ID: 1084219170

View in Genome Browser
Species Human (GRCh38)
Location 11:67667066-67667088
Sequence AGGGGTCTAGAATTTGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 193
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 176}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084219164_1084219170 -6 Left 1084219164 11:67667049-67667071 CCCAGACCTGGGCCAGGAGGGGT 0: 1
1: 0
2: 5
3: 69
4: 352
Right 1084219170 11:67667066-67667088 AGGGGTCTAGAATTTGAGGAGGG 0: 1
1: 0
2: 0
3: 16
4: 176
1084219165_1084219170 -7 Left 1084219165 11:67667050-67667072 CCAGACCTGGGCCAGGAGGGGTC 0: 1
1: 0
2: 2
3: 37
4: 391
Right 1084219170 11:67667066-67667088 AGGGGTCTAGAATTTGAGGAGGG 0: 1
1: 0
2: 0
3: 16
4: 176

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084219170 Original CRISPR AGGGGTCTAGAATTTGAGGA GGG Intronic
902101009 1:13989021-13989043 AAGGGTCTGGCATTTGATGAGGG + Intergenic
904842810 1:33384410-33384432 AAGGGGCTAGAATTTGAGATGGG + Intronic
906306501 1:44723448-44723470 AGGGGACTAGAATTTATGGAGGG - Intronic
907052036 1:51336066-51336088 AGGGTTCTAGACTCTGAAGAGGG - Intronic
907166656 1:52417538-52417560 AGGGGCAGAGAATTAGAGGATGG + Exonic
908870341 1:68603372-68603394 AAGGGTCTAGAAATTGACAAAGG - Intergenic
909522959 1:76590298-76590320 ATGGGATTAGAATTTTAGGAAGG + Intronic
910401413 1:86841683-86841705 TGGGTTAGAGAATTTGAGGAGGG + Intergenic
912904892 1:113693938-113693960 TGGGGTCTAGAATTTTAGGTAGG + Intergenic
913047465 1:115086797-115086819 ATGGGTCTCAAATTTGAGCATGG + Intronic
915108393 1:153548216-153548238 AGGGGGCTGGATTGTGAGGAGGG - Intronic
915614036 1:157021293-157021315 ATGTGTCAAGTATTTGAGGATGG + Intronic
918438718 1:184544272-184544294 AGTGGTTTAGAAGTTGAGGCAGG + Intronic
919878393 1:201886998-201887020 AGGGGTATACACTTTGAGGAGGG + Intergenic
919878398 1:201887031-201887053 AGGGGTATACACTTTGAGGAAGG + Intergenic
920254354 1:204644371-204644393 AGGGGTCTACCCTTTGAGAAAGG - Intronic
1062890948 10:1059433-1059455 AAGTGTGTATAATTTGAGGAAGG - Intronic
1063434383 10:6018634-6018656 AGGGGTCAAGAGTGGGAGGAAGG - Intronic
1068155406 10:53191095-53191117 ACGTGTCTAGAAATTGATGAGGG - Intergenic
1073328261 10:102654988-102655010 AGGGTTCTAGGATGTGAGAAGGG + Intronic
1075689843 10:124387447-124387469 AGGGCTCAAGAGTTTGAGGTCGG + Intergenic
1076996082 11:298234-298256 AGGGGCCTGGAGTGTGAGGAGGG + Exonic
1079368023 11:19826377-19826399 AGGGCTCAAGATTTTGAGTAAGG - Intronic
1080906218 11:36548056-36548078 AGGGGTGTTGAATTTTATGAAGG - Intronic
1081954204 11:47075594-47075616 AGGGTTCAAGAATTGGAGGTGGG + Intronic
1084219170 11:67667066-67667088 AGGGGTCTAGAATTTGAGGAGGG + Intronic
1085901918 11:80710281-80710303 AGGTGACTACAATGTGAGGATGG + Intergenic
1086850424 11:91801097-91801119 GATGTTCTAGAATTTGAGGAGGG - Intergenic
1087173160 11:95070930-95070952 ATGGGTGTAGAAATTGAGAAAGG + Exonic
1089569714 11:119396676-119396698 AGGGGTTAAGAATTTTAGGCTGG - Intergenic
1090242467 11:125193809-125193831 AGGGGACAAGGATTTAAGGATGG + Intronic
1090441238 11:126727316-126727338 AGGGGTCTGGGAGGTGAGGAAGG - Intronic
1093013589 12:14133896-14133918 GTGGGTCTAACATTTGAGGAAGG + Intergenic
1094638643 12:32251503-32251525 TGGGGTCTAGAACGTGAGAAGGG - Intronic
1096656307 12:53094602-53094624 CGGGGGCTGGAAATTGAGGAGGG + Intergenic
1098527993 12:71508859-71508881 AGTGTTCTAGAATGTCAGGAAGG - Intronic
1099224124 12:79948755-79948777 ATGGGTCAGGAATTTGAGGGTGG - Intergenic
1100469853 12:94880684-94880706 AAGGGTCTTGGATGTGAGGAAGG + Intergenic
1100724785 12:97396978-97397000 AGGAGTCTACAATTTAGGGAGGG - Intergenic
1101545152 12:105705479-105705501 TGGGGTTTACAATTGGAGGAAGG + Intergenic
1103054582 12:117808676-117808698 AGGGGTGTAGGAGTTGAGGATGG - Intronic
1110913927 13:80998514-80998536 ATGGGTCTGGGATTTTAGGAGGG + Intergenic
1114258747 14:21023196-21023218 AGAGGTCTGGAATTTGGGCATGG + Intronic
1115787969 14:36847660-36847682 AGGTTCCTAGAATTTGAGAAGGG + Intronic
1116653252 14:47621198-47621220 AGGGTTCAAGAATTTGTGAAGGG - Intronic
1117239155 14:53811116-53811138 ATGGGTCTAGAATTTGACCCTGG + Intergenic
1117354420 14:54910013-54910035 AGGGCTCTATCATCTGAGGAAGG + Intergenic
1118977177 14:70687853-70687875 AGGGGTCTAAAATTGGCTGATGG + Intergenic
1119580417 14:75774040-75774062 AGTGGTCTTGCTTTTGAGGAAGG + Intronic
1120632410 14:86906229-86906251 AAGGGTATAGTATTTGGGGAGGG - Intronic
1122308576 14:100780657-100780679 AGGGGTAAAGACTTTGAGGTTGG - Intergenic
1125399538 15:39286027-39286049 ACAGGTTGAGAATTTGAGGAGGG - Intergenic
1127238232 15:57080460-57080482 AGAGATCTAGGAATTGAGGAAGG + Intronic
1128327979 15:66737513-66737535 ATGGGTGTTGAATTGGAGGAAGG + Intronic
1129120082 15:73390940-73390962 AGGCATCTAGGCTTTGAGGAAGG + Intergenic
1129140081 15:73589905-73589927 AGTGTTCCAGAGTTTGAGGAAGG + Intronic
1131071082 15:89466352-89466374 AGGGGTCTGCAATTGGAGGATGG + Intergenic
1131841099 15:96438525-96438547 GGGGTTCTAGAATTTCAAGAGGG + Intergenic
1131988548 15:98068943-98068965 GGGGCTCTAGAGTTTGAGGGAGG + Intergenic
1132922095 16:2401513-2401535 GGGGGTCTAGAATTTGAGAGTGG - Intergenic
1143578233 17:7807662-7807684 AGGGGGCTAGAATTAGATGGGGG - Intronic
1143747625 17:9005263-9005285 ATGGCTCTAGAATCTGTGGAAGG - Intergenic
1144706917 17:17374994-17375016 AGGGCCCTAGGATTTGGGGATGG - Intergenic
1147034141 17:37667509-37667531 AGTGTTCTGAAATTTGAGGATGG - Intergenic
1149019116 17:51943148-51943170 AGAGGTATAGAATTTGACTATGG - Intronic
1149345066 17:55726317-55726339 AGGGGTCTGGGAGTGGAGGAGGG + Intronic
1149972615 17:61234277-61234299 AGGAATGTAGGATTTGAGGAAGG - Intronic
1150163313 17:62917444-62917466 AGGGTTCAAGAATTTCAGGATGG - Intergenic
1155396562 18:25392606-25392628 AGGGCTCTGGAATAGGAGGAGGG + Intergenic
1157549388 18:48570791-48570813 AGGGACCCAGACTTTGAGGAGGG + Intronic
1158798066 18:60872274-60872296 AGGGCAGTAGAATGTGAGGAAGG + Intergenic
1162525209 19:11202777-11202799 AGGTGTCTCGAATATCAGGATGG + Intronic
1165489823 19:36116527-36116549 AGAGGCCTAGAATGTGAGGTAGG + Intronic
1165583743 19:36893893-36893915 AGGAGTTTAGATTTTCAGGAGGG - Intronic
1166076701 19:40417780-40417802 AGGGGTGGAGAATCTGGGGAGGG - Intergenic
1166094667 19:40531168-40531190 AGGGGGCTTTACTTTGAGGATGG + Intronic
925023326 2:588425-588447 AAAGGCCTAGAATTTAAGGAAGG + Intergenic
926188732 2:10711535-10711557 AGGGGACTAGAATGAGAGGGAGG + Intergenic
926577351 2:14596786-14596808 AAGGGTCCAGTCTTTGAGGAAGG + Intergenic
927030806 2:19118722-19118744 AGGGCCCTGGAATCTGAGGAGGG + Intergenic
927237125 2:20884632-20884654 AGGAGTGAAGATTTTGAGGATGG - Intergenic
928272510 2:29869133-29869155 ATGGGTCTGGAATTTGAAAAGGG - Intronic
928431702 2:31224437-31224459 AGGGGTGAAGAAGTTGAGGTGGG + Intronic
930916882 2:56702714-56702736 GGGGGTGTGGAATTTGTGGATGG + Intergenic
930956269 2:57206505-57206527 CGAGGTCCAGATTTTGAGGAAGG - Intergenic
933172052 2:79135533-79135555 AGGGCTCCAGAAATTGAGGTAGG + Intergenic
933905747 2:86890882-86890904 AGTGGTGTAGAATTAGAAGAGGG + Intergenic
934110211 2:88735335-88735357 GAGGGTCTAGAAGCTGAGGAGGG - Intronic
934667222 2:96180791-96180813 AGGGCTATAGAATTAGATGAAGG + Intergenic
936144108 2:109967700-109967722 AGGTGTCTGGAATTTGAACATGG + Intergenic
936180790 2:110265661-110265683 AGGTGTCTGGAATTTGAACATGG + Intergenic
936200579 2:110403769-110403791 AGGTGTCTGGAATTTGAACATGG - Intronic
936769182 2:115891305-115891327 AGGGGTGTTGAATTTTTGGAAGG + Intergenic
937570897 2:123359823-123359845 AGAGGTCAAAAAATTGAGGAGGG - Intergenic
938550882 2:132381368-132381390 AGGAGTCCAAAATTTCAGGAAGG - Intergenic
940370914 2:152899800-152899822 AGGGGTGTAGAATTTTATCAAGG - Intergenic
941435529 2:165466306-165466328 AGGAGTAGAGAATTTCAGGAAGG - Intergenic
942189233 2:173454648-173454670 AGGGGTGTAGAAATGGCGGAGGG - Intergenic
945442870 2:209901296-209901318 AGGGCTCTAGAATTTCAGAATGG - Intronic
948083244 2:235224975-235224997 AGTGGTCTAGAAATTGCGCATGG - Intergenic
1179828758 21:43983007-43983029 AGGGCTCTAGAAAGTGAGGTGGG - Exonic
1181848491 22:25732555-25732577 ATGGGTCTGTAATTTGAGAAGGG + Intergenic
949483490 3:4515417-4515439 AGGGGTCTGGGTTTGGAGGAGGG + Intronic
949968331 3:9379256-9379278 GGGGACCTAGAGTTTGAGGAAGG - Intronic
953263508 3:41363276-41363298 AAGGGTCAAGACTTTGAGGGAGG + Intronic
953404372 3:42653393-42653415 AGGGGTGTGGAATATCAGGATGG + Intergenic
955101120 3:55851045-55851067 TGGGGTCTGGATTTTGAGCATGG - Intronic
956632377 3:71329194-71329216 AGAGGTCTAGACTTTGTGAAAGG - Intronic
956632423 3:71329513-71329535 AGAGGTCTAGACTTTGTGGCCGG - Intronic
959560177 3:107770449-107770471 AGGGCTATAGAAGTTGAGAAAGG + Intronic
960816747 3:121681298-121681320 AGGGGTTAAGGATGTGAGGAAGG + Intronic
960962636 3:123083044-123083066 GGGGGTCTGGAAGATGAGGAAGG + Intronic
963005020 3:140718912-140718934 GTGGTTCAAGAATTTGAGGAAGG + Intergenic
963260954 3:143190343-143190365 ATGGGTCAAAAATTTGAGCAAGG + Intergenic
965502310 3:169471379-169471401 AGGTGTCTAGAATTTAAAGCAGG - Intronic
966119643 3:176507670-176507692 AAGGGTCTAGAATTCCATGAGGG + Intergenic
966988409 3:185203574-185203596 AGGGAGCTAGCATCTGAGGAAGG + Intronic
971651287 4:29278771-29278793 AGTGGTAAAGAATTTCAGGAAGG + Intergenic
972772523 4:42210748-42210770 AGGGGTGCAAAATTTAAGGAGGG + Intergenic
973588180 4:52413062-52413084 AGATGTCTAGCATTTGAGTAGGG - Intergenic
974125177 4:57687459-57687481 CTGGGTCTAGAATTTGAGCAGGG + Intergenic
976333982 4:83864411-83864433 TGGGGTCAAGACTTTGGGGATGG + Intergenic
978326337 4:107561332-107561354 AGGGGTCTAAAATTAGAGAAGGG - Intergenic
978596659 4:110384893-110384915 AGGGGACTGGAATTGGAGGTTGG + Intronic
981498484 4:145420528-145420550 AGGGGTCAAGAGTTTTAGGTAGG - Intergenic
981606799 4:146548209-146548231 AGGGGCATAGAGTTTGATGAAGG + Intergenic
982073589 4:151717281-151717303 AGGGGTGGAGGATTTGGGGAGGG - Intronic
985193633 4:187404609-187404631 AGGGGTGTTGAATTTCATGAAGG + Intergenic
986809429 5:11340097-11340119 AGAGGTCTGGAAATGGAGGAGGG - Intronic
992271333 5:75066574-75066596 AGGGCTCTAGATTTTCAGAATGG - Intergenic
994078415 5:95679576-95679598 TTGGGTCTAGTGTTTGAGGAGGG - Intronic
996966248 5:129309488-129309510 AGGGGGATGGATTTTGAGGAGGG + Intergenic
998292752 5:140930618-140930640 AGGTGTGTAGAAATTAAGGAAGG + Intronic
999958292 5:156726003-156726025 AGATGACTAGAATTTGAGAAAGG - Intronic
999985876 5:157004929-157004951 AGGGGTCAAGAATCTGGGCAGGG + Intergenic
1003268047 6:4583770-4583792 AGGCCTCTAGAAACTGAGGATGG - Intergenic
1005504172 6:26455726-26455748 AGGAATCTAGAATTTGAACAGGG + Intergenic
1005981286 6:30838988-30839010 GGTGGGCTAGAATTTGTGGACGG - Intergenic
1007228952 6:40334843-40334865 AGGGGGCTAGGCTTTGGGGAGGG - Intergenic
1007537090 6:42601807-42601829 ATGGGTCTAGAGCTTGAAGAAGG - Intronic
1007957762 6:45932872-45932894 AGGGCTCTAGGAGATGAGGAAGG + Intronic
1008367494 6:50699497-50699519 AGGGGGCTAGCATTCTAGGAGGG + Intergenic
1008816951 6:55579439-55579461 AGGGGTCTAAAATAAAAGGAAGG + Intergenic
1010977752 6:82335534-82335556 AGTGCTCTAGAATTAGATGAGGG - Intergenic
1011205030 6:84883203-84883225 AGGGGTCTAGAATATGCCAATGG - Intergenic
1012241575 6:96879057-96879079 CGTTGTCAAGAATTTGAGGAAGG - Intergenic
1013611542 6:111800463-111800485 AGGGATATTGAATATGAGGAAGG + Intronic
1015630159 6:135223797-135223819 AGGAGTCTAGAATTTCAGAGTGG - Intergenic
1018079589 6:160247447-160247469 AGGGATTTAGCATTTGAGGGAGG - Intronic
1019504594 7:1384349-1384371 AGGGGTGCAGATTCTGAGGACGG + Intergenic
1020978786 7:15041932-15041954 AGGGGGCTAAAATTTGAGTGTGG + Intergenic
1021336195 7:19405519-19405541 AGAGTTCTAGAATTTCAGGAAGG - Intergenic
1022356294 7:29617734-29617756 AGGGGAATTGAGTTTGAGGATGG - Intergenic
1022864172 7:34400050-34400072 AGGGATCCAGAATTTGGGCAGGG + Intergenic
1024880434 7:54079740-54079762 AGTAGTCTAGAATTTAAGGGAGG + Intergenic
1030458412 7:109801645-109801667 ATAGGTCTAGAAGTTAAGGAGGG + Intergenic
1032148732 7:129408855-129408877 AGGGGTATAGAGTTTTAAGAAGG + Intronic
1032622924 7:133556458-133556480 AGGGATGTAGGATTTGAAGATGG - Intronic
1034086533 7:148327593-148327615 AGGTGTCTGGAATTTGAAGTTGG - Intronic
1034615709 7:152414708-152414730 TGAGGTCTAGAATTTGAGATCGG - Intronic
1036612168 8:10359820-10359842 AGTGGTCTTGAGTTTGAGGGAGG + Intronic
1036686330 8:10914037-10914059 AGGGGTCTGGAATTTGCCCAAGG - Intronic
1037084944 8:14837034-14837056 AGGGCTTTAGAAGTTGAGGAGGG - Intronic
1037510619 8:19578165-19578187 AGGGGGATAGAATTTGATGATGG - Intronic
1038566534 8:28623576-28623598 TGGGGTCTAGACTTTCAGCATGG - Intronic
1038580728 8:28747198-28747220 AGGGGTCAGGAATCTGGGGAAGG - Intronic
1039689749 8:39851112-39851134 AGAAGTCCAGAATTTAAGGAAGG - Intergenic
1042682853 8:71405797-71405819 ATAGGTTTAAAATTTGAGGAAGG - Intronic
1044382583 8:91551787-91551809 AGTGGTCCACAGTTTGAGGAAGG - Intergenic
1046262741 8:111791148-111791170 ATGGGTTTAGATTTTGAAGATGG + Intergenic
1048389156 8:133944791-133944813 AGGGGCCTAGAATTAGAAGAGGG + Intergenic
1050196130 9:3086351-3086373 AGGGGTCTGGAATTTCATGAGGG - Intergenic
1052324976 9:27207988-27208010 AGGGGTGTAGAATCTTATGAAGG + Intronic
1053368963 9:37544466-37544488 AGAGGTCAACAATTTGATGAAGG - Intronic
1053516846 9:38737627-38737649 AGGAGGCTGGAATGTGAGGAAGG + Intergenic
1059133922 9:111784888-111784910 AGGTGACTAGAACATGAGGATGG - Intronic
1060327955 9:122635967-122635989 AGGGATATAGAATTTGAGTTTGG - Intergenic
1061682612 9:132250401-132250423 ATGGGCCTATAAGTTGAGGACGG + Intergenic
1187217389 X:17290327-17290349 AAGGGTCAGGAATTTGAGGTTGG + Intergenic
1187408986 X:19031280-19031302 AGGGGTCAAAAATTTTAGGGAGG - Intronic
1190626653 X:52343802-52343824 ATGGGTCTAGTAGTTGAGGCAGG + Intergenic
1190701358 X:52992027-52992049 ATGGGTCTAGTAGTTGAGGCAGG - Intronic
1191184484 X:57594058-57594080 AGGTATCCAGACTTTGAGGAGGG - Exonic
1191212905 X:57908401-57908423 AGGTATCCAGACTTTGAGGAGGG + Exonic
1191975116 X:66863096-66863118 AGGGGCATAGAATTTGAGATGGG - Intergenic
1191982193 X:66938508-66938530 GGGGGTCAAGAATTTGGGCAGGG + Intergenic
1191999419 X:67132641-67132663 AGGTCTCTAGATTTTTAGGAAGG + Intergenic
1194958709 X:100211008-100211030 AGGGGTGTTGAATTTGTTGAAGG + Intergenic
1197117985 X:122855693-122855715 AGGGGTGTAGAATTGATGGAAGG + Intergenic
1200185510 X:154180596-154180618 TGGGGTGTAGAATTTTAGGCTGG - Intergenic
1200191164 X:154217735-154217757 TGGGGTGTAGAATTTTAGGCTGG - Intergenic
1200196919 X:154255539-154255561 TGGGGTGTAGAATTTTAGGCTGG - Intergenic
1200202569 X:154292656-154292678 TGGGGTGTAGAATTTTAGGCTGG - Intronic