ID: 1084216958

View in Genome Browser
Species Human (GRCh38)
Location 11:67652931-67652953
Sequence CTAGAGGCAAGCAATTCTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 0, 2: 3, 3: 13, 4: 166}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084216958 Original CRISPR CTAGAGGCAAGCAATTCTGA AGG Intergenic
901532308 1:9861287-9861309 CCAAAGGGAAGCATTTCTGAAGG + Intronic
903104731 1:21066579-21066601 CTGTAGGCAAGAAATTGTGAAGG - Intronic
904017882 1:27437199-27437221 CTAGAAGAAACCAATTTTGAAGG - Intronic
904766039 1:32848006-32848028 TTAGAGGCACACATTTCTGACGG - Intronic
906520943 1:46466591-46466613 ATAGAGTCAATCAATTATGAAGG + Intergenic
907362298 1:53927992-53928014 GTAGAGGCTATCAATTCTGCTGG + Intronic
909434279 1:75622398-75622420 CTAGAGGAATGCAATTCTAGAGG - Intergenic
911064820 1:93778797-93778819 CTCGAGGGAAGCCTTTCTGAAGG + Intronic
912152397 1:106876317-106876339 CTAGATGCAAGCCACACTGAAGG - Intergenic
913459341 1:119067398-119067420 CAAAAGGCAAGCAATTCAAAAGG + Intronic
914992426 1:152510595-152510617 CTAGAGGCCTGCAGTTCTCAGGG + Intergenic
915957088 1:160230066-160230088 CTAGAGGAAACGAATTTTGAAGG + Intronic
915993898 1:160545167-160545189 CCAGAGCCCAGGAATTCTGAAGG - Intronic
916357092 1:163923968-163923990 CTTCAGGTAAGCAATTCTGGTGG - Intergenic
916546567 1:165811219-165811241 CTATAGGGAAGCATTTCTTAGGG + Intronic
917026362 1:170646955-170646977 CTAGTGCCTACCAATTCTGAGGG - Intergenic
923847170 1:237747937-237747959 AAAGAGGGAAGGAATTCTGAGGG + Intronic
1065901113 10:30208945-30208967 CTTGTGGTAAGCAAGTCTGAAGG - Intergenic
1067569945 10:47364324-47364346 CTAGATGCCAGCAATGCTGCAGG + Intergenic
1069258967 10:66370104-66370126 CTAGAGGAAAGAAAATCTAAGGG + Intronic
1070628105 10:78065634-78065656 CTAGAGCCAAGCAATTCTGGAGG + Intergenic
1071124589 10:82319444-82319466 CTAGAGGCATGCAATTTGCATGG + Intronic
1071405218 10:85323413-85323435 TGAGGGGCAAGCATTTCTGAAGG + Intergenic
1075201132 10:120405151-120405173 CTGGAGGCCAGCACTTCTGGAGG - Intergenic
1077604646 11:3600679-3600701 CTGGATGCAAGCAATTCACAAGG + Intergenic
1084216958 11:67652931-67652953 CTAGAGGCAAGCAATTCTGAAGG + Intergenic
1084227108 11:67723494-67723516 CTGGATGCAAGCAATTCACAAGG + Intergenic
1084260544 11:67975267-67975289 CTGGATGCAAGCAATTCACAAGG + Intergenic
1084808091 11:71593362-71593384 CTTGATGCAAGTAATTCAGAAGG - Intronic
1084845201 11:71893375-71893397 CTGGATGCAAGCAATTCACAAGG - Intronic
1087653443 11:100895602-100895624 CTGGAGGGAAGAAATGCTGAAGG + Intronic
1087978835 11:104584997-104585019 CTAGGGTCATTCAATTCTGATGG + Intergenic
1087986567 11:104688996-104689018 CTAGAGAAAAGTAACTCTGATGG - Intergenic
1089714391 11:120343661-120343683 CTAGAGACAAGCAAATCTACTGG + Intronic
1089859608 11:121577033-121577055 CAAGAGGCAAGCAGCTCTAAGGG + Intronic
1094784530 12:33831070-33831092 TTTGAGACAATCAATTCTGATGG - Intergenic
1095608438 12:44098503-44098525 CCAGAGTCAAGCAAATATGAGGG + Intronic
1095971743 12:47906174-47906196 CTAGAGCCCAGCAAATCTGCTGG + Intronic
1097349631 12:58534426-58534448 CCAGAGGAGAGAAATTCTGAGGG + Intergenic
1099708613 12:86190538-86190560 CATGAGGAAAGCAATTTTGAGGG - Intronic
1099965709 12:89442537-89442559 TTACAGACAAGCAATGCTGAGGG + Intronic
1104044796 12:125154168-125154190 CTGCAGGCAAGCAGTGCTGAAGG + Intergenic
1108093284 13:46873896-46873918 CTAGAGGGGAGGAGTTCTGAAGG + Intronic
1108297560 13:49039386-49039408 CCAGAGACAAGCAAGCCTGACGG - Intronic
1109104141 13:58228163-58228185 CTAGAGAAAAGAAATTTTGATGG - Intergenic
1110729478 13:78863641-78863663 CTAGAGGCCAGGAATACTCAAGG - Intergenic
1112218769 13:97465232-97465254 CAAGAGGGAAGCAACTGTGATGG + Exonic
1115495640 14:34001765-34001787 CTAAATGCAAACTATTCTGATGG + Intronic
1116282496 14:42927087-42927109 TTACAGGTAAGCAATTCTAATGG - Intergenic
1116370309 14:44121962-44121984 CTAGAGGCAATCTGTGCTGAGGG + Intergenic
1119697957 14:76728997-76729019 TCAAAGGCAAGCAATTCTAAAGG - Intergenic
1119916668 14:78408495-78408517 CAGGAGGGAGGCAATTCTGATGG - Intronic
1120480387 14:85041910-85041932 CTAGAGAAAAGCAATCCTTAGGG + Intergenic
1121998856 14:98629406-98629428 CTAGAGGTCAGCAGATCTGAAGG + Intergenic
1122227402 14:100287635-100287657 CTTGAGGCCAGGAATTCGGAGGG - Intergenic
1123477183 15:20598255-20598277 CGAGAGGCAAGCAAGGGTGAGGG + Intergenic
1123640830 15:22402109-22402131 CGAGAGGCAAGCAAGGGTGAGGG - Intergenic
1124143085 15:27094580-27094602 ATAGAGGGAAGCAGTTCTGCAGG + Intronic
1126274111 15:46856085-46856107 ATCCAGGCAAGCAATTATGAAGG - Intergenic
1126961382 15:54000100-54000122 CTTGAGACAAGCAATTCTGAGGG + Intergenic
1128516280 15:68344016-68344038 CAGGAGGCAACCAACTCTGATGG - Intronic
1132054379 15:98638133-98638155 CTAGGGGTAACCAAGTCTGAAGG - Intergenic
1136724607 16:32348247-32348269 CCAGAGGCGAGCAAGTCTGTCGG - Intergenic
1138227312 16:55307890-55307912 TTAGAGGAAAGCAATTTTGATGG - Intergenic
1138884153 16:61054527-61054549 CCAGATGCAAGCACTGCTGATGG - Intergenic
1203001823 16_KI270728v1_random:169508-169530 CCAGAGGCGAGCAAGTCTGTCGG + Intergenic
1144608597 17:16689546-16689568 CTAGAGGCGAGCAATCCTGGTGG + Intergenic
1144693678 17:17286540-17286562 CTATAGACAAGCATTTCTCAAGG - Intergenic
1145128371 17:20320461-20320483 CTAGAGGCGAGCAATCCCGGTGG + Intergenic
1145196242 17:20896753-20896775 CTAGAGGCGAGCAATCCCGGTGG - Intergenic
1146003998 17:29149382-29149404 CTAGAGACAAGCAATCAGGAAGG + Intronic
1151125980 17:71845300-71845322 CTATAGGGAAACAATTCTAAAGG + Intergenic
1156213225 18:34970026-34970048 CTATGTGCAAGGAATTCTGAGGG - Intergenic
1156299743 18:35825935-35825957 CTGGATTCAAGCAATTCTCATGG - Intergenic
1157200653 18:45656560-45656582 ATACAGACATGCAATTCTGAGGG + Intronic
1158887018 18:61838170-61838192 CTAGAGGAAACAAAGTCTGATGG - Intronic
1159188886 18:65016455-65016477 TCATAGGCAAGCAATTCAGAAGG - Intergenic
1159363602 18:67437012-67437034 CTAGAGACAAGCATGTCTGTGGG - Intergenic
1160002596 18:75040975-75040997 TTGGTGGCAAGCAGTTCTGAAGG + Intronic
1166557342 19:43709498-43709520 CTGGATTCAAGCAATTCTCATGG + Intergenic
1166679239 19:44757200-44757222 CTGGAGGCCCGCAATTATGACGG + Exonic
928367907 2:30716865-30716887 ACAGAGGTAAACAATTCTGATGG + Intergenic
929303116 2:40328831-40328853 CTGGAGGCAAGCAGATCAGATGG - Intronic
934321539 2:91975389-91975411 CTGGAGGCGAGCAAGTCTGTCGG + Intergenic
934616605 2:95775125-95775147 CTAGAGGGAGGCACTTCTGGAGG + Intergenic
934837701 2:97605524-97605546 CTAGAGGGAGGCACTTCTGGAGG - Intergenic
934977984 2:98818900-98818922 CTATAGGGAAGCAACTCTGGGGG - Intronic
935735264 2:106101621-106101643 ATAAAGGCAAACAATACTGAGGG + Intronic
937030149 2:118732142-118732164 CTAGAGGAAAGCTGTTCAGATGG - Intergenic
938236422 2:129710004-129710026 CTGGAGGCCTGCAATCCTGATGG + Intergenic
940162874 2:150732601-150732623 TCAGAGGCCAGTAATTCTGATGG - Intergenic
943145164 2:184034636-184034658 CTAGAGGCAAGGGTTTCTCATGG + Intergenic
944555290 2:200882420-200882442 AAAGAGCCAAGAAATTCTGAAGG + Intronic
946077151 2:217083858-217083880 GAAGAGGCAAGCAATTCCGAAGG + Intergenic
947522255 2:230856061-230856083 CTAAAGGCAAGAAATCATGATGG - Intergenic
947785255 2:232812629-232812651 CTAGATCCAAGCAATATTGAAGG + Intronic
948724001 2:239920652-239920674 CTGGAAGGAAGCAACTCTGAAGG + Intronic
1169868358 20:10224673-10224695 ATGAAGGCAAGCAATTCTGAGGG - Intronic
1174538459 20:51270981-51271003 CTAGAGGAAAGCAATGGGGAAGG + Intergenic
1177402088 21:20618160-20618182 CTAGAGGGAAGAAATTGTGGTGG + Intergenic
951669879 3:25168738-25168760 ATAGAGACAATCAATTCTGAAGG + Intergenic
952446054 3:33381941-33381963 CTAGAGGAGAGGAATTCTGTTGG - Intronic
952737432 3:36704544-36704566 TTAGAGGAAAGAAATTCTCAGGG - Intergenic
954135739 3:48581376-48581398 CTCGAAGCAAGCAGTTCTCAAGG + Intronic
954271206 3:49510781-49510803 CTGGAGGCAATCAAATCTGTTGG - Exonic
955972237 3:64446931-64446953 CTAGAGGCAAGCATTGCTACAGG - Intergenic
957075495 3:75599686-75599708 CTGGATGCAAGCAATTCACAAGG + Intergenic
959766209 3:110032465-110032487 GGAGAGGAAAGAAATTCTGAGGG - Intergenic
960614210 3:119582143-119582165 CCAGAGCCCAGCAATTGTGAGGG + Exonic
961275691 3:125724448-125724470 CTGGATGCAAGCAATTCACAAGG - Intergenic
961278606 3:125747043-125747065 CTGGATGCAAGCAATTCACAAGG - Intergenic
961875796 3:130022590-130022612 CTGGATGCAAGCAATTCACAAGG + Intergenic
962727720 3:138249351-138249373 CAAGAGGCAGGCAATCCTGAGGG + Intronic
962903880 3:139784426-139784448 CTAGAGGCCAGCAATACAGTAGG - Intergenic
963187666 3:142437387-142437409 CTGGAAGCAAGCAGTTCTGTTGG - Intronic
965319941 3:167241013-167241035 CTGGAGGCAAGCAGATGTGAGGG + Intronic
966808545 3:183824850-183824872 CTGAAGGCAGGCCATTCTGACGG + Intronic
967693911 3:192509039-192509061 CTAGATACAATCAATCCTGAAGG + Intronic
967854944 3:194110422-194110444 AGACAGGCATGCAATTCTGAGGG - Intergenic
968988152 4:3890337-3890359 CTGGATGCAAGCAATTCACAAGG + Intergenic
969023785 4:4157513-4157535 CTGGATGCAAGCAATTCACAAGG + Intergenic
969730035 4:8949557-8949579 CTAGATGCAAGCAATTCACAAGG - Intergenic
969786200 4:9459187-9459209 CTGGATGCAAGCAATTCACAAGG - Intergenic
969789639 4:9483671-9483693 CTGGATGCAAGCAATTCACAAGG - Intergenic
969794119 4:9512837-9512859 CTGGATGCAAGCAATTCACAAGG - Intergenic
969880135 4:10166518-10166540 CTAGAGTGAAGCAGTTCTTATGG + Intergenic
970827742 4:20297392-20297414 CTAGAGGAAAAATATTCTGAGGG + Intronic
973620767 4:52723067-52723089 ATCCAGGCAAGCAATTATGAAGG - Intronic
981060959 4:140425293-140425315 TTTGATGCAAGCAATTTTGAAGG + Intronic
982047591 4:151464267-151464289 CTAGAGGTAATCAAATCTGGTGG + Intronic
983643749 4:169968954-169968976 ATAGAGCCAAGAAATCCTGAGGG - Intergenic
984947755 4:184983202-184983224 CTGGAGGCAAGGAAGTCTGTTGG - Intergenic
988385483 5:30559072-30559094 TTTGATGCAAGCCATTCTGATGG + Intergenic
991113151 5:62924756-62924778 TTAGAGTCAACCAACTCTGAAGG - Intergenic
994825947 5:104712935-104712957 CTAGAGGCAGCCTATGCTGAGGG + Intergenic
996209478 5:120788599-120788621 ATAGAGGCAAGCAATGCTGCTGG + Intergenic
996280488 5:121724578-121724600 TTACAGACAAGCAATGCTGAGGG - Intergenic
1000243942 5:159433517-159433539 CTCTAGACAAGCAAATCTGAGGG + Intergenic
1000750061 5:165084084-165084106 ATAGATGCAACCAATTCTGATGG - Intergenic
1006799659 6:36751911-36751933 TGAGAGGGAAGCAATTTTGATGG + Intronic
1006836584 6:37002665-37002687 CTGGAGGGAAGCAGCTCTGATGG + Intergenic
1008274256 6:49525183-49525205 CTAAATAAAAGCAATTCTGAGGG + Intronic
1009409070 6:63344584-63344606 CTAGAGGAAAGCAGTTCTGAAGG + Intergenic
1010409428 6:75544351-75544373 CTAGAGGCAACCAATAGTGACGG - Intergenic
1013655738 6:112244481-112244503 CTATAGACAAGCAGTCCTGAGGG - Intronic
1016427040 6:143945846-143945868 CGAGAGGCAAGAAATGCTGGGGG + Intronic
1016781307 6:147962464-147962486 CCAGAGGCAATGAATTCTGCAGG + Intergenic
1020024259 7:4887612-4887634 CTTGAGGAAAGAAGTTCTGAGGG - Intergenic
1020310888 7:6867689-6867711 CTGGATGCAAGCAATTCACAAGG + Intergenic
1021481646 7:21124392-21124414 CTAGGGGCAAGGAATTATGACGG - Intergenic
1023264226 7:38389468-38389490 CCAGAGGCAACCACTTTTGAAGG + Intronic
1027151523 7:75737435-75737457 CCAGATTCAAGCAATTCTGCTGG + Intronic
1029077590 7:97947999-97948021 CTGGATGCAAGCAATTCACAAGG + Intergenic
1032144712 7:129368596-129368618 TGAGAGGCAACCATTTCTGACGG + Intronic
1034391461 7:150790771-150790793 ATAGATGTAAGCATTTCTGAAGG - Intergenic
1036819583 8:11929603-11929625 CTAGATGCAAGCAATTCACAAGG + Intergenic
1036822064 8:11949251-11949273 CTAGATGCAAGCATTTCTCTTGG + Intergenic
1036832762 8:12034652-12034674 CTAGATGCAAGCAATTCACAAGG + Intergenic
1039656728 8:39417601-39417623 CTAGACGCTAGGAACTCTGAAGG - Intergenic
1039914026 8:41846489-41846511 CTGAAGGCAGGCAACTCTGAAGG + Intronic
1041585060 8:59506855-59506877 CTAGAGTCAACCAAATGTGAAGG - Intergenic
1047285801 8:123486289-123486311 GTCCAGGCAAGCAATGCTGAGGG + Intergenic
1048521586 8:135160331-135160353 CTACAGTCAAGAAATCCTGAAGG - Intergenic
1048536609 8:135302267-135302289 CTAGGTTCAAGCAATTCTCATGG + Intergenic
1050409323 9:5346360-5346382 AAATAGCCAAGCAATTCTGAGGG + Intergenic
1051274987 9:15390104-15390126 CCAGATGCAAGCAATTCTCCAGG - Intergenic
1053050404 9:34957482-34957504 CAGAAGGCCAGCAATTCTGAGGG - Intergenic
1053510550 9:38684179-38684201 TGAGAGGCAAGAATTTCTGACGG - Intergenic
1053608372 9:39682821-39682843 CTAGAGGGAAGCATGTCTGGAGG + Intergenic
1053866212 9:42439185-42439207 CTAGAGGGAAGCATGTCTGGAGG + Intergenic
1054245158 9:62659588-62659610 CTAGAGGGAAGCATGTCTGGAGG - Intergenic
1054559286 9:66694119-66694141 CTAGAGGGAAGCATGTCTGGAGG - Intergenic
1055302328 9:74894768-74894790 CCAGATTCAAGCAATTCTCATGG - Intergenic
1057407598 9:94787754-94787776 AAAGAGTCAAGTAATTCTGATGG + Intronic
1057913355 9:99036866-99036888 CCAGAGGCAGGCAGATCTGAAGG + Intronic
1188273233 X:28169454-28169476 CTAGAGGCAAGGACTTCAGTTGG - Intergenic
1188374217 X:29407628-29407650 ATATAAGCAAGCAATTCTGTAGG + Intronic
1189164201 X:38843856-38843878 CTAGCTGCAAGGAATTCTGCGGG + Intergenic
1190070934 X:47278589-47278611 CTGGGTTCAAGCAATTCTGAGGG - Intergenic
1194769219 X:97880248-97880270 TTGGAGGAAAGCCATTCTGAAGG + Intergenic
1195373897 X:104206617-104206639 ATAGAATCAAGCAATACTGAGGG + Intergenic
1196103299 X:111870079-111870101 CAAGAGGCAAGGCATTGTGATGG + Intronic
1197708431 X:129650112-129650134 CTAGATGCAGGCAAATCAGATGG - Intronic