGGCTGAGG + Intergenic
940055914 2:149512317-149512339 CCCAGCTACTTGGTGGGCTGAGG + Intergenic
940187406 2:151002510-151002532 CCCAGCCACTTGGAGGGCTGGGG + Intronic
940483029 2:154259996-154260018 CCCAGCCACAAGGGAGGCTGAGG - Intronic
940526647 2:154824217-154824239 CCCAGCTACTTGGTGGGCTGAGG + Intronic
940561658 2:155304841-155304863 CCCAGCTACTTGGGGTGCTGAGG - Intergenic
940647680 2:156408622-156408644 CCCAGCTACAGGGGAGGCTGAGG + Intergenic
941740623 2:169031447-169031469 CCCAAACACAGAGTGTGCTTGGG + Intergenic
942045540 2:172097288-172097310 CCCAGCTCCGGGGTGGGCTGAGG - Intergenic
942733686 2:179086276-179086298 CCCAGCTACTGGGGATGCTGAGG - Intergenic
943692818 2:190885986-190886008 CCCAGCTACATGGGGGGCTGAGG - Intronic
944224309 2:197334806-197334828 CCCAGCCACTTGGTAGGCTGAGG + Intergenic
944244566 2:197518023-197518045 CCCAGCCACTCGGTAGGCTGAGG + Intronic
944448931 2:199821263-199821285 CCAAGCTACATGGTGGGCTGAGG - Intronic
944922698 2:204432082-204432104 CCCAGCTACTGGGTAGGCTGAGG - Intergenic
944982230 2:205134406-205134428 CCCAGCCACTTGGTAGGCTGAGG + Intronic
945234513 2:207622282-207622304 CCCAGTTACTGGGGGTGCTGAGG - Intronic
945660284 2:212677624-212677646 CCAAGCCACAGGATGTCCTGTGG + Intergenic
946200370 2:218067922-218067944 CCCACCAACAGGGAGTCCTGAGG + Intronic
946351299 2:219155807-219155829 CCCAGCTACGGGGGGCGCTGAGG + Intronic
946794624 2:223336705-223336727 CCCAGCTACATGGGGGGCTGAGG + Intergenic
946823712 2:223655515-223655537 ACCAGCCACAGAGTGAGCTTGGG - Intergenic
946843977 2:223843127-223843149 CCCAGCTACATGGGGGGCTGAGG - Intergenic
946890294 2:224268970-224268992 CCCAGCTACAGGGGAGGCTGAGG - Intergenic
946898389 2:224348335-224348357 CCCAGCTACTGGGAGGGCTGAGG + Intergenic
947122818 2:226835589-226835611 CCCAGCCTCCGGCTGCGCTGGGG + Intronic
947374238 2:229479595-229479617 CCCAGCTACAGGGGAGGCTGAGG + Intronic
947419216 2:229926626-229926648 CCCAGCCACTGGGTAGGCTGAGG + Intronic
947596619 2:231416506-231416528 CCCAGCCACTGGGGAGGCTGAGG - Intergenic
948067527 2:235092268-235092290 CCCAGCCAGTGGGTCTGCTGGGG + Intergenic
948139149 2:235660086-235660108 CACAGTCACTGTGTGTGCTGAGG - Intronic
948984334 2:241510948-241510970 CCCAGCTACATGGGGAGCTGAGG - Intergenic
949069836 2:242017827-242017849 CCCAGCCACTGGGGAGGCTGAGG + Intergenic
1168841678 20:913837-913859 CCCAGCCACAGGCTGTGCCCTGG - Intronic
1168979827 20:1994961-1994983 CTCACCCAGAGTGTGTGCTGAGG - Intergenic
1169021575 20:2334894-2334916 CCCAGCCAGAGAGAGTCCTGGGG + Intronic
1169106493 20:3000170-3000192 CCCAGCTACAGGGGAGGCTGAGG + Intronic
1169111879 20:3039496-3039518 CCTAACTACAGGGAGTGCTGGGG + Intergenic
1169128820 20:3151987-3152009 CCCAGCCACTCGGGGGGCTGGGG + Intronic
1169156272 20:3332567-3332589 CCCAGCTGCTGGGGGTGCTGAGG - Intronic
1169386093 20:5150686-5150708 CCCAGCCCCAGCCTCTGCTGTGG + Intronic
1169447064 20:5681072-5681094 CCCAGCTACTGGGAATGCTGAGG - Intergenic
1169758208 20:9065714-9065736 CCAAGCTACTGGGAGTGCTGAGG + Intergenic
1170069240 20:12345944-12345966 CCCAGCCACATGGGATGCTGAGG - Intergenic
1170175689 20:13466623-13466645 CCCAGCCACAGGGGAGGCTGAGG + Intronic
1170190576 20:13641012-13641034 CCCAGCCACTGGGGAGGCTGAGG - Intergenic
1170453826 20:16513542-16513564 CCCAGCTACTGGGTAGGCTGAGG + Intronic
1170616284 20:17954824-17954846 CCCAGCCACTGGGGAGGCTGAGG - Intronic
1170759426 20:19236638-19236660 CCCAGCCACTGGGGAGGCTGAGG + Intronic
1171290131 20:23978496-23978518 CGCTGCCACAGGGTCTGCTGGGG - Intergenic
1171541265 20:25958933-25958955 CCCAGCTACTCGGTATGCTGAGG - Intergenic
1171755203 20:29100863-29100885 GCCAGTCAAAGGCTGTGCTGTGG + Intergenic
1171879111 20:30603592-30603614 CCCTGAAACAGGCTGTGCTGCGG - Intergenic
1171960074 20:31486955-31486977 CCCAGCTACTTGGGGTGCTGAGG - Intergenic
1171980687 20:31626404-31626426 CCCAGCCACTGGGGCGGCTGAGG + Intergenic
1172047027 20:32087400-32087422 CCCAGCCACTCGGGGGGCTGGGG - Intronic
1172142629 20:32734063-32734085 CCCAGCTACAGGGGAGGCTGAGG + Intronic
1172344165 20:34183973-34183995 CCCAGCTACTTGGGGTGCTGAGG + Intergenic
1172388760 20:34552111-34552133 CCCAGCCACTGGGGAGGCTGAGG - Intronic
1172541569 20:35721437-35721459 CCCAGCTACTTGGGGTGCTGAGG - Intronic
1172558935 20:35868488-35868510 CCCAGCTACAGGGAAGGCTGAGG + Intronic
1172584134 20:36070755-36070777 CCCAGGCACAGGATGGTCTGTGG - Intergenic
1172645253 20:36465172-36465194 CCCAACCACAGGGCATGCGGGGG - Intronic
1172738363 20:37146314-37146336 CCCAGCTACTTGGGGTGCTGAGG - Intronic
1172878975 20:38185406-38185428 CCCAGCTACTGGGTAGGCTGAGG - Intergenic
1172905675 20:38367336-38367358 CCCAGCCACTGGGGAGGCTGAGG + Intronic
1173587089 20:44190853-44190875 CCCAGCTACTGGGGGCGCTGAGG + Intergenic
1174082939 20:47983666-47983688 CCCAGACACAGGGGAAGCTGGGG - Intergenic
1174125200 20:48299191-48299213 CCCAGCCAAAAACTGTGCTGGGG - Intergenic
1174133012 20:48359317-48359339 CCCAGACACAGGGGAAGCTGGGG + Intergenic
1174323591 20:49761612-49761634 CACAGCCTCAGGGGGTCCTGAGG - Intergenic
1174451551 20:50623950-50623972 CCCAGCTACTGGGTAGGCTGAGG - Intronic
1174487539 20:50870857-50870879 CTCTGCCACAGGGAGTGCTGGGG - Intronic
1174596059 20:51684578-51684600 CCCAGCCACTGGGGAGGCTGAGG + Intronic
1174600827 20:51723456-51723478 CCCAGCCACACAGGGGGCTGGGG + Intronic
1174644727 20:52075972-52075994 CCCAGCCACACGGGAGGCTGAGG - Intronic
1174672778 20:52323539-52323561 CCCAGCTACTTGGTATGCTGAGG - Intergenic
1175368604 20:58471774-58471796 TCCAGCCACGGGCTGTGCTCAGG + Intronic
1175897212 20:62343658-62343680 CCCAGCTACATGGTAAGCTGAGG + Intronic
1175947469 20:62565560-62565582 CCCAGCCACGGGCCATGCTGAGG - Intronic
1176163704 20:63662011-63662033 CACAGCCCCATGCTGTGCTGTGG + Intronic
1176618352 21:9039782-9039804 TTCAGCCACAGGGTGTGCCTCGG - Intergenic
1177527243 21:22310364-22310386 CCCAGCTACTCGGGGTGCTGAGG + Intergenic
1177647161 21:23914254-23914276 CCCAGCTACAGGGGAGGCTGAGG - Intergenic
1177894148 21:26841361-26841383 CCCAGCTACTGGGCATGCTGAGG + Intronic
1177999877 21:28149296-28149318 CCCAGCCAAGGTGTGTGCTCTGG + Intergenic
1178245623 21:30948690-30948712 CCCAGCCACTCAGTATGCTGAGG - Intergenic
1178863089 21:36305640-36305662 CCCAGCTACTGGGGATGCTGAGG + Intergenic
1179289326 21:40005089-40005111 CCCAGCTACTTGGTGGGCTGAGG + Intergenic
1179453937 21:41485531-41485553 CCCAGCCACTTGGGGGGCTGAGG + Intronic
1179505931 21:41840328-41840350 CCCAGCCACTGGGGAGGCTGAGG + Intronic
1179951273 21:44710082-44710104 CCCCACTCCAGGGTGTGCTGAGG + Intronic
1179962013 21:44772911-44772933 CCAATCCCCAGGGTCTGCTGGGG + Intronic
1180044196 21:45295532-45295554 CCCGGCCACAAGAGGTGCTGGGG + Intergenic
1180211367 21:46297181-46297203 CCCAGCTACAGGGGAGGCTGAGG + Intronic
1180767303 22:18352534-18352556 CGCTGCCACAGGGTCTGCTGGGG + Intergenic
1180779006 22:18509845-18509867 CGCTGCCACAGGGTCTGCTGGGG - Intergenic
1180781789 22:18524471-18524493 CCCAGCTACTGGGGGTGCTGAGG + Intergenic
1180811727 22:18767165-18767187 CGCTGCCACAGGGTCTGCTGGGG - Intergenic
1180880567 22:19200724-19200746 CCCAGCTACTGGGGGAGCTGAGG + Intronic
1180885163 22:19238203-19238225 CCCAGCTACATGGGATGCTGAGG - Intronic
1180947317 22:19703684-19703706 CCCAGCCACTGGGGAGGCTGAGG - Intergenic
1180963975 22:19776144-19776166 CCCAGGGACAGGCAGTGCTGTGG + Intronic
1181055873 22:20260285-20260307 CCCAGCCCCAGGGTCTCCTCAGG - Intronic
1181065514 22:20303957-20303979 CCCAGCCTCAGGGACTCCTGAGG - Intergenic
1181161679 22:20963510-20963532 GCCAGGCACAGGGGGTGCTTGGG - Intergenic
1181197880 22:21201407-21201429 CGCTGCCACAGGGTCTGCTGGGG - Intergenic
1181238675 22:21463814-21463836 CCCAGCTACTGGGGGTGCTGAGG + Intergenic
1181295694 22:21836752-21836774 CCCAGCCACTTGGGGGGCTGAGG + Intronic
1181304516 22:21907524-21907546 CCCAGCCACTGGGGAGGCTGAGG - Intergenic
1181322964 22:22022763-22022785 TCCAGCCCCACGGTGTGGTGGGG + Intergenic
1181401865 22:22654399-22654421 CACTGCCACAGGGTCTGCTGGGG + Intergenic
1181519590 22:23437392-23437414 CCCCGCCCCAGGGTGTGCCTGGG + Intergenic
1181573228 22:23779072-23779094 CCCAGCCACACAGTGGGCTGGGG + Intronic
1181647686 22:24242706-24242728 CACTGCCACAGGGTCTGCTGGGG - Intronic
1181703819 22:24635493-24635515 CGCTGCCACAGGGTCTGCTGGGG + Intergenic
1181899006 22:26137066-26137088 CCCAGCCACTCGGTAGGCTGAGG - Intergenic
1181982822 22:26778139-26778161 CCCAGCTACTGGGGATGCTGAGG - Intergenic
1182160277 22:28114693-28114715 CCCAGCTACATGGGATGCTGAGG - Intronic
1182213677 22:28698279-28698301 CCCAGCTACTGGGTAGGCTGAGG + Intronic
1182305400 22:29364532-29364554 CCCAGCTACCCGGTATGCTGAGG - Intronic
1182344940 22:29656052-29656074 GCCAGCTACTGGGGGTGCTGAGG - Intronic
1182398804 22:30058157-30058179 CCCAGCCACTGGGGAGGCTGAGG - Intergenic
1182419075 22:30240035-30240057 CCCAGCTACTCGGGGTGCTGAGG - Intergenic
1182435912 22:30329734-30329756 TGCAGCCACAGGCTGTGATGGGG - Intergenic
1182636047 22:31727864-31727886 CCCAGCTACTAGGGGTGCTGAGG + Intronic
1182789572 22:32938810-32938832 CCCAGCCACTTGGGATGCTGAGG + Intronic
1182939699 22:34263779-34263801 CCCAGCCACTGGGGAAGCTGAGG + Intergenic
1183097824 22:35564175-35564197 CCCAGCTACATGGGGGGCTGAGG - Intergenic
1183229251 22:36570645-36570667 CTCAGCTACTGGGGGTGCTGAGG + Intronic
1183269665 22:36853210-36853232 CCCAGCCCCAGGGTGTCCCAAGG - Intergenic
1183897988 22:40984366-40984388 CCCAGCTACAGGGGAGGCTGAGG + Intergenic
1183939021 22:41282006-41282028 CCCAGCCACTGGGGAGGCTGAGG + Exonic
1184207409 22:43014275-43014297 CCCAGCCCTAGGACGTGCTGCGG + Intronic
1184219839 22:43092754-43092776 CCCAGCCACTAGGGGGGCTGAGG + Intergenic
1184333546 22:43840517-43840539 CACAGCCACAGGATCTGCTCAGG + Intronic
1184534416 22:45076988-45077010 CCCAGCCACACAGTGTCCTGTGG - Intergenic
1184563809 22:45279034-45279056 CCCAGCTACATGGGGGGCTGAGG + Intergenic
1184601927 22:45548890-45548912 CCCATCCAAGGGGTGTCCTGGGG + Intronic
1184675675 22:46041700-46041722 CCCACCTGCAGGGTGTTCTGAGG - Intergenic
1185045594 22:48527211-48527233 GCCAGCCACAGGGAGTGCCACGG - Intronic
1203228925 22_KI270731v1_random:93428-93450 CGCTGCCACAGGGTCTGCTGGGG + Intergenic
950124782 3:10504657-10504679 CCCACCCTCAGGGAGTCCTGAGG + Intronic
950204045 3:11064303-11064325 CCCAGCCACTGGGGAGGCTGAGG - Intergenic
950371822 3:12537281-12537303 CCCAGCCACTGGGAAGGCTGAGG + Intronic
950392097 3:12704789-12704811 CCCAGCTACAGGGGAGGCTGAGG - Intergenic
950669445 3:14517292-14517314 CCCAACCACAGGGAGAGATGGGG + Intronic
950751401 3:15131247-15131269 CCCAGCTACAGGGGAAGCTGAGG + Intergenic
951563178 3:23988193-23988215 CCCAGCTACTTGGGGTGCTGAGG - Intergenic
951576128 3:24116016-24116038 CCCAGCCACACGGGAGGCTGAGG - Intergenic
951719515 3:25683105-25683127 CCCAGCCACTGGGGAGGCTGAGG + Intergenic
951866816 3:27317916-27317938 CCCAGCCACTGGGGAGGCTGAGG - Intronic
952011343 3:28903647-28903669 CGCAGCCAGAGTGGGTGCTGAGG + Intergenic
952271882 3:31841022-31841044 CCCAGCTACAGGGGAGGCTGAGG - Intronic
952291850 3:32024598-32024620 CCCAGCTACTGGGGGGGCTGAGG - Intronic
952344119 3:32468265-32468287 CCCAGCTACTGGGTAGGCTGAGG - Intronic
952373633 3:32746999-32747021 CCCAGCTACACGGGGGGCTGAGG + Intronic
952485515 3:33805858-33805880 CCCAGCTACATGGTAGGCTGAGG - Intronic
953345331 3:42170937-42170959 CCCAGCCACTGGGGAGGCTGAGG - Intronic
953467949 3:43140839-43140861 CCCAGCTACTTGGTGGGCTGAGG + Intergenic
953786319 3:45914396-45914418 CCCAGCCACTGGGGAGGCTGAGG - Intronic
954020568 3:47737276-47737298 CCCAGCTACAGGGAAAGCTGAGG + Intronic
954094331 3:48312525-48312547 CCCAGCCACTGGGGATGCTGAGG + Intronic
954203103 3:49036946-49036968 CCCAGCTACATGGAGGGCTGAGG + Intronic
954249207 3:49355299-49355321 CCCAGCCACTGGGGAGGCTGAGG + Intergenic
954416115 3:50394244-50394266 CCTGGCCCCAGGGAGTGCTGGGG - Intronic
954429592 3:50463412-50463434 CCCAGCCACTGGGGAGGCTGAGG - Intronic
954485799 3:50850242-50850264 CCCAGCCACTAGGGGGGCTGAGG + Intronic
954608046 3:51929013-51929035 CCCAGCCCCAGGGCCTGCAGAGG + Intergenic
954665804 3:52251233-52251255 CCCAGCTACTCGGAGTGCTGAGG - Intergenic
955217031 3:56992726-56992748 CCAAGCCACAGACTGCGCTGGGG - Intronic
955259319 3:57369102-57369124 CCCAGCTACAGGGGAGGCTGAGG + Intronic
955322322 3:57983211-57983233 CCCAGCTACTTGGGGTGCTGAGG - Intergenic
955559377 3:60172379-60172401 CCCAGCTACTCGGGGTGCTGAGG - Intronic
955715108 3:61821283-61821305 CCCAGCTACAGGGGAGGCTGAGG - Intronic
956080565 3:65551414-65551436 CCCAGCCACTCGGGGAGCTGAGG - Intronic
956446601 3:69331970-69331992 CCCAGCCACTCGGGATGCTGAGG + Intronic
957220324 3:77374052-77374074 CCCAGCTACTGGGGATGCTGAGG + Intronic
957327096 3:78710183-78710205 CCCAGCGACATGGGGGGCTGAGG - Intronic
957388606 3:79531505-79531527 CCCAGCTACTCGGTATGCTGAGG + Intronic
958075109 3:88666549-88666571 CCCAGCCACATGGGAGGCTGAGG - Intergenic
958436012 3:94096612-94096634 CCCAGCCACTTGGGGGGCTGAGG - Intronic
959978170 3:112485158-112485180 CCCAGCCACCGGGGAGGCTGAGG - Intronic
960639371 3:119811611-119811633 CTCAGCCACTGGGAGTGCAGGGG + Exonic
960871712 3:122256731-122256753 CCCAGCTACAGGGGAGGCTGAGG - Intronic
960979418 3:123208581-123208603 CCCAGCCACATCCTATGCTGTGG + Exonic
961237642 3:125381295-125381317 CCCAGCTACTTGGTGGGCTGAGG + Intergenic
961484262 3:127206531-127206553 CCCATCCTCAGGGTGTCCTAGGG - Intergenic
961718622 3:128876823-128876845 CCCAGCCACTCGGTAGGCTGAGG - Intergenic
961734824 3:128994773-128994795 CCCAGCCGCTTGCTGTGCTGAGG - Intronic
961803916 3:129475037-129475059 CCCAGCTACTGGGGGTGGTGAGG + Intronic
961822119 3:129580513-129580535 CCTACCCACCGGGTGGGCTGGGG - Intronic
962902580 3:139774193-139774215 ACCATCCATAGGGTGTTCTGAGG - Intergenic
964372644 3:156017049-156017071 ACCAGCCACAGAGTGTGACGAGG + Intergenic
964681661 3:159346684-159346706 CTCACCCAAAGGGGGTGCTGTGG - Intronic
965103250 3:164329682-164329704 CCCAGCAACTTGGTATGCTGAGG - Intergenic
965129933 3:164684437-164684459 CCCAGCCACTGGGGAGGCTGAGG + Intergenic
965561154 3:170063416-170063438 CCCAGCCACTGGGGAGGCTGAGG + Intronic
965642807 3:170848843-170848865 CCCAGCTACATGGGGGGCTGAGG - Intronic
966083009 3:176028507-176028529 GCCAGTCACAGGGTGGGCTGGGG - Intergenic
966123127 3:176545734-176545756 CCCAGCTACATGGGGGGCTGAGG + Intergenic
966274811 3:178152719-178152741 CCCAGCTACTGGGGATGCTGAGG - Intergenic
966358405 3:179107156-179107178 CCCAGCTACTGCGTGGGCTGAGG + Intergenic
966562836 3:181342618-181342640 CTCAGCTACTGGGTGTGGTGGGG - Intergenic
966699412 3:182830205-182830227 CCCAGCTACTTGGTGGGCTGAGG + Intronic
966869660 3:184281981-184282003 CCCAGCCACTGGGGAGGCTGAGG + Intronic
966892913 3:184420427-184420449 CCCAGCCTCAGTCTTTGCTGAGG - Intronic
967165892 3:186779127-186779149 CCCAGCTACAGGGGAGGCTGAGG - Intergenic
967169928 3:186815062-186815084 CCCAGCCACTGGGGAAGCTGAGG + Intergenic
967669144 3:192211539-192211561 CCCAGCTACACGGTAGGCTGAGG - Intronic
967847521 3:194056148-194056170 TGCACCCACAGGGTGTCCTGGGG - Intergenic
968049066 3:195641824-195641846 CCCAGCCACTGGGGAGGCTGAGG + Intergenic
968098333 3:195947806-195947828 CCCAGCCACTGGGGAGGCTGAGG - Intergenic
968106861 3:196007398-196007420 CCCAGCCACTGGGGAGGCTGAGG - Intergenic
968163059 3:196442888-196442910 CCCAGCCACTGGGGAGGCTGAGG + Intergenic
968305552 3:197648110-197648132 CCCAGCCACTGGGGAGGCTGAGG - Intergenic
968506919 4:974953-974975 CCCAGGCACAGGGGGTCTTGGGG - Intronic
968510146 4:991966-991988 CCATGCCATGGGGTGTGCTGAGG + Intronic
968576169 4:1367166-1367188 CCCTGCCACAGCCTGTGCCGTGG + Intronic
969018163 4:4119179-4119201 CCCAGCCACTGGGGAGGCTGAGG - Intergenic
969488599 4:7486057-7486079 GCCATCCCCAGGCTGTGCTGTGG - Intronic
969740313 4:9020222-9020244 CCCAGCTACAGGGGAAGCTGAGG + Intergenic
969799648 4:9553022-9553044 CCCAGCTACAGGGGAGGCTGAGG + Intergenic
969972250 4:11060085-11060107 CCCAGCCACATGGGAAGCTGAGG - Intergenic
970281016 4:14455725-14455747 CCCAGCTACTGGGTAGGCTGAGG - Intergenic
970592578 4:17572364-17572386 CCCAGCTACTGGGGGAGCTGAGG - Intergenic
970631542 4:17952529-17952551 CCCAGCTACAGGGGAGGCTGAGG - Intronic
970631732 4:17954045-17954067 CCCAGCTACAGGGGAGGCTGAGG + Intronic
970930370 4:21504350-21504372 CCCAGCTACTGGGGGAGCTGAGG + Intronic
971365588 4:25974429-25974451 CCCAGCTACTTGGTGGGCTGAGG - Intergenic
971897934 4:32621052-32621074 CCCAGCTACTAGGTGGGCTGAGG - Intergenic
971904125 4:32703861-32703883 CCCAGCTACTGGGGGAGCTGAGG + Intergenic
972313783 4:37906261-37906283 CCCAGCTACTTGGTGGGCTGAGG - Intronic
972577848 4:40368363-40368385 CCCAGCCACTTGGGATGCTGAGG + Intergenic
972586823 4:40445156-40445178 CCCAGCCACAGGGGAGGCTGAGG + Intronic
972856143 4:43109283-43109305 CCCAGCTACTCGGGGTGCTGAGG - Intergenic
973030761 4:45334878-45334900 CCCAGCTACTGGGGATGCTGAGG - Intergenic
973286351 4:48421129-48421151 CCCAGCTACAGGGGGTGCTGAGG - Intronic
973656597 4:53054767-53054789 CCCAGCTACTGGGTAGGCTGAGG - Intronic
973889000 4:55350876-55350898 CCCAGCTACTGGGGGTGCTGAGG - Intronic
974077018 4:57176463-57176485 CCCAGCCACTGGGGAGGCTGAGG - Intergenic
974602291 4:64099147-64099169 CCCAGCTACTGGGGATGCTGAGG + Intergenic
975025283 4:69541330-69541352 CCCAGCCACTGGGGAGGCTGAGG + Intergenic
975038557 4:69714243-69714265 CCCAGCTACACGGTTGGCTGAGG + Intergenic
975319983 4:72999104-72999126 CCCAGCCACTGGGGAGGCTGAGG - Intergenic
975624827 4:76335693-76335715 CTCAGCTACTGGGGGTGCTGAGG - Intronic
975879986 4:78893676-78893698 CCCAGCTACATGGGATGCTGAGG - Intronic
976766396 4:88602591-88602613 CCCAGCTACTTGGGGTGCTGGGG - Intronic
977659116 4:99562935-99562957 CCCAGCTACTGGGGGGGCTGAGG - Intronic
978488407 4:109283360-109283382 CCCAGCTACTTGGTGGGCTGAGG - Intronic
978870259 4:113567281-113567303 CCCAGCTACTGGGTAGGCTGAGG - Intronic
979000287 4:115208705-115208727 CCCAGCTACAGGGGAGGCTGAGG + Intergenic
979448330 4:120840177-120840199 CCCTGCCCCAGGGTGTGAAGGGG - Intronic
979686907 4:123520650-123520672 CCCAGCTACTTGGTGGGCTGAGG + Intergenic
980053048 4:128057161-128057183 CCCAGCTACTGGGAATGCTGAGG - Intergenic
980325460 4:131339024-131339046 CCCAGCTACTGGGAGGGCTGAGG + Intergenic
980428239 4:132655062-132655084 CCCAGCCACACGGGAGGCTGAGG + Intergenic
980789495 4:137601492-137601514 CCCAGCCACTTGGGGGGCTGAGG + Intergenic
980802942 4:137776335-137776357 CCCAGCCACTGAGGATGCTGAGG - Intergenic
981219483 4:142214666-142214688 CCCAGCTACATGGTAGGCTGAGG - Intronic
981314765 4:143331285-143331307 CCCAGCTACTGGGTGGGCTGAGG + Intergenic
982228931 4:153190851-153190873 CCCAGCTACCCGGGGTGCTGAGG - Intronic
982253656 4:153432157-153432179 CCCAGCTACTGGGGGTGCTGAGG + Intergenic
982583081 4:157203996-157204018 CCCAGCTACTGGGGGGGCTGAGG + Intergenic
982736425 4:159011636-159011658 CCCAGCTACAGGGGAGGCTGAGG + Intronic
983097835 4:163585874-163585896 TGCAGCGACAGGGTGTGATGAGG + Exonic
983346662 4:166535588-166535610 CCCAGCTACAGGGGAGGCTGAGG + Intergenic
983426289 4:167588108-167588130 CCCAGCTACCGGGTAGGCTGAGG - Intergenic
983578092 4:169280361-169280383 CCCAGCCACTAGGTAGGCTGAGG + Intergenic
984121436 4:175750172-175750194 CCCAGCTACTGGGGGTACTGAGG - Intronic
984161418 4:176256821-176256843 CCCAGCTACATGGGGGGCTGAGG + Intronic
984244359 4:177257450-177257472 CCCAGCTACTGGGGGTGCTGAGG - Intergenic
984412722 4:179415214-179415236 CCCAGCTACTGAGTGGGCTGAGG - Intergenic
984442983 4:179796993-179797015 CCCAGCTACATGGTAGGCTGAGG + Intergenic
984522581 4:180819048-180819070 CCCAGCCACTAGGTAGGCTGAGG - Intergenic
985037977 4:185860592-185860614 CACAGCCTCAGGGGGTCCTGAGG + Intronic
985111062 4:186546772-186546794 CCCATGAACAGGGTGTGGTGTGG - Intronic
985111069 4:186546804-186546826 CCCACGAACAGGGTGTGGTGTGG - Intronic
985111076 4:186546836-186546858 CCCACGAACAGGGTGTGGTGTGG - Intronic
985111083 4:186546868-186546890 CCCACGAACAGGGTGTGGTGTGG - Intronic
985111090 4:186546900-186546922 CCCAGGAACAGGGTGTGGTGTGG - Intronic
985111098 4:186546932-186546954 CCCAGGAACAGGGTGTGGTGTGG - Intronic
985111106 4:186546964-186546986 CCCAGGAACAGGGTGTGGTGTGG - Intronic
985111114 4:186546996-186547018 CCCAGGAACAGGGTGTGGTGTGG - Intronic
985111122 4:186547028-186547050 CCCACGAACAGGGTGTGGTGTGG - Intronic
985111129 4:186547060-186547082 CCCACGAACAGGGTGTGGTGTGG - Intronic
985111150 4:186547150-186547172 CCCAGGAACAGGGTGTGAGGAGG - Intronic
985111158 4:186547182-186547204 CCCATGAACAGGGTGTGGTGTGG - Intronic
985111165 4:186547214-186547236 CCCATGAACAGGGTGTGGTGTGG - Intronic
985111172 4:186547246-186547268 CCCATGAACAGGGTGTGGTGTGG - Intronic
985111186 4:186547310-186547332 CCCACGAACAGGGTGTGGTGTGG - Intronic
985111199 4:186547374-186547396 CCCACGAACAGGGTGTGGTGTGG - Intronic
985111210 4:186547435-186547457 CCCAGGAACAGGGTGTGAGGAGG - Intronic
985505605 5:278595-278617 CCCAGCCACTGGGGAGGCTGAGG + Intronic
985551567 5:535778-535800 CCCAGGCACAGGCTGTCCTGGGG + Intergenic
985634839 5:1030889-1030911 CTCAGCCACAAGGGGGGCTGGGG + Intronic
985661441 5:1159044-1159066 CCCAGGGACAGGGTGGGCAGAGG - Intergenic
985742576 5:1627253-1627275 CCCAGCCACTGGGGAGGCTGAGG - Intergenic
986006659 5:3673974-3673996 CCCAGCTGCCGGGGGTGCTGAGG - Intergenic
986021633 5:3809650-3809672 CCTACCCACAGGGTGGCCTGGGG + Intergenic
986496113 5:8343782-8343804 CCCACCCACAGCATGTGGTGTGG + Intergenic
986672324 5:10153304-10153326 CCCAGCTACTGGGGGTGCTGAGG + Intergenic
987001010 5:13659687-13659709 CACAACCAGAGGGTGTCCTGTGG - Intergenic
987314192 5:16709166-16709188 CCCAGCTATAGGGTGCACTGAGG + Intronic
987325213 5:16806232-16806254 CCCAGCTACTGGGGATGCTGAGG + Intronic
987606555 5:20143481-20143503 CCCAGCTACATGGGATGCTGAGG - Intronic
988127030 5:27054168-27054190 CCCAGCTACCTGGGGTGCTGAGG - Intronic
988449502 5:31326805-31326827 CCCAGCTACTGGGGGCGCTGAGG - Exonic
988495634 5:31743288-31743310 CCCAGCCATTGGGGATGCTGAGG - Intronic
989056792 5:37373583-37373605 CCCAGCTACTTGGTGGGCTGAGG + Intergenic
989373306 5:40732722-40732744 CCCAGCCACTCGGGGGGCTGAGG - Intronic
989593044 5:43129768-43129790 CCCAGCCACTGGGGAGGCTGAGG - Intronic
989620716 5:43381473-43381495 CCCAGCCACATGGGAGGCTGAGG - Exonic
989636601 5:43542414-43542436 CCCAGCTACTGGGTAGGCTGAGG + Intronic
989647528 5:43651460-43651482 CCCAGCCACTCGGGGGGCTGAGG + Intronic
989721834 5:44538187-44538209 CCCAGCTACTGGGGGGGCTGAGG + Intergenic
989800071 5:45526557-45526579 CCCAGCCAAAGAGTGTTCTGAGG + Intronic
990058452 5:51616000-51616022 CCCAGCCACTTGGGATGCTGAGG + Intergenic
990236477 5:53773236-53773258 CCCAGCTACTAGGGGTGCTGAGG + Intergenic
990384875 5:55250788-55250810 CCCAGCCACTTGGGGGGCTGAGG - Intergenic
990413114 5:55560887-55560909 CCCAGCCACAGGGTTAGCTAGGG - Intergenic
990634670 5:57711303-57711325 ACCTGTCACAGGGTGTGCAGGGG + Intergenic
991060401 5:62368659-62368681 CCCAGCCACTTGGGGGGCTGAGG + Intronic
991088042 5:62666426-62666448 CCCAGCCACTTGGGGGGCTGAGG - Intergenic
991416616 5:66399349-66399371 CCCAGCTACTTGGGGTGCTGAGG - Intergenic
991639158 5:68736475-68736497 CCCAGCCCCAGAGTGCCCTGTGG - Intergenic
991671633 5:69054069-69054091 CTCAGCCATAGGATGTGCTACGG + Intergenic
991677440 5:69101839-69101861 CCCAGCTACAAGGGGTGCTGAGG + Intronic
992326054 5:75661279-75661301 CCCAGCTACAGCGGGGGCTGAGG + Intronic
992687191 5:79210320-79210342 CCCAGCTACTGGGGATGCTGAGG + Intronic
993144810 5:84080178-84080200 CCCAGCTACTCGGTGGGCTGAGG + Intronic
993301742 5:86220102-86220124 CCCAGCCACTGGGGAGGCTGAGG + Intergenic
993376747 5:87157600-87157622 CCCAGCCACTCGGGGTGCTGAGG - Intergenic
994113377 5:96034018-96034040 CCCAGCTACTGGGGATGCTGAGG + Intergenic
994140768 5:96338751-96338773 CCCAGGAACAGGATGTTCTGCGG - Intergenic
995507153 5:112872442-112872464 CCCAGCCACTGGGGAGGCTGAGG - Intronic
995884078 5:116873804-116873826 CCCAGCTACTGGGTAGGCTGAGG - Intergenic
995910146 5:117176904-117176926 CCCAGCCACTCGGTAGGCTGAGG + Intergenic
995972020 5:117984185-117984207 CCCAGCTACTGGGTAGGCTGAGG - Intergenic
996312558 5:122123215-122123237 CACAGCCACAGTGCTTGCTGTGG - Intergenic
996508088 5:124289781-124289803 CCCAGCCAGAGGAGGGGCTGTGG - Intergenic
996683490 5:126254671-126254693 CCCAGCCACTGGGGAGGCTGAGG - Intergenic
996919935 5:128756301-128756323 CCAAGCCACAGCCTATGCTGTGG - Intronic
997469605 5:134109652-134109674 CCCAGCTACTGGGTAGGCTGAGG + Intergenic
997567616 5:134901788-134901810 CCCAGCTACTCGGGGTGCTGAGG + Intergenic
997594163 5:135095180-135095202 CCCAGCCCCATGGAGTGCTGGGG + Intronic
997618154 5:135266908-135266930 CCCAGCCAGAGTGGGTGCTCAGG - Intronic
997996768 5:138592868-138592890 CCCAGCCACTGGGGAGGCTGAGG + Intergenic
998832419 5:146174327-146174349 CCCAGCTACAGGGGAGGCTGAGG + Intronic
1000065264 5:157688702-157688724 CCCAGCCACACGGGAGGCTGAGG + Intergenic
1000091763 5:157935788-157935810 CCCAGCTACAGGGGAGGCTGAGG - Intergenic
1001094613 5:168766612-168766634 CGCAGCCACAGGCTGTGATGAGG - Intronic
1001280945 5:170386008-170386030 CCCAGCTACAGGGGAGGCTGAGG + Intronic
1001321564 5:170686700-170686722 CCCAGCCCCAGAGTTTACTGAGG - Intronic
1001475532 5:172048016-172048038 CCCAGCTACATGGGGGGCTGAGG - Intronic
1001700832 5:173705513-173705535 CCCAGCCACGGGGGGCTCTGGGG + Intergenic
1001713971 5:173799813-173799835 CCCAGCTACTTGGTGGGCTGAGG - Intergenic
1001909134 5:175500070-175500092 CCCAGCTACTTGGGGTGCTGAGG + Intronic
1002393963 5:178939100-178939122 CCCAGCTACAGGGGAGGCTGAGG + Intergenic
1002439748 5:179258160-179258182 CCCAGCCCCAGCGTGTGCAGAGG - Intronic
1002688463 5:181034036-181034058 CCCAGCCACTGGGGAGGCTGAGG + Intergenic
1002813234 6:654686-654708 CCCAGCTACAGGGGAGGCTGTGG + Intronic
1003076132 6:2985190-2985212 CCCTGGCACAGGGGGTGCTCTGG + Intergenic
1003120300 6:3313911-3313933 CCCAGCTACAGGGGAGGCTGAGG + Intronic
1003252520 6:4443196-4443218 CCCAGCCACTGGGGAGGCTGAGG - Intergenic
1004182470 6:13392944-13392966 CCCAGCCACTTGGGGGGCTGAGG + Intronic
1004591657 6:17057833-17057855 TCCAGCTACTGGGGGTGCTGGGG - Intergenic
1004595397 6:17094673-17094695 CCCAGCCACCTGGTCAGCTGAGG - Intergenic
1004613869 6:17271406-17271428 CACAACCACAGGGTTTGGTGGGG + Intergenic
1004882235 6:20020418-20020440 CCCAGCTACAGGGGAGGCTGAGG + Intergenic
1004936634 6:20514515-20514537 CCCAGCTACACGGGATGCTGAGG + Intergenic
1005061944 6:21784669-21784691 TCCAGCCACTTGGTGGGCTGAGG + Intergenic
1005263931 6:24091339-24091361 CCCAGCCACTGGGGAAGCTGAGG + Intergenic
1005985549 6:30872279-30872301 CCCAGCCACTTGGGGGGCTGAGG - Intergenic
1006163220 6:32049875-32049897 CCCAGCCACAAGCAGTTCTGTGG + Intronic
1006275926 6:33005691-33005713 CCCAGCCACTGGGGAGGCTGAGG - Exonic
1006370880 6:33642956-33642978 GCCAGCCAAAGGGTGTACGGAGG - Intronic
1006584843 6:35102090-35102112 CCCAGCTACTCGGGGTGCTGAGG + Intergenic
1006607526 6:35269163-35269185 CCCAGCCACTGGGGAGGCTGAGG + Intronic
1007460432 6:42014249-42014271 CCCAGCTACTGGGAGGGCTGAGG + Intronic
1007521918 6:42456663-42456685 CCCAGCTACTGGGGATGCTGAGG - Intergenic
1007556489 6:42770804-42770826 CCCAGCTACACGGTAGGCTGAGG - Intronic
1007633291 6:43284326-43284348 GCCAGCCCCAGGGTGGGCAGAGG + Intronic
1007704621 6:43783279-43783301 CACAGCCTCGGGGTGAGCTGGGG - Intronic
1007938424 6:45754572-45754594 CCCAGCCGCAAGGTGTGCCTCGG - Intergenic
1008659528 6:53651987-53652009 GCCAGCCCCGGGGTGTGCTGAGG + Exonic
1009059480 6:58380737-58380759 CCCAGCTACTGGGGGGGCTGAGG + Intergenic
1009593843 6:65709144-65709166 CCCAGCTACTGGGGGTGCTGAGG - Intergenic
1009609885 6:65927776-65927798 CCCAGCCACATGGAAGGCTGAGG - Intergenic
1009843755 6:69110061-69110083 CCCAGCTACTCGGGGTGCTGAGG - Intronic
1010138818 6:72588379-72588401 CCCAGCTACACGGTAGGCTGAGG - Intergenic
1010210796 6:73361771-73361793 CCCAGCTACTGGGGGAGCTGAGG + Intergenic
1010234656 6:73565222-73565244 CCCAGCTACTGGGTAAGCTGAGG + Intergenic
1010433878 6:75808725-75808747 CTCAGCCACAGGAGGTTCTGAGG + Intronic
1011271998 6:85589334-85589356 CCCAGCTACATGGGGGGCTGAGG - Intronic
1011362888 6:86547548-86547570 CCCAGCCACTTGGGGGGCTGAGG + Intergenic
1012178446 6:96120384-96120406 CCCAGCTACTGGGGGTGCTGAGG - Intronic
1012656327 6:101826418-101826440 CACTGCCACAGCGTGTGATGGGG + Intronic
1012745884 6:103088283-103088305 CCCAGCTACTTGGGGTGCTGAGG - Intergenic
1013193984 6:107829268-107829290 CCCAGCCACTCGGTAGGCTGAGG + Intergenic
1013309619 6:108880969-108880991 CCCAGCTACAGGGCAGGCTGAGG - Intronic
1013463761 6:110399811-110399833 AGAAGGCACAGGGTGTGCTGCGG - Intronic
1013801413 6:113949895-113949917 CCCAGCCACTCGGTAGGCTGAGG - Intronic
1013833031 6:114297386-114297408 CCCAGCCAAGCGGTGTCCTGAGG + Intronic
1014908745 6:127063497-127063519 CCCAGCTATTGGGGGTGCTGAGG - Intergenic
1015696841 6:135990209-135990231 CCCAGCCACTTGGTAGGCTGAGG - Intronic
1015813686 6:137186198-137186220 CCCAGCCCCAGGGTGATCTCAGG - Intergenic
1016415966 6:143834130-143834152 CCCAGCCACTTGGTAGGCTGAGG + Intronic
1017002012 6:150003697-150003719 TACAGCCACATGGTGTCCTGGGG - Intergenic
1017474772 6:154779146-154779168 CCCAGCTACAGGGGAGGCTGAGG - Intronic
1017837602 6:158193181-158193203 CCCAGCCACTGGGGAGGCTGAGG + Exonic
1018076787 6:160223841-160223863 CCCAGCCACTGGGGAGGCTGAGG - Intronic
1018684666 6:166294669-166294691 CCCAGCTACTTGGGGTGCTGAGG - Intergenic
1018709421 6:166486973-166486995 TCCAGCCCCAGGCTGTGGTGTGG + Intronic
1019464322 7:1178616-1178638 CCCAGCCACTGGGGAGGCTGAGG + Intergenic
1019562890 7:1666860-1666882 CCCAGCCACCGGCTGGGGTGGGG - Intergenic
1019607538 7:1917713-1917735 GCCAGCCACAGGGACTGCTGAGG - Intronic
1019657217 7:2202280-2202302 CTCAGCCACAGGAGGAGCTGGGG + Intronic
1019751400 7:2732679-2732701 ACCACCCACGGGGTGTGCAGGGG + Intronic
1019768923 7:2871192-2871214 CCCAGCCACGGGGAAGGCTGAGG + Intergenic
1019912089 7:4106852-4106874 CTCAGCCACAGGGGCTGCTGCGG - Intronic
1020043522 7:5022385-5022407 CCCAGCTACACGGGGGGCTGAGG - Intronic
1020234569 7:6345882-6345904 CCCAGCTACATGGTAGGCTGAGG - Intronic
1020241293 7:6397123-6397145 CCCAGCTACTGGGGATGCTGAGG + Intronic
1020373854 7:7462741-7462763 CCCAGCTACTGGGGATGCTGTGG + Intronic
1020691095 7:11355470-11355492 CCCAGCCACAAGGCAGGCTGAGG - Intergenic
1021450453 7:20778830-20778852 CCCAGCTACAGGGGAGGCTGAGG + Intergenic
1022303574 7:29125506-29125528 CCCAGCTACATGGGGGGCTGAGG - Intronic
1023069009 7:36409787-36409809 CCCAGCTACTTGGTGGGCTGAGG - Intronic
1023377930 7:39577323-39577345 CGCAGCCAGAGTGGGTGCTGAGG - Intronic
1023446462 7:40236946-40236968 CCCAGCCACTGGGAAGGCTGAGG - Intronic
1023803306 7:43853336-43853358 CCCAGCCACTGGGGAGGCTGAGG + Intergenic
1023939916 7:44762804-44762826 GCCAGGTAAAGGGTGTGCTGGGG - Intronic
1023952465 7:44857646-44857668 CCCAGCCACTGGGGAGGCTGAGG - Intergenic
1023997150 7:45167071-45167093 CCCAGCCACTGGGGAGGCTGAGG - Intronic
1024416342 7:49112033-49112055 CCCAGCTACAGGGGAGGCTGAGG - Intergenic
1024726361 7:52201050-52201072 CCCAGCTACTGGGGATGCTGAGG - Intergenic
1024830878 7:53454492-53454514 CCCAGCTACAGGGGAAGCTGAGG + Intergenic
1025009047 7:55380985-55381007 CCCAGCCACTGGGGAGGCTGAGG - Intronic
1025076712 7:55950116-55950138 CCCAGCCACCCGGGATGCTGAGG + Intergenic
1025150293 7:56541954-56541976 CCCAGCCTCAGGTGGTGCTTGGG + Intergenic
1025900653 7:65741892-65741914 CCCAGCTACTGGGTAGGCTGAGG + Intergenic
1025955979 7:66183418-66183440 CCCAGCCACTGGGGAGGCTGAGG - Intergenic
1026018223 7:66687967-66687989 CCCAGCTACACGGTAGGCTGAGG + Intronic
1026075073 7:67158683-67158705 CCCAGCTACACGGTAGGCTGAGG - Intronic
1026147929 7:67763990-67764012 CCCAACCTCAGGGGGAGCTGAGG - Intergenic
1026174784 7:67987115-67987137 CCCAGCTACTGGGGGTGCTAAGG - Intergenic
1026252777 7:68685302-68685324 GCCAATCAGAGGGTGTGCTGCGG - Intergenic
1026303455 7:69119531-69119553 CCCAGCCACTGGGGGCGTTGTGG - Intergenic
1026420869 7:70235765-70235787 CCCAGCTACATGGTGGGCTGAGG - Intronic
1026798665 7:73382919-73382941 CCCAGCAGCAGGGGATGCTGAGG + Intergenic
1026974662 7:74490080-74490102 CCCAGCTACTCGGGGTGCTGAGG - Intronic
1027049587 7:75013525-75013547 CCCAGCTACTCGGTGGGCTGCGG + Intronic
1027144442 7:75684330-75684352 CCCAGCTACAGGGGAGGCTGAGG + Intronic
1027258184 7:76444634-76444656 CCCAGCCACTGGGGAGGCTGAGG + Intergenic
1027280664 7:76607386-76607408 CCCAGCCACTGGGGAAGCTGAGG - Intergenic
1027356599 7:77362369-77362391 CCCAGCTACTTGGTGGGCTGAGG + Intronic
1027654659 7:80915624-80915646 CCCAGCTACTGGGTAGGCTGAGG + Intronic
1027764149 7:82318387-82318409 GCAAGCCACATAGTGTGCTGGGG - Intronic
1027981604 7:85231564-85231586 CCCAGCCACTGGGGAGGCTGAGG - Intergenic
1029089346 7:98035977-98035999 CCCAGCTACAGGGGAGGCTGAGG - Intergenic
1029238091 7:99140400-99140422 CCCAGCTACTGGGTAGGCTGAGG - Intronic
1029859931 7:103559688-103559710 CCCAGCTACAGTGGGGGCTGAGG - Intronic
1030829006 7:114197978-114198000 CCCAGCTACCTGGGGTGCTGAGG - Intronic
1031413165 7:121464753-121464775 CCCAGCTACAGGGCAGGCTGAGG + Intergenic
1031842497 7:126761080-126761102 CCCAGCCACTGGGGACGCTGAGG + Intronic
1031889085 7:127273608-127273630 CCCAGCTACTGGGGATGCTGAGG - Intergenic
1032002417 7:128273983-128274005 CCCAGCCACATGGGAGGCTGAGG + Intergenic
1032132720 7:129244112-129244134 CCCAGCTACAGGGAAGGCTGAGG - Intronic
1032226285 7:130034367-130034389 CCCAGCTACTGGGTTGGCTGAGG + Intronic
1032363146 7:131274525-131274547 CCCAGCTACTGGGTAGGCTGAGG + Intronic
1032987230 7:137351464-137351486 CCCAGCCACTGGGGATGCCGAGG + Intergenic
1033020557 7:137720371-137720393 CCCAGCCACTCGGGGGGCTGAGG - Intronic
1033408886 7:141097905-141097927 CCCAGCTACTTGGTGGGCTGAGG - Intronic
1033479209 7:141722287-141722309 CCCAGCTACTGGGGATGCTGAGG + Intronic
1033505699 7:141997600-141997622 CCCAGCAACAGGGTGTGCAAAGG - Intronic
1033804582 7:144938825-144938847 CCCAGCTACAGGGGAGGCTGAGG + Intergenic
1034159208 7:148980304-148980326 CCCAGCTACAGGGGAGGCTGAGG + Intergenic
1034193423 7:149227823-149227845 CCCAGCCACTGGGGAGGCTGAGG - Intergenic
1034195565 7:149244426-149244448 CCCAGCCACTGGGGAGGCTGAGG - Intronic
1034283591 7:149870124-149870146 CCAAACCACAGGAAGTGCTGCGG + Intergenic
1034410351 7:150937948-150937970 GCCACCCACAGGGGATGCTGAGG + Intergenic
1034605499 7:152309437-152309459 CCCAGCAACTTGGGGTGCTGAGG - Intronic
1034947921 7:155275737-155275759 CCCAGCTACTGGGGGGGCTGAGG + Intergenic
1035018103 7:155783800-155783822 CCCAGCCACTGGGGAAGCTGAGG - Intergenic
1035490930 7:159277657-159277679 CCCAGACACCGGGTGGTCTGTGG + Intergenic
1035576629 8:711611-711633 CCCAGCCACTCGGTAGGCTGAGG - Intronic
1035682724 8:1500252-1500274 ACCAGCCACAGTGAGTGGTGTGG - Intergenic
1035767095 8:2114841-2114863 CCCAGCTACAGGGAAGGCTGAGG - Intronic
1035863529 8:3056481-3056503 CCCAGCTACTGGGGATGCTGAGG - Intronic
1036245517 8:7112775-7112797 CCCAGCTACAGGGGAGGCTGAGG + Intergenic
1036960304 8:13238395-13238417 CCCAGCTACAGGGGGAGGTGAGG + Intronic
1037095660 8:14983311-14983333 CGTAGCCACCTGGTGTGCTGAGG - Intronic
1037589730 8:20302987-20303009 CCCTGCCACAGGCTTTGCTCTGG - Intronic
1037744119 8:21629722-21629744 CCCAGCCACATGGGAGGCTGAGG + Intergenic
1037956804 8:23066779-23066801 CCCAGCTACACGGGATGCTGAGG + Intronic
1037973587 8:23192457-23192479 CCCAGCCTCAGGGAGGGCAGAGG - Intronic
1038029913 8:23628859-23628881 CCCAGCTGCTGGGGGTGCTGAGG + Intergenic
1038310593 8:26443538-26443560 CCCAGCTACTGGGGATGCTGAGG - Intronic
1038898872 8:31819121-31819143 CCCAGCTACTTGGTGGGCTGAGG + Intronic
1039022047 8:33218685-33218707 CCCAGCCACTGGGGAGGCTGAGG - Intergenic
1039206694 8:35163719-35163741 CCCAGCTACAGGGGAGGCTGAGG - Intergenic
1039459347 8:37730359-37730381 CCCAGCTACTCGGGGTGCTGAGG + Intergenic
1039502258 8:38027489-38027511 CCCAGCCACTGGGGAGGCTGAGG + Intergenic
1039732964 8:40299744-40299766 CCCAGTTACTGGGGGTGCTGAGG - Intergenic
1039773984 8:40717543-40717565 CCCAGCTACTGGGTAGGCTGAGG + Intronic
1040361107 8:46665265-46665287 CCCAGCTACTGGGGATGCTGAGG + Intergenic
1040720617 8:50317950-50317972 CCCAGCTACTGGGGATGCTGAGG - Intronic
1041233534 8:55776394-55776416 CCCAGCTACTTGGTGGGCTGAGG - Intronic
1041474536 8:58249042-58249064 CCCAGCCACATGCTGCACTGTGG - Intergenic
1041689080 8:60671809-60671831 CCAAACCACAGGGTAGGCTGAGG - Intergenic
1042133213 8:65609740-65609762 CCCAGCTACAGGGGAGGCTGAGG + Intronic
1042488023 8:69368039-69368061 CCCAGCTACTGGGGGAGCTGAGG - Intergenic
1042580959 8:70278848-70278870 CCCAGCTACAAGGTAGGCTGAGG + Intronic
1042713090 8:71741460-71741482 CCCAGCTACTGGGGATGCTGAGG - Intergenic
1042721768 8:71833964-71833986 CCCAGCCCCAGGCTGTCATGGGG - Intronic
1042776434 8:72437150-72437172 CCCAGCCACTCGGTAGGCTGAGG - Intergenic
1042799994 8:72708101-72708123 GTTAGCCACTGGGTGTGCTGGGG - Intronic
1042927421 8:73980202-73980224 CCCAGCTACTGGGGGTGCTGAGG - Intronic
1042930404 8:74007873-74007895 CCCAGCTACCAGGGGTGCTGAGG - Intronic
1043238397 8:77899343-77899365 CCCACTCACAGGGTGTGCAATGG + Intergenic
1043484869 8:80688841-80688863 CCCAGCTACTGGGGGAGCTGAGG + Intronic
1043698847 8:83257655-83257677 CCCAGCCACTTGGTAGGCTGAGG + Intergenic
1044032512 8:87256136-87256158 CCCAGCCACTGGGGAGGCTGAGG - Intronic
1044637592 8:94342049-94342071 CCCAGCTACTGGGTGGCCTGGGG - Intergenic
1045013995 8:97982925-97982947 CCCAGCCAGGGGGTGTGGTCTGG - Intronic
1045023040 8:98061078-98061100 CCCAGCCACTCGGGGAGCTGAGG + Intergenic
1045740360 8:105351065-105351087 CCCAGCTACTGGGGGGGCTGAGG + Intronic
1046626903 8:116584855-116584877 CCCAGCCACTGGGGAGGCTGAGG + Intergenic
1047046347 8:121056914-121056936 CCCAGCTACATGGGGGGCTGAGG - Intergenic
1047268512 8:123331352-123331374 CCCAGCCACTGGGGAGGCTGAGG - Intronic
1047404253 8:124571846-124571868 CCCAGCCACTGGGGAGGCTGAGG + Intronic
1047801731 8:128317190-128317212 CCCTGCAACTGGGTGTCCTGGGG + Intergenic
1047994220 8:130318195-130318217 CCCAGCCACTTGGGGGGCTGAGG - Intronic
1048342614 8:133552422-133552444 CCCAGCCAACGGCTCTGCTGAGG - Intronic
1048387053 8:133921721-133921743 CCCAGGCACAGGGTGTTGGGAGG + Intergenic
1048964574 8:139606266-139606288 CCCTCCCACAGGGAGTGCTGTGG + Intronic
1049104705 8:140604709-140604731 CCCAGCTACATGGGGGGCTGAGG + Intronic
1049182589 8:141230639-141230661 CCCAGACACAGCGTGCGCTCGGG - Intronic
1049368208 8:142251055-142251077 GCCAGGCAGAGGGTTTGCTGGGG + Intronic
1049385467 8:142340894-142340916 ACCAGCCCCATGCTGTGCTGTGG - Intronic
1049414526 8:142489168-142489190 CCCAGCCACAGGATGTGAAGGGG + Intronic
1049569930 8:143364667-143364689 CCCAGTCACAGGGTCAGCTCGGG - Intergenic
1049581438 8:143412927-143412949 CCCAGCCACAGGGGACCCTGGGG + Intergenic
1049858975 8:144884365-144884387 CCCAGCCACTGGGGAGGCTGAGG - Intronic
1050552631 9:6761123-6761145 CCCAGCTACTGGGTTGGCTGAGG - Intronic
1051151243 9:14081406-14081428 CACAGCCACAGGGTGTCCCCGGG + Intergenic
1051224530 9:14885038-14885060 CCCAGCCACTCGGGGGGCTGAGG - Intronic
1051668357 9:19486334-19486356 CCCAGCTACTTGGGGTGCTGAGG - Intergenic
1052690273 9:31808452-31808474 CCCAGCTACAGGGGAGGCTGAGG - Intergenic
1052850255 9:33373841-33373863 CCCAGGGACAGAGTGAGCTGAGG - Intergenic
1052988398 9:34504145-34504167 CCCAGACAGAGGCTGGGCTGGGG - Intronic
1053012667 9:34643618-34643640 CCCAGCTACAGGGGAGGCTGAGG + Intronic
1053297776 9:36927228-36927250 CCAGGCCCCAGGGTGGGCTGGGG - Intronic
1053557522 9:39153672-39153694 CCCAGCTACTGGGTAGGCTGAGG - Intronic
1053821634 9:41973958-41973980 CCCAGCTACTGGGTAGGCTGAGG - Intronic
1054139593 9:61465278-61465300 CCCAGCTACTGGGTAGGCTGAGG + Intergenic
1054336607 9:63814650-63814672 ACCAGGCCCAGGGTGTGGTGCGG + Intergenic
1054350564 9:64014939-64014961 TTCAGCCACAGGGTGTGCCTTGG - Intergenic
1054608936 9:67213452-67213474 CCCAGCTACTGGGTAGGCTGAGG + Intergenic
1054879957 9:70134554-70134576 CCCAGTCACTGGGTGTGGGGTGG - Intronic
1055434674 9:76280618-76280640 CCCAGCTACATGGTGGGCTGAGG + Intronic
1055641401 9:78321269-78321291 CCCAGGCACTTGGTGTTCTGTGG + Intronic
1055743052 9:79411066-79411088 ACCAGCTAAAGGGTGTACTGGGG + Intergenic
1056172440 9:83999023-83999045 CCCAGCTACTGGGGATGCTGAGG + Intronic
1056213531 9:84387257-84387279 CCCAGCTACTGGGGGAGCTGAGG + Intergenic
1056220457 9:84446365-84446387 CCCAGCCACTGGGGAGGCTGAGG + Intergenic
1056510099 9:87296342-87296364 CCCAGCCACTGGGGAGGCTGCGG - Intergenic
1056605859 9:88084321-88084343 CCCAGCTACTTGGTGGGCTGAGG - Intergenic
1056713384 9:89009549-89009571 CCCAGCTTGAGGGCGTGCTGGGG - Intergenic
1056717309 9:89042799-89042821 GCTAGCCAATGGGTGTGCTGAGG + Intronic
1056717321 9:89042889-89042911 GCTAGCCAGTGGGTGTGCTGAGG + Intronic
1057137467 9:92703184-92703206 CCCAGCTACTGGGTAGGCTGAGG + Intergenic
1057242189 9:93421087-93421109 CCCAGCTACTGGGGATGCTGAGG - Intergenic
1057376497 9:94528783-94528805 CCCAGCCACTGGGGAGGCTGAGG - Intergenic
1057390180 9:94636360-94636382 CCCAGCTACAGGGGAGGCTGAGG + Intronic
1058899898 9:109432850-109432872 CCAAACCACAGGGTGAGTTGGGG + Intronic
1059291876 9:113232726-113232748 CCCAGCCACTTGGTAGGCTGAGG + Intronic
1059395190 9:114029886-114029908 GCCAGACACACTGTGTGCTGAGG + Intronic
1059879309 9:118672538-118672560 CCCAGCCACTTGGTAGGCTGAGG - Intergenic
1060107868 9:120885460-120885482 CCCAGCTACTGGGAATGCTGAGG + Intronic
1060257169 9:122042128-122042150 CCCAGCCACTCGGGGGGCTGAGG - Intronic
1060506271 9:124200582-124200604 CCCAGCTACAGGGGAGGCTGAGG - Intergenic
1060578273 9:124718928-124718950 CCCAGCTACTGGGGATGCTGAGG - Intronic
1060961964 9:127687418-127687440 CCCAGCTACTAGGTGAGCTGAGG - Intronic
1061102623 9:128503772-128503794 CCCAGCTACACGGGGAGCTGAGG + Intergenic
1061138294 9:128749210-128749232 CCCAGCCACTAGGGGGGCTGAGG + Intronic
1061252555 9:129435221-129435243 CCCAGCCACTCGGGATGCTGAGG - Intergenic
1061378665 9:130241255-130241277 CCCAGCCAGAGGGACTCCTGTGG + Intergenic
1061396894 9:130348395-130348417 CCCAGCCACAAAGGGTCCTGTGG - Intronic
1061429691 9:130523360-130523382 ACCAGCTCCTGGGTGTGCTGGGG + Intergenic
1061563821 9:131424049-131424071 CCCAGCCACTGGGGAGGCTGAGG - Intronic
1061620592 9:131808964-131808986 CCCAGCCACAGGATCTGCACAGG - Intergenic
1061723708 9:132569849-132569871 CCCAGCTACAGGGAGGGCTAAGG - Intronic
1061851897 9:133421148-133421170 CCCAGCCACAAGGGAGGCTGAGG + Intronic
1061899632 9:133666267-133666289 CCCAGGCAAAGGGTGGGCTGTGG + Intronic
1061913629 9:133737991-133738013 CCCAGGCTCAGGGGGTGGTGGGG + Intronic
1061998153 9:134199001-134199023 CCCAGCCACTTGGTAGGCTGAGG + Intergenic
1062010234 9:134263228-134263250 CCCAGCCCCAGGGGGTGCTCAGG + Intergenic
1062063967 9:134515990-134516012 CCCAGCCACTCGGGGGGCTGAGG + Intergenic
1062257240 9:135632781-135632803 CCCAGCTACTGGGGGTGCTGAGG - Intronic
1062269820 9:135703267-135703289 CCCAGTCTCAGGCTGTCCTGAGG + Intronic
1062336236 9:136070390-136070412 CCCAGCCACTGGGGAGGCTGAGG + Intronic
1062548399 9:137074263-137074285 CCCAGTCACGGTGTGGGCTGGGG + Intergenic
1062558548 9:137128753-137128775 CTCAGCAACAGGGTGTTCGGAGG + Intergenic
1062617159 9:137403091-137403113 CCGAGCCACAGGGTCTCCCGTGG - Intronic
1062726943 9:138079625-138079647 CCCAGCCACCTGGGGAGCTGAGG + Intronic
1203654893 Un_KI270752v1:14233-14255 CCCAGCCACTGGGGAGGCTGAGG + Intergenic
1185489410 X:509628-509650 CCCAGCTACTCGGTGGGCTGAGG - Intergenic
1185737451 X:2504011-2504033 CCCAGCCACTGGGTGGGCTCTGG + Intergenic
1185909118 X:3965979-3966001 ACCAGGCCCAGGGTGTGGTGCGG - Intergenic
1186621097 X:11240927-11240949 CCCAGCTACTGGGTGGGGTGGGG + Intronic
1186680997 X:11874264-11874286 CCCAGCTACAGGAGGGGCTGTGG - Intergenic
1186971527 X:14850232-14850254 CCCAGCTACTGGGGATGCTGAGG + Intronic
1187663666 X:21578843-21578865 CCCAACCACTGGCTCTGCTGAGG - Intronic
1187858047 X:23655883-23655905 CCCAGCTACACGGGATGCTGAGG + Intergenic
1188382548 X:29514562-29514584 CCCAGCTACTGGGGATGCTGAGG - Intronic
1188512639 X:30953189-30953211 CCCAGCTACTGGGTAGGCTGAGG - Intronic
1189164844 X:38850444-38850466 CCCAGCCACTGGGGAGGCTGAGG + Intergenic
1189257136 X:39649089-39649111 CCCTGCCCCACGGTGTGCTAAGG - Intergenic
1189496237 X:41511481-41511503 CCCAGCTACATGGGGTGATGAGG + Intergenic
1189882851 X:45509681-45509703 CCTCCCCACAGGCTGTGCTGTGG - Intergenic
1189998430 X:46661614-46661636 CCCGGCCACATGGTGTTATGTGG - Intronic
1190661793 X:52661549-52661571 CCCAGCCACATGGGAGGCTGAGG - Intronic
1191055974 X:56241279-56241301 CCCAGCCACTTGGTAGGCTGAGG - Intronic
1191851358 X:65588440-65588462 CCCAGGGCCAGGGTGTGCTCAGG - Intronic
1192340696 X:70261019-70261041 CCCAGCTACATGGGGGGCTGAGG + Intergenic
1192416041 X:70981582-70981604 CCCAACTACATGGTGAGCTGAGG + Intergenic
1192417585 X:70997290-70997312 CCCAGACAGAGGGAGTGCAGTGG + Intergenic
1192454688 X:71266998-71267020 CCCAGCTACACGGGATGCTGAGG - Intergenic
1192805466 X:74504872-74504894 CCCAGCCACACGGGAGGCTGAGG + Intronic
1192831016 X:74751112-74751134 CCCAGCCACTTGGTGGGCTGAGG + Intronic
1192998086 X:76533622-76533644 CCCAGCCAAAGGAAGTGATGAGG - Intergenic
1194246508 X:91518847-91518869 CCCAGCTACTCGGTATGCTGAGG - Intergenic
1194335970 X:92646605-92646627 CCCAGCTACTTGGTATGCTGAGG - Intergenic
1195023427 X:100851796-100851818 TCCAGCCACATGGGATGCTGAGG + Intronic
1195274372 X:103267092-103267114 CCCAGCTACAGGGAAGGCTGAGG - Intergenic
1195899080 X:109778662-109778684 CCCAGCTACTGGGGGTGCTGAGG + Intergenic
1196054041 X:111335828-111335850 CCCAGCTACTGGGGGTGCGGGGG + Intronic
1196857149 X:119995031-119995053 CCCAGCTACAGGGGAGGCTGAGG + Intergenic
1197255672 X:124260474-124260496 CCCAGCTACTGGGTAGGCTGAGG - Intronic
1197304519 X:124825267-124825289 CCCAGCTACTTGGGGTGCTGAGG - Intronic
1197424533 X:126279223-126279245 CCCAGCTACTGGGGATGCTGAGG + Intergenic
1197666524 X:129230007-129230029 CCCAGCTACAGGGGAGGCTGAGG + Intergenic
1197713980 X:129692972-129692994 TCCAGCTACTGGGGGTGCTGAGG + Intergenic
1197785173 X:130191206-130191228 CCCACCCTCAGTGCGTGCTGGGG + Intergenic
1197843443 X:130775262-130775284 CCCAGCTACTTGGGGTGCTGGGG + Intronic
1197910533 X:131478813-131478835 CCCAGCCACATGGAGTCATGAGG + Intergenic
1198457178 X:136828284-136828306 CCCAGCTACATTGAGTGCTGTGG + Intergenic
1198726068 X:139678045-139678067 CCCAGCTACTGGGTAGGCTGAGG + Intronic
1199151240 X:144489580-144489602 CCCAGCTACATGGGGGGCTGAGG - Intergenic
1199385198 X:147215549-147215571 CCCAGCCTCAGGAGGTCCTGAGG + Intergenic
1199774130 X:150996130-150996152 CCCAGCCACATGGGAGGCTGAGG - Intergenic
1200565469 Y:4760091-4760113 CCCAGCTACTCGGTATGCTGAGG - Intergenic
1200644404 Y:5763354-5763376 CCCAGCTACTTGGTATGCTGAGG - Intergenic
1201151739 Y:11098624-11098646 TTCAGCCACAGGGTGTGCCTCGG - Intergenic
1201250236 Y:12050165-12050187 CCCAGCTACTGGGTAGGCTGAGG + Intergenic
1201380276 Y:13368493-13368515 CCCAGCTACATGGGGGGCTGAGG - Intronic
1201620558 Y:15952513-15952535 CCCAGCTACTCAGTGTGCTGAGG - Intergenic
1201947682 Y:19529489-19529511 CCCAGCTACTGGGGGTGCTGAGG + Intergenic