ID: 1084220969

View in Genome Browser
Species Human (GRCh38)
Location 11:67678871-67678893
Sequence TGCAATGATCTGGATGAGAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1299
Summary {0: 5, 1: 42, 2: 305, 3: 362, 4: 585}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084220969 Original CRISPR TGCAATGATCTGGATGAGAT TGG Intronic
901643969 1:10706823-10706845 TCTCATCATCTGGATGAGATGGG - Intronic
902146594 1:14406386-14406408 TGCAGCAACCTGGATGAGATTGG + Intergenic
902270140 1:15298224-15298246 TGCAATGACCTGGATGAGACTGG + Intronic
903525452 1:23990164-23990186 CACAGTGACCTGGATGAGATTGG - Intergenic
903689171 1:25158544-25158566 TGCAGCAACCTGGATGAGATTGG - Intergenic
904288000 1:29465874-29465896 TGGAATTATCTGGATGATAAAGG - Intergenic
905572660 1:39018043-39018065 TGCAGTGACCTGGATGAGATTGG - Intergenic
906053483 1:42894573-42894595 TGCAGTGACGTGGATGAGATTGG - Intergenic
906131379 1:43460419-43460441 TGCAGTGACCTGGATGAGACTGG + Intergenic
906563243 1:46776054-46776076 TGCAATGACCTGGATGAGATTGG - Intronic
906816033 1:48880261-48880283 CGCAGTGACCTGGATAAGATTGG - Intronic
907349676 1:53817332-53817354 TGCAGTGACCTGGATGAGACTGG + Intronic
907662200 1:56403696-56403718 TGCAGCAACCTGGATGAGATTGG + Intergenic
907758144 1:57331000-57331022 TGGTATGAACTGGAAGAGATAGG - Intronic
907977401 1:59445225-59445247 AGCAAGGATCTTGCTGAGATGGG + Intronic
908045748 1:60166708-60166730 TACCATCATATGGATGAGATGGG - Intergenic
908174612 1:61542228-61542250 TTCAGTGACCTGAATGAGATTGG - Intergenic
908614209 1:65899727-65899749 TGCAGTGACCTGGACGACATTGG + Intronic
908862386 1:68504353-68504375 TGCAACGACCTGGATGAAATTGG + Intergenic
909339151 1:74512092-74512114 TGAAAAGATCTGGATGGGACTGG + Intronic
909639318 1:77854184-77854206 TGCAGTGACCTGGATGAGACTGG - Intronic
909667289 1:78149229-78149251 TACAGTGACCTGGATGAGATTGG + Intergenic
909721181 1:78771477-78771499 TGCACTGACCTGGATGAAATTGG - Intergenic
909947839 1:81683588-81683610 TGCAGTGACCTGGATGAGATTGG - Intronic
909960815 1:81839675-81839697 TGCAGTGACCTGGATGAGACTGG - Intronic
910016238 1:82528190-82528212 TGCAGCAACCTGGATGAGATTGG + Intergenic
910016241 1:82528218-82528240 TGCAGCAACCTGGATGAGATTGG - Intergenic
910048850 1:82953150-82953172 TGCAGTGACCTGGATGAGACTGG - Intergenic
910078125 1:83304711-83304733 TACAGTGACCTGGATGAGACAGG + Intergenic
910153226 1:84180258-84180280 TGCAGTGACCTAGATGAGATTGG + Intronic
910544065 1:88394465-88394487 TGCAGTGACCTGGATGAGGTTGG + Intergenic
910659227 1:89652866-89652888 GGCAAAGATCTGGAGGAGGTGGG + Intronic
910734107 1:90433311-90433333 TGCAGCGATCTGGTTGAGACTGG + Intergenic
910738501 1:90489328-90489350 TGCAGGGACCTGGATGAGACTGG - Intergenic
910949180 1:92627307-92627329 TGCAGTGTCCTGGATGAGATTGG - Intronic
911050837 1:93669783-93669805 TGCAGTGACCTGGATGAGATTGG + Intronic
911847359 1:102771477-102771499 TGCAGCGACCTGGATTAGATTGG + Intergenic
912115528 1:106402306-106402328 TGCAGTGACCTGGATGAAATTGG + Intergenic
913143695 1:115967787-115967809 TGTAGTGACCTGGATGAGATTGG + Intergenic
913152498 1:116058810-116058832 TGCAGTGACCTGGATGAGATTGG + Intronic
913244542 1:116860108-116860130 AGCAATAATCTGAATGAGGTAGG - Intergenic
913313001 1:117521876-117521898 TGCAGTGACCTGGATGAGATTGG + Intronic
913339275 1:117741644-117741666 TGCAGCGACCTGGATGAGATTGG - Intergenic
913405110 1:118482270-118482292 TGCAGTGACCTGAATGAGATTGG - Intergenic
913587587 1:120290767-120290789 CACAATGATCTGGATGAGATTGG - Intergenic
913620598 1:120607602-120607624 CACAATGATCTGGATGAGATTGG + Intergenic
914454896 1:147826790-147826812 TGCAGCGACCTGGATGAGATCGG - Intergenic
914569607 1:148902651-148902673 CACAATGATCTGGATGAGATTGG - Intronic
914603221 1:149227605-149227627 CACAATGATCTGGATGAGATTGG + Intergenic
914733651 1:150395299-150395321 AGCAGCGACCTGGATGAGATTGG - Intronic
914968438 1:152283301-152283323 TGCAGTGACCTGGTTGAGACTGG + Intergenic
915643443 1:157248537-157248559 TGCAGTGACCTGGATGAGATTGG + Intergenic
915658891 1:157384512-157384534 TGGAATGATTTGAATCAGATAGG + Intergenic
916264025 1:162871696-162871718 TGCAGTGAGCTGGATGAGACTGG + Intergenic
916559190 1:165918310-165918332 TGCAATGATATTGAATAGATGGG + Intergenic
916581101 1:166109965-166109987 TGCAGTGACCTGGATGAGACTGG + Intronic
916671621 1:167027252-167027274 TGCAGTGACCTGGATGAGATTGG + Intergenic
917053723 1:170955107-170955129 TGCAGTGACCTGGTTGAGACTGG - Intronic
917057514 1:170999459-170999481 TGCAGTGACCTGGATGAGATTGG - Intronic
917471102 1:175326606-175326628 TTCCAGGATCTGGAAGAGATGGG - Intronic
917577682 1:176341273-176341295 TACAATGACCTGGATGAGATTGG + Intergenic
917887419 1:179400272-179400294 TGCAGTGACCTGGATGAGATTGG + Intronic
917897987 1:179511188-179511210 TTCAGTGACCTGGATGAGACTGG - Intronic
918873938 1:190013798-190013820 TGCAGTGACCTGGATGAGATTGG + Intergenic
919072946 1:192778649-192778671 TGCAGCGACCTGGGTGAGATTGG - Intergenic
919405432 1:197175843-197175865 TGAGATGATCTCAATGAGATAGG - Intronic
919548961 1:198960818-198960840 TGCAGTGACCTGGATAAGATTGG - Intergenic
919598649 1:199595576-199595598 TGCAGTGACTTGGGTGAGATTGG + Intergenic
919850552 1:201669279-201669301 TGCAAAGATTTGGATTAGAGAGG + Intronic
920726475 1:208439995-208440017 TGCAGTGACCTGGATGAGATTGG - Intergenic
921409492 1:214819896-214819918 TGCAATGACCTGGATGAGATTGG - Intergenic
921518640 1:216130454-216130476 CACAGTGACCTGGATGAGATTGG - Intronic
921835002 1:219769572-219769594 TGCAGTGACCTGGATGAGATTGG + Intronic
922545001 1:226450086-226450108 TCAAATGATCTGGATGATAACGG - Intergenic
922672891 1:227526793-227526815 TGAAGTGAACTGGATGAAATTGG - Intergenic
922794173 1:228331340-228331362 TGCAGTGACCTGGATGAGACTGG - Intronic
923302146 1:232651212-232651234 TGCACTGGTCTGGAAGTGATAGG - Intergenic
923648712 1:235851249-235851271 TGCAGTGACCTGGATGAGACTGG + Intronic
923662233 1:235968340-235968362 CACAGTGATCTGGATGAGATTGG + Intergenic
923808271 1:237284402-237284424 TGCAGTGACCTGGATGAGACTGG - Intronic
923875792 1:238045629-238045651 TGCAATGACCTGGATGAGATTGG + Intergenic
923996787 1:239504758-239504780 TGTGGTGACCTGGATGAGATTGG + Intronic
924320937 1:242849460-242849482 TGCAGTGACCTGGATGAGACTGG - Intergenic
924470456 1:244338513-244338535 TGCAGCCATGTGGATGAGATTGG - Intergenic
1063007557 10:1988018-1988040 TGCAATGATGGTGATGACATCGG + Intergenic
1063081266 10:2769996-2770018 TGCAGCAACCTGGATGAGATTGG + Intergenic
1063507574 10:6614784-6614806 TGCAGTGACCCAGATGAGATTGG - Intergenic
1063542472 10:6948188-6948210 TGCAGTGACCTGGATAAGACTGG + Intergenic
1063884135 10:10560862-10560884 TTCAGTGACCTGGATGAGATTGG + Intergenic
1064077683 10:12282802-12282824 TGCAGTGACCTGGATGAGATTGG - Intergenic
1064177736 10:13089965-13089987 TGCAGCAACCTGGATGAGATTGG - Intronic
1064282795 10:13966920-13966942 CTCAGCGATCTGGATGAGATTGG + Intronic
1064521444 10:16207062-16207084 TGCAGTGACCTGGATGAGATTGG - Intergenic
1064907652 10:20364750-20364772 TGCAGTGATCTGGATGAGATTGG - Intergenic
1065080019 10:22119745-22119767 TGCAAGGACATGGATGATATTGG - Intergenic
1065628800 10:27657158-27657180 TGCAGTGACCTGGATGAGATTGG - Intergenic
1066145041 10:32548707-32548729 TGCAGTGACCTGGATGAGATTGG - Intronic
1066502227 10:36005492-36005514 GGCAATGACCTGGATGAGATTGG + Intergenic
1066658503 10:37717345-37717367 CGCAGTGACCTGGATGAGATTGG - Intergenic
1066767140 10:38813063-38813085 TGGAATGGACTGGATTAGATCGG - Intergenic
1067043004 10:42967029-42967051 TGCAGTGACCTGAATGAGATTGG - Intergenic
1067043013 10:42967284-42967306 TGCAGTGACCTGGATGAGATTGG + Intergenic
1068073485 10:52224741-52224763 TGTAGTAACCTGGATGAGATTGG - Intronic
1068077456 10:52274419-52274441 TGCAGGGAACTGGATGAAATTGG - Intronic
1068103490 10:52584912-52584934 TGCAATAATCAGGATGAAACTGG - Intergenic
1068760211 10:60698974-60698996 CACAGTGACCTGGATGAGATTGG + Intronic
1069085181 10:64130439-64130461 AGCAATGATCTGAAGGACATGGG + Intergenic
1069326495 10:67237227-67237249 TGCAGCGACCTGGATGAGATTGG + Intronic
1069343176 10:67437167-67437189 TGCAGCGACCTGGATGAGATTGG + Intronic
1070382596 10:75894323-75894345 TGCAGAGACCTGGATGAGATTGG - Intronic
1070433546 10:76364994-76365016 TGCAGTGACCTGGATGAGATTGG - Intronic
1070484716 10:76919003-76919025 TGCAGTGACCTGGATGAGACTGG + Intronic
1070555739 10:77526504-77526526 TGCAAATATCTGGATGCTATTGG - Intronic
1070655752 10:78269947-78269969 TGGAGTGATGTGGATGGGATGGG - Intergenic
1071020813 10:81053187-81053209 TGCAGCAACCTGGATGAGATTGG + Intergenic
1071071409 10:81697993-81698015 TGCAATCATTTGGAGGAGAAGGG - Intergenic
1071405347 10:85324633-85324655 TTCAGTGGCCTGGATGAGATTGG - Intergenic
1071485139 10:86096043-86096065 TGCAGTGACCTGGATGAGACTGG + Intronic
1071744960 10:88406894-88406916 TGCAGTGACCTGGATGAGATTGG + Intronic
1072815423 10:98503709-98503731 TGCAGTGACCTGGTTGAGACTGG + Intronic
1072928494 10:99639180-99639202 TGCATCCACCTGGATGAGATTGG + Intergenic
1073585999 10:104710674-104710696 TTCATTGCTCTGGATGAGGTGGG - Intronic
1073847289 10:107571682-107571704 TGTAGCGACCTGGATGAGATTGG + Intergenic
1073897656 10:108181835-108181857 TGCAATGACATGGATGAAACTGG - Intergenic
1074472481 10:113740188-113740210 TGCAGTGTCCTGGATTAGATTGG + Intergenic
1074731436 10:116380780-116380802 CACAGTGACCTGGATGAGATTGG + Intergenic
1074885070 10:117686837-117686859 TTCAGTGATCTTGATGAGAAAGG - Intergenic
1074985332 10:118653347-118653369 TGCAGTGACCTGGATGAGACTGG - Intergenic
1075066994 10:119295650-119295672 TGCAGCGACCTGGATGAGATTGG + Intronic
1075358718 10:121809751-121809773 TGCAATGAGGTGGAAGAGACTGG + Intronic
1075660136 10:124187779-124187801 TGCAGTGACCTGGATGAGACTGG - Intergenic
1075717391 10:124564856-124564878 TGCAATGATCTGGATGAGATTGG + Intronic
1075889206 10:125931011-125931033 TGCAGTGACCTGGATGAGATTGG - Intronic
1075947263 10:126445874-126445896 TGCAGTGACCTGGATGAAATTGG + Intronic
1075982269 10:126750218-126750240 TGCAGTGACCTGGATGAGATTGG - Intergenic
1076214126 10:128679272-128679294 TGCCATGATGTGGAAGAGACAGG + Intergenic
1076298631 10:129406765-129406787 TGCAGCAACCTGGATGAGATTGG + Intergenic
1077166734 11:1144987-1145009 TGCAGTGACCTGGATGAGATTGG - Intergenic
1077876286 11:6310089-6310111 TGTAGCGACCTGGATGAGATTGG - Intergenic
1077987652 11:7370194-7370216 TGCAGAGACCTGGATGAGACTGG - Intronic
1078289120 11:9989139-9989161 TGCAGTAACCTGGATGAGATAGG + Intronic
1078592932 11:12661213-12661235 TGCAGCAACCTGGATGAGATTGG + Intergenic
1078707111 11:13755208-13755230 TGCAGAGACCTGGATCAGATTGG + Intergenic
1078745042 11:14105274-14105296 TGGAGTGCTCTGGAAGAGATAGG - Intronic
1078791830 11:14551261-14551283 TGCCATTATCAGGATGTGATGGG + Intronic
1078997001 11:16712012-16712034 TGCAGTGACCTGGCTGAGATTGG - Intronic
1079151675 11:17905521-17905543 TGCAGTTATCTGGCAGAGATTGG + Intronic
1079273201 11:19007876-19007898 TGCAGTGACCTGGATGAGATTGG - Intergenic
1079474136 11:20810514-20810536 TGCAGTGATCTGGATGAGATTGG - Intronic
1079662487 11:23057345-23057367 TGCTATGACATGGATGAGATTGG + Intergenic
1079791195 11:24741709-24741731 TGCAGTGACCTGGATGAGATTGG - Intronic
1079818900 11:25098982-25099004 TACAATGAAATGGATGAGTTAGG + Intergenic
1079951716 11:26813813-26813835 TGCAGTGACCTGGATGAGATTGG - Intergenic
1080243016 11:30148750-30148772 AGCTAAGATGTGGATGAGATTGG - Intergenic
1080324589 11:31055698-31055720 TGCAGTGACCTGGGTGAGATTGG + Intronic
1080402776 11:31952881-31952903 TGCAGTGACCTGGATGAGATTGG + Intronic
1081106272 11:39073467-39073489 TGAAGTGACCTGTATGAGATTGG + Intergenic
1081195731 11:40158109-40158131 TGCAGTGACCTGGATGAGATTGG + Intronic
1081682863 11:45020965-45020987 TGCCATCATTTTGATGAGATTGG - Intergenic
1082210262 11:49492067-49492089 TGCAGCAATCTGGATGAGACTGG - Intergenic
1082638916 11:55630599-55630621 TGCTGTGACCTGGATGAGACTGG + Intergenic
1082917241 11:58450552-58450574 TGCAGAGACTTGGATGAGATTGG + Intergenic
1083017164 11:59466718-59466740 TGCAGTGACCTGGATGAGATTGG + Intergenic
1083064111 11:59905664-59905686 TGCAGAGACCTGGATGAGACTGG - Intergenic
1083691352 11:64410765-64410787 TGGAAGGATCTGGATTGGATAGG - Intergenic
1084220969 11:67678871-67678893 TGCAATGATCTGGATGAGATTGG + Intronic
1084332614 11:68438700-68438722 TGGAATGATCTGGAGGAGGCAGG + Intronic
1084991769 11:72932239-72932261 TGCAATAATCTGGATGAGACAGG - Intronic
1084993406 11:72951123-72951145 TGCAATGGTTTGGAGTAGATAGG - Intronic
1085748388 11:79135882-79135904 TGCAGAAATCTGGATGAGATTGG + Intronic
1086513392 11:87585153-87585175 CGCAGCGACCTGGATGAGATTGG - Intergenic
1086836096 11:91625035-91625057 GGCAGTGACCTGGATGAGATTGG + Intergenic
1087105954 11:94407026-94407048 TGCAGTGACCTGGATGAGATTGG - Intergenic
1087619636 11:100527020-100527042 TGCAGTGACCTGCATGAGGTTGG + Intergenic
1087649198 11:100845195-100845217 GGCAGCAATCTGGATGAGATTGG + Intronic
1087865739 11:103224544-103224566 TGCAACAATCTGGATGGAATTGG - Intronic
1088078399 11:105879290-105879312 TGCATTGATCTCGATGGGAGTGG + Intronic
1088137441 11:106575047-106575069 TGCAGTGACCTGGATGAAACTGG - Intergenic
1088180096 11:107099576-107099598 TGCAATGACCTGGATGAGATTGG + Intergenic
1088206906 11:107402948-107402970 TGTGATGACCTGGATGAGACTGG + Intronic
1088376996 11:109152043-109152065 TGCAGTGATCTGGATGAGATTGG - Intergenic
1088651737 11:111963322-111963344 TGCAACGATCAGGAGGAGGTGGG - Intronic
1088653938 11:111981162-111981184 TGCAATTATTTGTATAAGATAGG - Intronic
1088809363 11:113380282-113380304 TTCATGGACCTGGATGAGATTGG - Intronic
1089107856 11:116029456-116029478 TGCAGTGACCTGGATGAGATTGG + Intergenic
1089171377 11:116513936-116513958 GGCAATGATCCGGCTGAGGTTGG + Intergenic
1089825763 11:121275300-121275322 TGCAGTGACCTGGATGAGACTGG - Intergenic
1089837930 11:121387964-121387986 CGCAGTGACCTGGATGACATTGG + Intergenic
1089900531 11:121978440-121978462 TCCAGTGACCTGGATGAGATTGG + Intergenic
1090142719 11:124282104-124282126 TGCAGTGACTTGGATGAGATTGG + Intergenic
1090537604 11:127661446-127661468 TGCAGTGACCTGGATGAGACTGG - Intergenic
1090559030 11:127909825-127909847 TGCAGCAACCTGGATGAGATTGG - Intergenic
1090757819 11:129809555-129809577 TGCAGTGACCTGGATGAGACTGG + Intergenic
1090894537 11:130958885-130958907 TGCAGTGACCTGGATGAGATTGG - Intergenic
1091167790 11:133495200-133495222 TGCAGTGACCTGAATGAGACTGG - Intronic
1091209979 11:133848691-133848713 TGCAGTGAACTGGATGAGATTGG - Intergenic
1091618222 12:2066181-2066203 TGCTGTGATCTGGATGGGAAGGG + Intronic
1092303367 12:7274051-7274073 TGCAGCAACCTGGATGAGATAGG - Intergenic
1092436803 12:8454536-8454558 TGCACTGACCTGGATGAGATTGG + Intergenic
1092622473 12:10287282-10287304 TGCAAGGGTATGTATGAGATTGG + Intergenic
1092628808 12:10357245-10357267 TGCAGTGACCTGGATGAGATTGG - Intergenic
1093001559 12:14002296-14002318 CACAGTGACCTGGATGAGATTGG - Intergenic
1093118096 12:15235376-15235398 TGCAGTGATCTGGGTGAAATTGG - Intronic
1093172824 12:15878351-15878373 TGCAGTGACCTGGATGAGATCGG + Intronic
1093488297 12:19676799-19676821 TGCAGTGACCTGGTTGAGACTGG - Intronic
1093497452 12:19774705-19774727 TGTAGTGACCTGGATGAGATTGG - Intergenic
1093721056 12:22442773-22442795 TGCAGTGACCTGGATGAGATTGG + Intergenic
1094228358 12:28073227-28073249 TGCAATGACATGGATGAGTCTGG + Intergenic
1094724360 12:33098076-33098098 TTCAGTGATCTGAATGAGACTGG + Intergenic
1094729443 12:33157822-33157844 TGCAATGTTTTGGATGGGAGAGG + Intergenic
1094785334 12:33841987-33842009 TGCAATGACTTGGATGAAACTGG - Intergenic
1094810316 12:34130618-34130640 TGCAGTGACCTGGATGAGATTGG + Intergenic
1095247594 12:39941007-39941029 TGCACTGACCTAGATGAGATTGG - Intronic
1095421184 12:42025525-42025547 TGCACTGACATGGATGTGATAGG + Intergenic
1095459562 12:42428457-42428479 TGGAATGAGCGGGGTGAGATTGG + Intronic
1095531571 12:43192580-43192602 TCTAATGACCTGGATGAGATTGG - Intergenic
1095665399 12:44791273-44791295 TGCAGTGACCTGGATGAGATTGG + Intronic
1095687899 12:45056348-45056370 TGCAGCAACCTGGATGAGATTGG + Intergenic
1095893453 12:47256889-47256911 TGCAGTGACCTGGATGAGAATGG + Intergenic
1095913334 12:47451065-47451087 TGCAGTGATCTAGATGACATTGG + Intergenic
1095932553 12:47642550-47642572 TGCAGTAACCTGGATGAGACTGG + Intergenic
1096348494 12:50873033-50873055 CGCAGCGACCTGGATGAGATTGG + Intronic
1096437384 12:51605391-51605413 TGCAATGACCTAGATGAGATTGG - Intronic
1096888123 12:54738221-54738243 CACAGTGACCTGGATGAGATTGG - Intergenic
1096961984 12:55588952-55588974 TGCAGCGACCTGGATGAGACTGG + Intergenic
1096963918 12:55609115-55609137 TGCAGCAACCTGGATGAGATTGG - Intergenic
1097200731 12:57276470-57276492 TGCAGTGACCTGGATGAGATTGG + Intronic
1097248026 12:57617299-57617321 TGAAGTGATATGGAAGAGATCGG + Intronic
1097295990 12:57963615-57963637 TGCAGTGACCTGGATGAGACTGG + Intergenic
1097342219 12:58451914-58451936 TGCAGAGACCTGGATGAGATTGG - Intergenic
1097385384 12:58944560-58944582 TGCAGTGACCTGGATGAGACTGG - Intergenic
1097639013 12:62156648-62156670 TGCAGCGACCTGGATGAGATTGG + Intronic
1097760946 12:63463389-63463411 TGCAGTAACCTGGATGAGACTGG + Intergenic
1097844140 12:64349676-64349698 CACAGTGACCTGGATGAGATTGG + Intronic
1098982207 12:76968846-76968868 TGCAGTGACCTGGATGATATTGG - Intergenic
1099014733 12:77330852-77330874 AGCAGTGACCTGGATGAGATTGG + Intergenic
1099101670 12:78449008-78449030 TGAAATGAGCTAGATGAGTTAGG + Intergenic
1099393222 12:82105391-82105413 TGCAGCAATCTGGATGAGATTGG + Intergenic
1099441483 12:82705034-82705056 CGCAGTGACCTGGATGAGATTGG + Intronic
1099516932 12:83608543-83608565 TTCAGTGACCTGGATGAGATTGG + Intergenic
1099753934 12:86815704-86815726 TGCAGTGACCTGGATGGGATTGG + Intronic
1099776938 12:87145895-87145917 TGCAGTGACCTGGATGAGATTGG - Intergenic
1099809038 12:87557256-87557278 TGCAATTATTTGGAGGAGAGAGG - Intergenic
1100290451 12:93209096-93209118 TGCAGTGACCTGGATGAGATTGG - Intergenic
1100822065 12:98440941-98440963 TGCAGTCACCTGGATGAGACTGG + Intergenic
1101525877 12:105529898-105529920 TGCAATGATCTTGGAGAGTTGGG - Intergenic
1101576013 12:105997132-105997154 TGCAGTGACCTGGATGAGATTGG + Intergenic
1101634742 12:106529659-106529681 TGCAGTGGCCTGGATGAGATTGG - Intronic
1101984611 12:109435969-109435991 TGCAAGGCTCTTGATGAGCTTGG + Intronic
1102417063 12:112773029-112773051 TGCAGTGACCTGGATGAGATTGG - Intronic
1102795813 12:115687964-115687986 TGCAATGATCTGGATATGAAAGG - Intergenic
1102916191 12:116754263-116754285 TGCAGTGACCTGGATGAGATTGG - Intronic
1103111833 12:118286913-118286935 TGCAGTGACCTGGATGAGACTGG + Intronic
1103195534 12:119040493-119040515 TGCAATGACCTGGATGAGACTGG - Intronic
1104210884 12:126687481-126687503 TGCAGCAACCTGGATGAGATTGG + Intergenic
1104333032 12:127865719-127865741 TGCAGTGACCTGGATGAGACTGG + Intergenic
1104498692 12:129264761-129264783 TGCAGTGAGCTGGATGAGACTGG + Intronic
1104504019 12:129313462-129313484 TTCAGTGACCTGGATGAGATTGG - Intronic
1105319863 13:19308614-19308636 TGCAATGACCTGGATGAGACTGG - Intergenic
1105491005 13:20888220-20888242 TGAAATGATATGGAAGAGAGAGG + Intronic
1105761348 13:23517594-23517616 AGCAAGGACCTGGATGAGACCGG + Intergenic
1105908767 13:24840597-24840619 TGCAGTGACTTGGATGAGATTGG + Intronic
1105985753 13:25565005-25565027 TGCAGTGACCTGGATGAGATTGG - Intronic
1105988595 13:25594712-25594734 CACAGTGACCTGGATGAGATTGG - Intronic
1106146131 13:27051448-27051470 TGCAGTGACCTGGATGAGATTGG - Intergenic
1106213465 13:27672954-27672976 TGCAGTGACCTGGATGAGATTGG + Intergenic
1106627209 13:31433137-31433159 TGCAATGATCTGGATTATACAGG - Intergenic
1106691395 13:32121067-32121089 TGCAGTGACCTGGATGAGATTGG - Intronic
1106699271 13:32211575-32211597 TGCAATGTCCTGGCTGGGATCGG - Intronic
1106921240 13:34565805-34565827 TGCAGTGACCTGGATGAGATTGG + Intergenic
1106937695 13:34741193-34741215 TGCATTTACCTGGATGAGATTGG - Intergenic
1107110017 13:36687094-36687116 GGCTAATATCTGGATGAGATGGG + Intronic
1107185094 13:37508528-37508550 TGCAGGGACCTGGATGAGATTGG + Intergenic
1107554407 13:41504880-41504902 TGCAGTGACCTGGATGGGATTGG + Intergenic
1107665952 13:42690788-42690810 TGCAGTGACCTGGATGAAATTGG - Intergenic
1107705703 13:43101729-43101751 TGCAACTATCTGGATGGAATTGG - Intronic
1107783796 13:43933986-43934008 GGAAATGATCTGTATGAGAGAGG - Intergenic
1107803914 13:44136405-44136427 TGTAAAGATGTAGATGAGATTGG - Intergenic
1108251078 13:48568712-48568734 TGCAATTATGATGATGAGATGGG + Intergenic
1108267358 13:48725631-48725653 TGCAGTGACCTGGATGAGATTGG + Intergenic
1108817332 13:54307846-54307868 TGCAGTGACCTGGATGAGATTGG + Intergenic
1108826029 13:54413670-54413692 TGCAGTCAACTGGATGAGATTGG + Intergenic
1108996764 13:56744028-56744050 TGCAGTGGCCTGGATGAGATTGG - Intergenic
1109097117 13:58133160-58133182 TGCAATCATTTGGAGGAGAAAGG + Intergenic
1109125848 13:58516183-58516205 TTCAGTGACCTGGATGAGACTGG + Intergenic
1109213135 13:59557852-59557874 TGCAGTGACCTGGATGAGATTGG - Intergenic
1109467459 13:62755734-62755756 TGCAATGACCTGGATGAGACTGG + Intergenic
1109503448 13:63268090-63268112 TGCTGTGACATGGATGAGATTGG - Intergenic
1109507914 13:63331165-63331187 TGCAACAACCTGGATGAAATTGG - Intergenic
1109927464 13:69163165-69163187 TGCAATGACATGGATGAGACTGG - Intergenic
1110205035 13:72902081-72902103 TGCAGTGACCTAAATGAGATTGG + Intronic
1110469958 13:75848360-75848382 TGCAGCAACCTGGATGAGATTGG - Intronic
1110538015 13:76674871-76674893 TACAATGACCTGGATGAGACTGG + Intergenic
1110562122 13:76920507-76920529 TGCAGTGACCTGGATGAGATTGG + Intergenic
1110628038 13:77673827-77673849 TGCAGTGACCTGGATGAGATTGG + Intergenic
1110881998 13:80583574-80583596 TGCAATGACCTGGATGAGATTGG + Intergenic
1111330093 13:86754641-86754663 TGCAGTGACCTGGATGAGATTGG + Intergenic
1111755011 13:92382061-92382083 TGCAGTGACCTGGATGAGATTGG + Intronic
1111988895 13:95095385-95095407 TGCAGTGACCTGGATGAGACTGG + Intronic
1111993770 13:95142275-95142297 TGCAGTGACCTGGATGAGACTGG + Intronic
1112034974 13:95488660-95488682 TGCAGTGACCTGGATAAGACTGG - Intronic
1112738603 13:102449268-102449290 TGCAGTGACCTGGATGAGACTGG + Intergenic
1113182772 13:107650428-107650450 TGCAGTGACCTGGATGAGACTGG + Intronic
1113194405 13:107785396-107785418 TGCCTCGACCTGGATGAGATTGG + Intronic
1113330588 13:109323196-109323218 TGCAGCGACCTGGATGAGATTGG + Intergenic
1113386644 13:109854909-109854931 TGCAGTGACCTGGATGAGATTGG + Intergenic
1114691695 14:24588364-24588386 CACAGTGACCTGGATGAGATTGG - Intergenic
1114952356 14:27771259-27771281 TGCAGCAATCTGGATGAGATTGG + Intergenic
1114961180 14:27891972-27891994 TGTAGCGACCTGGATGAGATTGG + Intergenic
1115526708 14:34287700-34287722 TGCAGTGACCTGGATAAGATTGG - Intronic
1115835150 14:37393995-37394017 TGCAGCAACCTGGATGAGATTGG - Intronic
1115959151 14:38815527-38815549 TTGAGTGACCTGGATGAGATTGG + Intergenic
1115970338 14:38938589-38938611 TGCAGAAACCTGGATGAGATTGG + Intergenic
1116117563 14:40676083-40676105 TGCAGTGACCTGGATGAGATTGG - Intergenic
1116223811 14:42121885-42121907 TGCAGTGACCTGGATAAGATTGG + Intergenic
1116732466 14:48641524-48641546 TGCACTAACCTGGATGAGTTTGG + Intergenic
1117113235 14:52481046-52481068 TGCAGTGACCAGGATGAGACTGG + Intronic
1117254168 14:53961641-53961663 AGGAATGATCAGGATGGGATTGG + Intergenic
1117473196 14:56067510-56067532 TGCAATAATCTAGGTGAGATGGG + Intergenic
1117509638 14:56437366-56437388 TGCAGTGACTTGGTTGAGATTGG - Intergenic
1117845662 14:59908744-59908766 TGCAGTGACCTGGATGAGATTGG - Intergenic
1118061985 14:62149652-62149674 TGCAGTGACCTGGAGGAGATTGG + Intergenic
1118162787 14:63307715-63307737 TGCAGTGACCTAGATGAGATTGG + Intergenic
1118197110 14:63637649-63637671 TGCCATGACCTGGATGAGACTGG + Intronic
1119098942 14:71861832-71861854 TGCAGCGACCTGGATGAGATTGG + Intergenic
1119645452 14:76344875-76344897 TGCAGTGACCTGGATGAGATTGG - Intronic
1119753253 14:77096126-77096148 TGCAGCAACCTGGATGAGATTGG - Intergenic
1119947242 14:78707849-78707871 TGCAGTGACCTGGATAAGACTGG - Intronic
1119991475 14:79202675-79202697 TGAAGTGACCTGGATGAGTTTGG - Intronic
1120058529 14:79954128-79954150 TCCAATGGTCTGGATGAGGAAGG + Intergenic
1120161486 14:81150079-81150101 TGCAGTAAGCTGGATGAAATTGG - Intergenic
1120161713 14:81152814-81152836 TGCCATGGTCTGGATGAAAGAGG + Intergenic
1120397275 14:83984523-83984545 TGCAATGGCCTGAATGAGATTGG + Intergenic
1120478061 14:85013770-85013792 TGCAGTGACCTGGATGAGATTGG + Intergenic
1120489928 14:85164656-85164678 TGCAGTGACCTGGATGAGACTGG + Intergenic
1120545295 14:85803951-85803973 TGCTGTGACCTGGATGAGATTGG - Intergenic
1121460457 14:94072297-94072319 TGCAGTGACCTGGATGAGACTGG + Intronic
1121516104 14:94550973-94550995 TGCAGCGACCTGGATGAGACTGG - Intergenic
1121714593 14:96064521-96064543 TGCAGTGACCTGGATGAGATTGG + Intronic
1122025060 14:98869722-98869744 CACAGTGACCTGGATGAGATTGG + Intergenic
1122706220 14:103623768-103623790 TGAAATTATCTGGAGGACATAGG + Intronic
1123799620 15:23806357-23806379 TGCAATGACCTGGATGAGATTGG - Intergenic
1124381198 15:29168018-29168040 TGCAGTGACCTGGATAAGATTGG + Intronic
1124387187 15:29219710-29219732 TGCAGTGACCTGGATGAGATTGG + Intronic
1124557603 15:30741699-30741721 TGCAGTGACCTGGATGAGACTGG + Intronic
1124673642 15:31663968-31663990 TGCAGTGACCTGGATGAGACTGG - Intronic
1124683052 15:31753595-31753617 TGCAGCAACCTGGATGAGATTGG - Intronic
1125213593 15:37243614-37243636 TGCAGCAACCTGGATGAGATTGG + Intergenic
1125260333 15:37816836-37816858 AGCAATGACATGGATGAGACTGG + Intergenic
1125272986 15:37960328-37960350 TGCAGCAACCTGGATGAGATTGG - Intronic
1125294709 15:38190252-38190274 TGGAATGATCTGGCTAAGAGGGG - Intergenic
1125356801 15:38824945-38824967 GACAATGACCTGGATGAGTTTGG + Intergenic
1125377491 15:39046447-39046469 TGCAATGATCTGGATGAGACTGG + Intergenic
1125412387 15:39418780-39418802 TGCAGTGACCTGGATGAGACTGG - Intergenic
1125438351 15:39672863-39672885 TGGAATCAGATGGATGAGATGGG + Intronic
1125689333 15:41583943-41583965 TGCAATACTCTGGGTGAGAGAGG - Intergenic
1125903093 15:43367290-43367312 TGCAATTATCTGGGTGTGAGAGG - Intronic
1126460298 15:48907704-48907726 TGCAGTGACCTGGATGAGACTGG - Intronic
1126488071 15:49204995-49205017 TGCAGTGACCTGGATGAGACTGG - Intronic
1126563751 15:50073380-50073402 TGCAAGGATGTGGATGAAGTTGG - Intronic
1126578036 15:50216942-50216964 TGCAGTGACCTGGATGAGACTGG + Intronic
1126624535 15:50673566-50673588 CACAGTGACCTGGATGAGATTGG - Intronic
1126627893 15:50703175-50703197 TGGAATGTACTGGCTGAGATGGG - Exonic
1127007683 15:54588781-54588803 TGCAATGACCTAGATGAGATTGG - Intronic
1127194972 15:56574519-56574541 TGCAGTGACCTGGATGAAAGTGG + Intergenic
1127434256 15:58941168-58941190 TGCAGCAACCTGGATGAGATTGG + Intronic
1127524659 15:59780627-59780649 TGCATCGACCTAGATGAGATTGG - Intergenic
1129096427 15:73213564-73213586 TGCAGTGACCTGGATGAGACTGG - Intronic
1129919202 15:79305204-79305226 TGAAATGGTCAGGATGAGAGAGG + Intergenic
1130419132 15:83724848-83724870 TGCAATGACATGGATGAAACTGG - Intronic
1130790774 15:87153589-87153611 TGTACTGACCTGGATGAGATTGG - Intergenic
1130951107 15:88589301-88589323 TGCAGTGACCTGGATGAGATTGG + Intergenic
1131706368 15:95000439-95000461 TGCGGTGATCTGGGTGAGAGAGG - Intergenic
1131765903 15:95675563-95675585 TGCAGTGACCTGGATGAGATTGG - Intergenic
1132333923 15:101031050-101031072 TGCAGTGACCTGGAGGAGACGGG - Intronic
1132435430 15:101797508-101797530 TGCAGTGACCTGGATGAGACTGG + Intergenic
1132940533 16:2505030-2505052 AGCAAGAATCTGGATGAGCTGGG - Intronic
1133487641 16:6235703-6235725 CACAGTGATCTGAATGAGATTGG + Intronic
1133712211 16:8412170-8412192 TGCAGTGACCTGGATGAGATTGG + Intergenic
1134333882 16:13276209-13276231 TGCAGTGACCTGGATGAGATTGG - Intergenic
1135917407 16:26617347-26617369 TGCAGTGACCTGGATGAGATTGG - Intergenic
1135943208 16:26840818-26840840 TTAATTGATTTGGATGAGATTGG - Intergenic
1137548640 16:49421551-49421573 TGCAAGGAGCTGAATGAGATGGG + Intergenic
1137776490 16:51059023-51059045 CTCAGTGATCTGGATAAGATTGG + Intergenic
1137998906 16:53253289-53253311 TGCAGTGACCTGGATGATATTGG + Intronic
1138390400 16:56666547-56666569 TGCACTGTGCTGGATGATATGGG - Intronic
1138558661 16:57787386-57787408 AGCAGTGTTCTGGATGAGCTGGG - Intronic
1138907293 16:61352816-61352838 TACAGTGACCTTGATGAGATTGG + Intergenic
1138926994 16:61604429-61604451 TGCAAGGATATGGATGAAACTGG + Intergenic
1139044938 16:63046535-63046557 TGCAGTGACCTGGATGAGATTGG + Intergenic
1139145530 16:64320163-64320185 TGCAGTGACCTGGATGAGACTGG - Intergenic
1139243359 16:65416974-65416996 GGCTATGATGAGGATGAGATGGG - Intergenic
1140316630 16:73904487-73904509 TGCAGCGACCTGGATGAGACTGG + Intergenic
1141220852 16:82068199-82068221 TGCAAGTATCTGGATGAGCTGGG + Exonic
1141333707 16:83135867-83135889 TGCAGCAACCTGGATGAGATTGG + Intronic
1142297180 16:89232036-89232058 TGCTGTGATGTGGATGTGATTGG + Exonic
1142907824 17:3057594-3057616 TGCAATGACCTGGATGAGACTGG - Intergenic
1142926739 17:3246669-3246691 TGCAATGACCTGGATGAGACTGG + Intergenic
1143308385 17:5968018-5968040 CGCAGTGACCTGGATGAGATTGG - Intronic
1144139177 17:12331126-12331148 TGCAGTGGCCTGGATGAGATTGG - Intergenic
1144520570 17:15949964-15949986 GGGAATGATCTGGAAGAGAAAGG - Intronic
1145336451 17:21916939-21916961 TGCAATGAAATGGATGCGAATGG + Intergenic
1145706003 17:26872066-26872088 TGCAATGGAATGGAAGAGATTGG + Intergenic
1145706005 17:26872091-26872113 TGCAATGAAATGGAAGAGAGTGG + Intergenic
1146707015 17:35008171-35008193 TACACTGATCTAGAAGAGATGGG - Exonic
1146750861 17:35378368-35378390 TGCAGTGACCTGGATGAGATTGG - Intergenic
1146962703 17:36997920-36997942 TGCAGTGACCTGGATGAGATTGG + Intronic
1147235285 17:39052680-39052702 TGCAGTGACCTGGATGAGATTGG + Intergenic
1147452537 17:40514716-40514738 TACCATGATCTGGGTGAGATAGG + Intergenic
1147462659 17:40583380-40583402 TGCAATGACCTGGATGAGATTGG - Intergenic
1147549262 17:41427515-41427537 TGTAGTGACCTGGATGAGATTGG - Intergenic
1149033381 17:52108281-52108303 TGCAATAACCTGGATGAGACTGG + Intronic
1149121938 17:53179690-53179712 TGCAGTGACCTGGATGAGATTGG - Intergenic
1149410429 17:56399773-56399795 TGCAGTGACCTGGATGAGATTGG - Intronic
1149698841 17:58638511-58638533 TGCAGCAACCTGGATGAGATTGG + Intronic
1149934773 17:60793697-60793719 TGCAGTGACCTGGATGAGATTGG - Intronic
1150089112 17:62305269-62305291 TGCAGCAACCTGGATGAGATTGG - Intergenic
1151048867 17:70953383-70953405 TGCAGTGACCTGGATGAGACTGG + Intergenic
1151266412 17:72959414-72959436 CGCAGTGACCTGGATGAGATTGG + Intronic
1151327883 17:73390170-73390192 TGCAGTGCCCTGGATGAGAATGG - Intronic
1152220984 17:79066313-79066335 TGCAGTGACCTGGATGAGATTGG + Intergenic
1153065934 18:1045325-1045347 TGCAGTGACCTGGATGTGATTGG + Intergenic
1153069029 18:1083541-1083563 TGCAGTAACCTGAATGAGATTGG - Intergenic
1153100510 18:1463282-1463304 TGCAATGATGTGGATGAACCTGG - Intergenic
1153168447 18:2288218-2288240 TCCAGTGACCTGGATGAGATTGG - Intergenic
1153378553 18:4410002-4410024 TGCAATAACCTGGAAGAGATCGG + Intronic
1153427481 18:4982085-4982107 CACAGTGACCTGGATGAGATTGG + Intergenic
1153490867 18:5646653-5646675 TGCAATGCTCAGCATGAGAGTGG + Intergenic
1153663418 18:7346349-7346371 TGTAGTGACCAGGATGAGATTGG - Intergenic
1154014591 18:10605091-10605113 TGCAATGATCCGGAAGAGAGGGG - Intergenic
1154190896 18:12230486-12230508 TGCAATGATCCGGAAGAGAGGGG + Intergenic
1155004684 18:21718086-21718108 TGCAGCCACCTGGATGAGATTGG + Intronic
1155287081 18:24300586-24300608 TGCAGTGATCTGGATTTGAGGGG + Intronic
1155428511 18:25730647-25730669 TTCAGTGATCTGGATGAGATTGG - Intergenic
1155577793 18:27266921-27266943 TGCAGTGACCTAGATGAGATTGG + Intergenic
1156614275 18:38764998-38765020 TGCAGCGACCTGGATGAGATTGG + Intergenic
1156782217 18:40864165-40864187 TGCAATGGTCTGGTTGTCATTGG + Intergenic
1156800590 18:41108915-41108937 TGTAGTGACCTGGATGAGATTGG - Intergenic
1156976167 18:43223967-43223989 TGCAGTGACCTGGATGAGATTGG - Intergenic
1156976821 18:43232310-43232332 TGCAGTGACCTGGATGAGATTGG + Intergenic
1156984688 18:43335841-43335863 TGCAGTGACCTGGATGAGATTGG - Intergenic
1157541348 18:48512566-48512588 TGCAGTGACCTGAATGAGATTGG + Intergenic
1157973846 18:52302199-52302221 CACAGTGACCTGGATGAGATTGG - Intergenic
1158003102 18:52642167-52642189 TGCGGTGACCTGGATGAGATTGG + Intronic
1158077704 18:53550409-53550431 TGCAGTGACCTGGATGAGATTGG + Intergenic
1158331194 18:56364643-56364665 TGCAGTGACCTGGATGAGATTGG - Intergenic
1158746020 18:60200985-60201007 TGCAGCGACCTGGATGACATTGG + Intergenic
1158756986 18:60337230-60337252 TGCAGTGACCTGGATGAGATTGG + Intergenic
1158830307 18:61270190-61270212 TGCAGCAATCTGGATGAGACTGG + Intergenic
1158852409 18:61508596-61508618 TTCAGTGACCTGGATGAGATTGG + Intronic
1158881234 18:61781462-61781484 TGCAGTGACCTGGGTGAGATTGG + Intergenic
1159568220 18:70081019-70081041 CGCAGTGATCTGGATGAGATTGG + Intronic
1159711116 18:71762111-71762133 TGCAGCAACCTGGATGAGATTGG - Intronic
1163079160 19:14924213-14924235 CGCAGTGACCTGGATGAGATTGG - Intergenic
1163174101 19:15552186-15552208 TGTAAGGATCTGGCTGAGCTAGG - Exonic
1163992489 19:21011736-21011758 TGCAGTGACCTGGATAACATTGG + Intergenic
1164238158 19:23356445-23356467 TGCAATGTCCTGGATGAGATTGG + Intronic
1164287746 19:23836291-23836313 TGCAATAACCTGGATGAGACTGG - Intergenic
1164298733 19:23939265-23939287 TGCAATGACCTGGATGATATTGG - Intronic
1164319558 19:24130903-24130925 TGCAATGACCTGGATGAGACTGG - Intergenic
1164636317 19:29794034-29794056 TGCAGCAACCTGGATGAGATTGG + Intergenic
1164851520 19:31488297-31488319 TGAAATGATCTGGAGGAAAGTGG - Intergenic
1164860278 19:31557119-31557141 TGCAGGAACCTGGATGAGATTGG - Intergenic
1164944807 19:32284439-32284461 TGCAGCAACCTGGATGAGATTGG + Intergenic
1165969710 19:39616873-39616895 TGCAGCAATCTGGACGAGATAGG - Intergenic
1165979997 19:39713072-39713094 TGCAGTAACCTGAATGAGATTGG - Intergenic
1166648475 19:44551608-44551630 TGCAATGACCTGGATGAGACTGG + Intergenic
1167181262 19:47905549-47905571 TGCCGTGACCTGGATGAGACCGG - Intergenic
1167181926 19:47910916-47910938 TGCAGTGACCTGGATGAGACCGG - Intergenic
1167182577 19:47916299-47916321 TGCCGTGACCTGGATGAGACCGG - Intergenic
1167183247 19:47921649-47921671 TGCCGTGACCTGGATGAGACCGG - Intergenic
1167183892 19:47926685-47926707 TGCAGTGACCTGGATGAGACCGG - Intergenic
1167184542 19:47932051-47932073 TGCCGTGACCTGGATGAGACCGG - Intergenic
1167185214 19:47937400-47937422 TGCCGTGACCTGGATGAGACCGG - Intergenic
1167185868 19:47942792-47942814 TGCCGTGACCTGGATGAGACCGG - Intergenic
1167186532 19:47948153-47948175 TGCAGTGACCTGGATGAGACCGG - Intergenic
1167187184 19:47953542-47953564 TGCAGTGACCTGGATGAGACCGG - Intergenic
1167187832 19:47958922-47958944 TGCAGTGACCTGGATGAGACCGG - Intergenic
1167542005 19:50094713-50094735 TGCCGTGACCTGGATGAGACCGG + Intergenic
1167543985 19:50109248-50109270 TGCCGTGACCTGGATGAGACCGG + Intergenic
1167544660 19:50114602-50114624 TGCCGTGACCTGGATGAGACCGG + Intergenic
1167545335 19:50119952-50119974 TGCCGTGACCTGGATGAGACCGG + Intergenic
1167546012 19:50125304-50125326 TGCCGTGACCTGGATGAGACCGG + Intergenic
1167546689 19:50130639-50130661 TGCCGTGACCTGGATGAGACCGG + Intergenic
1167547346 19:50135981-50136003 TGCCGTGACCTGGATGAGACCGG + Intergenic
1167609720 19:50501291-50501313 TGCAGGGATCTGGATGGGATGGG + Intergenic
1167708498 19:51096182-51096204 TGCAATGACCTGGATGAGATTGG + Intergenic
1168502131 19:56901911-56901933 TGCAGCAACCTGGATGAGATTGG + Intergenic
924996404 2:365771-365793 TGCCATGAGCTGGATAAGAGGGG + Intergenic
925125609 2:1453658-1453680 TGCAAGGATGTGTTTGAGATGGG - Intronic
925126935 2:1464192-1464214 TGCAGAGACCTGGTTGAGATTGG - Intronic
925340930 2:3135375-3135397 TGCAGAGACCTGGATGAGATTGG - Intergenic
925343539 2:3153402-3153424 TGCAGCGACCTGGATGAGATTGG + Intergenic
925567753 2:5274519-5274541 TGCCATGACCTGGATGAGATTGG - Intergenic
925951268 2:8914018-8914040 TGCAGTAACCTGGATGAGACTGG + Intronic
926515756 2:13843425-13843447 TTCAGTGACCTGGATGAGATTGG + Intergenic
926592678 2:14756750-14756772 TGCAATGACCTAGATGAGATTGG - Intergenic
926611234 2:14950309-14950331 TGCAATGACCTGGATGAGATTGG - Intergenic
926944805 2:18175770-18175792 TGCAATGACCTGGGTAAGACTGG + Intronic
926986451 2:18629920-18629942 TGCAGTGACCTGTATGAGACTGG - Intergenic
927327923 2:21827736-21827758 TGCAGTGACCTGGTTGAGATTGG - Intergenic
927686077 2:25171418-25171440 TGCATTGATGTTCATGAGATGGG + Intergenic
928175265 2:29029339-29029361 TGCAGTGACCTGGATGAGATTGG + Intronic
928772109 2:34715065-34715087 TGCAATGACCTGGATGAGATTGG - Intergenic
928856370 2:35807594-35807616 TGCAGTGACCTAGATGAGATTGG + Intergenic
929009759 2:37429365-37429387 TGCAGCGACCTGGATGAGATTGG - Intergenic
929013298 2:37469557-37469579 TGCAGCAACCTGGATGAGATTGG + Intergenic
929036846 2:37701512-37701534 TGCAGTGACCTGGATGAAATTGG - Intronic
929055787 2:37875104-37875126 TGTAAGGACCTGGATGAGGTGGG + Intergenic
929243249 2:39674360-39674382 TTCAGTAACCTGGATGAGATTGG + Intronic
929643045 2:43600860-43600882 TGCAGTGACCTGGATGAGATTGG + Intergenic
929722428 2:44383774-44383796 TGCAGTGACCTGGATGGGATTGG - Intronic
929806325 2:45149172-45149194 TGCAGTGACCTGGATGAGATTGG + Intergenic
930143724 2:47980042-47980064 TGCAGTGACCTGGATGAGATTGG + Intergenic
930990423 2:57647532-57647554 TGCAGTGACCTGGATAAGGTTGG - Intergenic
931055418 2:58463896-58463918 TGCAATGACCTGGATGAGACTGG - Intergenic
931136454 2:59407512-59407534 TGCAGTGACCTGGATAAGATTGG + Intergenic
931548393 2:63414572-63414594 TGCAGTGACCTGGATGAGATTGG + Intronic
931736786 2:65202094-65202116 TGGAATAATCTGAATAAGATTGG - Intergenic
932065613 2:68556044-68556066 CACAGTGACCTGGATGAGATTGG + Intronic
932071011 2:68620465-68620487 TGCAGCGATCTGGATGAGATTGG + Intronic
932095943 2:68848529-68848551 TGCAGTGACCTGGACGAGACTGG + Intergenic
932100084 2:68890575-68890597 TGCACTGACCTGGATGAGATTGG - Intergenic
933231654 2:79814527-79814549 TGCAGTGAGCTGGAAGAAATTGG - Intronic
933760180 2:85667311-85667333 TAAATTGATATGGATGAGATGGG - Intronic
934518212 2:95002241-95002263 TTCCATGATGTGGAAGAGATTGG - Intergenic
934892246 2:98080787-98080809 TGCTATGATTTGGATGTGGTTGG - Intergenic
935104418 2:100026776-100026798 TGCAGTGACCTGGATAAGACTGG + Intronic
935172184 2:100618864-100618886 TGCGGTGACCTGGATGAGATTGG - Intergenic
935436722 2:103043700-103043722 TGCAGTGACCTGGATGAGAATGG + Intergenic
935467673 2:103418283-103418305 TGCAGTGACCTGGATGAGATTGG + Intergenic
936164914 2:110112959-110112981 CGCACTGACCTGGATGAGCTCGG + Intronic
936510382 2:113140336-113140358 TGCAGTGACCTGGATGAGATTGG - Intergenic
936555326 2:113492338-113492360 CGCAGTGACCTGGATAAGATTGG + Intronic
936957987 2:118042227-118042249 TGCAGCGACCTGGATGAGATTGG - Intergenic
937058351 2:118959811-118959833 TTCAGTGACCTGGATGAGATTGG + Intronic
937068745 2:119044725-119044747 TACAATGACCTGGATGAGATTGG - Intergenic
937529812 2:122814589-122814611 TGCAGTGACCTGGATGAGATTGG + Intergenic
937957515 2:127429914-127429936 TGAGATGTTCTGGAGGAGATGGG + Intergenic
938037293 2:128045788-128045810 TGCAGTCATCTGAATGAGATTGG - Intergenic
938316302 2:130331649-130331671 TGCAATGTTTTGGATGTGAGGGG - Intergenic
938509905 2:131930241-131930263 TGCAGTGACCTGGATGAGTTTGG + Intergenic
938597770 2:132806071-132806093 TGCAGTGACCTGGATGAGATTGG - Intronic
939032124 2:137089505-137089527 CACAGTGACCTGGATGAGATTGG + Intronic
939329611 2:140740359-140740381 CACAGTGACCTGGATGAGATTGG + Intronic
939534872 2:143415820-143415842 TGCAGCAACCTGGATGAGATTGG + Intronic
939582317 2:143965461-143965483 TGCAATGAAAAGGAGGAGATGGG - Intronic
939813516 2:146865710-146865732 TGCAGTTACCTGGATGAGATTGG + Intergenic
939907899 2:147940704-147940726 TGCAGTGACCTGGATGAGACTGG + Intronic
940028329 2:149232796-149232818 TGCAGTGACCTGGATGAGATTGG + Intergenic
940219928 2:151341230-151341252 TCCAATGGCCTGGATGAGATGGG - Intergenic
940618229 2:156078536-156078558 TGCAATGACCTGAATGAGATTGG - Intergenic
940648442 2:156416070-156416092 TGCAGAGACCTGGATGAGACTGG - Intergenic
940708929 2:157138625-157138647 TGCAGTGACCTGGATGAGATTGG - Intergenic
940784129 2:157964023-157964045 CACAGTGACCTGGATGAGATTGG - Intronic
941702597 2:168620124-168620146 TGCAGCAACCTGGATGAGATTGG + Intronic
942060174 2:172222199-172222221 TGCAGTGATCTGGATGAGATTGG + Intergenic
942154249 2:173110720-173110742 TGCAGTGATCTGGATGAGATTGG - Intronic
942268368 2:174249475-174249497 TGATATGATGTGGGTGAGATGGG - Intergenic
942434033 2:175951513-175951535 CACAGTGACCTGGATGAGATTGG - Intronic
942726620 2:179016041-179016063 CACAATGACCTGGATGAGATTGG + Intronic
943128470 2:183826710-183826732 TGCAACAACCTGGATGTGATCGG + Intergenic
943429754 2:187784439-187784461 TGCAGTGACCTGGATGAGATTGG - Intergenic
943620853 2:190146281-190146303 TGCAGTGACCTGGATAAGATTGG - Intronic
943890824 2:193284756-193284778 TGCTGTGACCTGGATGAGACTGG - Intergenic
943973159 2:194437295-194437317 TACAGCGAACTGGATGAGATTGG - Intergenic
944043378 2:195380801-195380823 TGCAGCAACCTGGATGAGATTGG - Intergenic
944360484 2:198849901-198849923 TGCAATGACCTGTATGAGATTGG + Intergenic
944421176 2:199532154-199532176 TGCAGTAACCTGGATGAGATTGG + Intergenic
944431506 2:199638632-199638654 TGCAGCAACCTGGATGAGATTGG - Intergenic
944866178 2:203864845-203864867 TGCCATTATCTGGAGGACATTGG + Intergenic
944919677 2:204398958-204398980 TACAGTGAACTGGATGAAATTGG + Intergenic
944934493 2:204553758-204553780 TGCAGCAACCTGGATGAGATTGG + Intronic
945075642 2:206036428-206036450 TGCAGTGACCTGGATGAGATTGG + Intronic
945131525 2:206578492-206578514 TGCAGTGACCTGGATGAGAGTGG - Intronic
945637031 2:212368272-212368294 TGCAGTGACCTGGATGAGATTGG + Intronic
945815124 2:214596221-214596243 TGCAATGACCTGGATGAAATTGG + Intergenic
945826292 2:214724072-214724094 TGCAGCGACCTGGATGACATTGG + Intergenic
945861174 2:215124064-215124086 TGCAGTGACCTGGATAAGATTGG - Intronic
945918013 2:215725086-215725108 TGCAATGACCTGGATGAGATTGG - Intergenic
945918883 2:215734426-215734448 TGCAGCAATCTAGATGAGATTGG - Intergenic
946036968 2:216751714-216751736 TGCAGTGACCTGGATGAGATTGG + Intergenic
946501629 2:220253816-220253838 TGCAGCATTCTGGATGAGATTGG + Intergenic
947456573 2:230259704-230259726 TGCAGTGACCTGGATGAGATTGG - Intronic
947881486 2:233517873-233517895 TGCCGTGACCTAGATGAGATTGG + Intronic
947911914 2:233807082-233807104 TGCAGTAACCTGGATGAGATTGG - Intronic
948134922 2:235629203-235629225 TGCAGTGACCTGGATGAGATTGG - Intronic
948230752 2:236347573-236347595 TGCAATGACCTGGATGAGATTGG + Intronic
948571271 2:238918990-238919012 TGCAGTGACCTGGATGAGATTGG + Intergenic
948842292 2:240658464-240658486 CGCAGTGGCCTGGATGAGATTGG - Intergenic
1169075361 20:2756722-2756744 GGCACTGATCTGGAAGAGGTTGG + Intronic
1169335613 20:4753460-4753482 TGCAGTGACCTGGATGAGATTGG - Intergenic
1169401849 20:5288653-5288675 TGCAGCGACCTGGATGAGATTGG + Intergenic
1169516927 20:6327000-6327022 TGCAGTGACCTGAATGAGACTGG - Intergenic
1169528710 20:6460050-6460072 TGCAATAACCTGGATGGAATTGG + Intergenic
1169584605 20:7067153-7067175 TGCAACGACCTGGATGAGATTGG + Intergenic
1169587856 20:7106454-7106476 TGCAGTGACCTGGTTGAGATTGG - Intergenic
1169643754 20:7785660-7785682 TGCAGTGACCTGGATGAGACTGG + Intergenic
1170245278 20:14214898-14214920 TGCAGTGACCTGAATGAGACTGG - Intronic
1170375352 20:15694010-15694032 TGCAGTGACTTAGATGAGATTGG - Intronic
1170405816 20:16034955-16034977 TACAATGACATGGATGAGATTGG - Intronic
1171041199 20:21765300-21765322 TGCAGCAAGCTGGATGAGATTGG - Intergenic
1171062054 20:21974515-21974537 TGCAGTGACCTGGATGGAATTGG - Intergenic
1171130504 20:22648395-22648417 TGCAGTGACCTGTGTGAGATTGG - Intergenic
1171159944 20:22912514-22912536 TTGCATGACCTGGATGAGATTGG - Intergenic
1171166066 20:22972897-22972919 TGCAGTGACCTGGATGAGATTGG + Intergenic
1171242197 20:23580659-23580681 TGCAGTGACCTGGATGAGATTGG - Intergenic
1171544906 20:25992369-25992391 TGTGAAGGTCTGGATGAGATGGG + Intergenic
1172298242 20:33829289-33829311 TGCAAAGAACTGGCTGAGAAGGG - Intronic
1174109411 20:48187842-48187864 TGCAATGCTCTGGAATAGATAGG - Intergenic
1174600778 20:51723096-51723118 TGCAGTGACCTGGATGAGACTGG + Intronic
1174836325 20:53858794-53858816 TGCAGCAACCTGGATGAGATTGG - Intergenic
1174838826 20:53882547-53882569 TGCAACGATGTGGATGGAATTGG - Intergenic
1175000162 20:55619193-55619215 TGCAGCAACCTGGATGAGATTGG + Intergenic
1175069549 20:56321639-56321661 TGCAGTGACCTGGATGAGATTGG + Intergenic
1175547515 20:59788248-59788270 TACGATGACGTGGATGAGATTGG - Intronic
1175563869 20:59956698-59956720 TGCAGTGACCTGGATGAGATTGG - Intergenic
1176999749 21:15597474-15597496 TGCAGTGGCCTGAATGAGATTGG - Intergenic
1177004772 21:15657758-15657780 TGCAGCGACCTGGATGAGATTGG - Intergenic
1177027955 21:15944862-15944884 TGCAATGACCTGGTTGAGATTGG - Intergenic
1177117779 21:17106026-17106048 TGCAGTCATCTGGAAGAGAAGGG - Intergenic
1177173966 21:17683754-17683776 TGCAGTTACCTGTATGAGATTGG - Intergenic
1177847799 21:26311944-26311966 TGCAGTGACCTGGATGAGATTGG + Intergenic
1177981623 21:27922145-27922167 TGCAGTGACCTGGATGTGTTTGG - Intergenic
1177994943 21:28085440-28085462 TGCAGTGACCTGGATGAGATTGG - Intergenic
1178054960 21:28788370-28788392 TGCAGTGACCTGGATGAGACTGG + Intergenic
1178059927 21:28841513-28841535 TGCAGTGACCTGGATGAGACTGG + Intergenic
1178114384 21:29402285-29402307 TACAATGATATTGTTGAGATGGG + Intronic
1178200688 21:30400609-30400631 TGCATTGATCTTGGTGATATGGG + Intronic
1178220130 21:30646872-30646894 TCCAGTCATCTGGATGGGATGGG + Intergenic
1178906991 21:36644562-36644584 TGCAATGACCTGGATGAGATTGG - Intergenic
1178988806 21:37334111-37334133 TGCAGCAACCTGGATGAGATTGG + Intergenic
1179083681 21:38197086-38197108 CACAATGACCTGGATGAGATTGG - Intronic
1179535987 21:42052500-42052522 TGCAGTGACCTGGATGAGATTGG - Intergenic
1179555612 21:42173537-42173559 TGGAATGTTCTGGAACAGATGGG - Intergenic
1182324160 22:29499240-29499262 TGCAGTGACCTGGATGAAACTGG - Intergenic
1182964152 22:34505711-34505733 TGCAATGAGCTGGGTGAGATTGG + Intergenic
1184020399 22:41817284-41817306 GGCAGTGATCTGGATGAAGTAGG + Intronic
949321465 3:2815936-2815958 TGCAGTGACGTGGATGAGATTGG + Intronic
949629224 3:5904594-5904616 TGCAGTTACCTGGATGAGATTGG + Intergenic
949727332 3:7064379-7064401 TGCAGCGACCTGGATGCGATTGG - Intronic
951444135 3:22757324-22757346 TGCAGTGACCTGGATGAGATTGG + Intergenic
951571970 3:24073357-24073379 TGCAGTGACCTGAATGAGATTGG - Intergenic
951763762 3:26173761-26173783 TACAGCAATCTGGATGAGATTGG - Intergenic
951852472 3:27157026-27157048 TGCAGTGACCTGGATGAGACTGG + Intronic
951967595 3:28404725-28404747 CACAGTGACCTGGATGAGATTGG + Intronic
952096943 3:29965014-29965036 TGCAGTGACCTGGATGAGATTGG - Intronic
953004291 3:38963572-38963594 TGCAGTGACCTGGATAAGATTGG + Intergenic
953255341 3:41285436-41285458 TGCAGCGACCTGGATGAGATTGG + Intronic
953539957 3:43809342-43809364 TGCAGTGACCTGGGTGAGATTGG + Intergenic
953726043 3:45399925-45399947 TGCAGTGACCTGGGTGAGATTGG - Intronic
953866978 3:46592732-46592754 TGCAGTGACCTGGATGAGATTGG + Intronic
955859594 3:63313506-63313528 TGCAGTGACCTGGATGAGATTGG - Intronic
956299228 3:67751722-67751744 TGCAGTGACCTGAATGAGATTGG + Intergenic
956524463 3:70142382-70142404 TGCAATGACCTGGATGAGATTGG + Intergenic
957015768 3:75063131-75063153 TGCAGTGACCTGGATGAGATTGG - Intergenic
957205031 3:77185874-77185896 TGCAGCAACCTGGATGAGATTGG + Intronic
957637587 3:82806873-82806895 TGTAATGATCATGATGAGAATGG - Intergenic
957671708 3:83313443-83313465 TGCAGTGACCTGGATGAGATTGG + Intergenic
958002836 3:87772876-87772898 TGCAATGGCCTGGATGAGAATGG - Intergenic
958087848 3:88835366-88835388 TGCAGTGACCTAGATGAGATTGG - Intergenic
958477274 3:94600858-94600880 TGCAGTGACCTGGATGAGATTGG + Intergenic
958480323 3:94637794-94637816 TGCAGTGAACAGGATGAGATTGG - Intergenic
958490141 3:94762175-94762197 TCTAGTGACCTGGATGAGATTGG - Intergenic
958578052 3:95977807-95977829 TGCATTAACCTGCATGAGATTGG + Intergenic
958969429 3:100595028-100595050 TGCAGAAACCTGGATGAGATTGG - Intergenic
959131828 3:102365543-102365565 TGCAGTGACCTGGATGAGATTGG - Intronic
959171843 3:102853538-102853560 TGCAATGACATGGATGGAATTGG + Intergenic
959250068 3:103930482-103930504 TGCAAGGACGTGGATGACATGGG - Intergenic
959280367 3:104329934-104329956 TGCAGTGACCTGAATGAGATTGG + Intergenic
959325190 3:104928053-104928075 TGCAGAGACCTGGATGAGATTGG - Intergenic
959436643 3:106323289-106323311 TGCAGTGACCTGGATGAGTTTGG + Intergenic
959668113 3:108943920-108943942 TGGAGTGACCTGGATGAGATTGG - Intronic
959678782 3:109068502-109068524 TGCAATGACCTAGATGAGATTGG - Intronic
959715220 3:109425273-109425295 TGCAACAACCTGGATGAGACTGG - Intergenic
959763038 3:109991494-109991516 CTCAGTGACCTGGATGAGATTGG + Intergenic
959765732 3:110025296-110025318 TGCAGTGACCTGGATGAGATTGG + Intergenic
959879243 3:111423837-111423859 TGCAGTGACCTGGATGAGATTGG + Intronic
959899581 3:111645216-111645238 TGCAGTGACCTGGATGAGATTGG + Intronic
960017246 3:112905461-112905483 TGCAGTAATCTGGATGAAACTGG - Intergenic
960196017 3:114769642-114769664 TGCAGTGACCTGGATGAGATTGG + Intronic
960337591 3:116437107-116437129 TGCAATGACCTGGATGAGACTGG + Intronic
960512336 3:118565790-118565812 TGCAGTGACCTGGTTGAGGTTGG - Intergenic
960524911 3:118698736-118698758 TGCAGTGACCTAGATGAGATTGG + Intergenic
961093412 3:124135222-124135244 TGCAATGACCTGGATGAGATTGG + Intronic
961264181 3:125627213-125627235 TGCAGTGACCTGGATGGGACTGG - Intergenic
961354586 3:126328225-126328247 TGCAGTGACCTAAATGAGATTGG - Intergenic
962027754 3:131566588-131566610 TGGAATTATCTGCATGAGTTTGG - Intronic
962370702 3:134818658-134818680 TGCAGTGATCTGGATGAGACTGG - Intronic
962504360 3:136030692-136030714 CGCAGTGACCAGGATGAGATTGG - Intronic
962995103 3:140619247-140619269 TGCAACAATCTGGATGGAATTGG + Intergenic
963560080 3:146854091-146854113 TGCAATGAACTGGGGGAGAGGGG + Intergenic
963847612 3:150175543-150175565 TGCATTGACTTGGATGAGATTGG + Intergenic
964146668 3:153472303-153472325 TGCAGTGACCTGGATGAGATTGG - Intergenic
964161122 3:153646798-153646820 TGCAGTGACCTGGATGAGATTGG + Intergenic
964190432 3:153994245-153994267 TGCAGTGACCTGGATGAGACTGG + Intergenic
964418577 3:156476441-156476463 TGCAGTGACCTGGATGAGACTGG - Intronic
964430181 3:156597501-156597523 TGCAGTGACCTGGATGAGACTGG + Intergenic
964915851 3:161840094-161840116 TGCAATGACCTGGATGAGACTGG - Intergenic
965066070 3:163850482-163850504 TGCAGTGACCTGGATGAGATTGG + Intergenic
965122508 3:164580164-164580186 GACAATGATGTGGATCAGATGGG - Intergenic
965223290 3:165955068-165955090 TGCAATGACCTGGATGAGATTGG + Intergenic
965415924 3:168391963-168391985 AGCAGCGACCTGGATGAGATTGG - Intergenic
965438051 3:168676853-168676875 TGGAGAGACCTGGATGAGATTGG - Intergenic
965518763 3:169651490-169651512 TGCAGCGACCTGGATGAGATTGG + Intronic
965638138 3:170805508-170805530 TGCAGTAACCAGGATGAGATTGG + Intronic
965940506 3:174174121-174174143 CACAGTGACCTGGATGAGATTGG - Intronic
965979987 3:174677328-174677350 TACAATGATATGAATGACATAGG - Intronic
966117222 3:176479704-176479726 TGCAGTGACCTGGATGAGATTGG - Intergenic
966164350 3:177000313-177000335 TGCAGCAACCTGGATGAGATTGG - Intergenic
966344035 3:178958320-178958342 TGCAGTGAACTGGATGAGACTGG - Intergenic
966467080 3:180241760-180241782 TGCAGCGACCCGGATGAGATTGG - Intergenic
966623787 3:181994549-181994571 TGCAGTGACCTGGATAAGATTGG - Intergenic
966686530 3:182701791-182701813 TGCAGTGACCTGGATGAGATTGG - Intergenic
966991902 3:185241102-185241124 CGCAGCAATCTGGATGAGATTGG - Intronic
967209543 3:187155982-187156004 TGCAGTGACCTAGATGAGATTGG + Intronic
967257170 3:187605242-187605264 TTCAGTGACCTGGATGAGACTGG - Intergenic
967559349 3:190900392-190900414 TGCAGTGATCTGGATGAGATTGG + Intergenic
967741119 3:193003112-193003134 TGCAGAGACCTGGATGAGACTGG - Intergenic
967760507 3:193219855-193219877 TGCAGAGACCTGGATGAGATTGG + Intergenic
968535805 4:1128068-1128090 TGCAGCAACCTGGATGAGATTGG + Intergenic
968551598 4:1226292-1226314 TGCAATCATCCGGATGGGGTGGG - Intronic
968721239 4:2207094-2207116 CACAGTGACCTGGATGAGATTGG + Intronic
969091913 4:4700905-4700927 TGCAGCAAACTGGATGAGATTGG - Intergenic
969251685 4:5972558-5972580 TGCAATGATTTGGACCAGAGGGG + Intronic
969546617 4:7834182-7834204 TGCAGCAACCTGGATGAGATTGG + Intronic
970215461 4:13754684-13754706 TGCAGTGACCTGGATGAGATTGG - Intergenic
970554431 4:17216791-17216813 TGCAATGTTCTGAATGAGTGTGG + Intergenic
970605211 4:17673610-17673632 CACAGTGACCTGGATGAGATTGG + Intronic
970658166 4:18254822-18254844 TGCAGTGACCTGGATGAGACTGG - Intergenic
970874539 4:20854336-20854358 TGGAGTGACCTGAATGAGATTGG + Intronic
971182641 4:24344037-24344059 TGCAGCGACCTGGATGAGATTGG - Intergenic
971626524 4:28927313-28927335 TGCAATGAGCTGGATGAGATTGG - Intergenic
971694972 4:29889188-29889210 TGCAGTGACCTGGATGAGATTGG + Intergenic
971903753 4:32698308-32698330 TGCAATGATCTAGTTGACAGGGG - Intergenic
971905464 4:32718990-32719012 TGCAATGACCTGCATGAGATTGG - Intergenic
972013879 4:34219761-34219783 TGCAGTGACCTGGATGAGATTGG + Intergenic
972190036 4:36579693-36579715 TGCAGTGACCTAGATGAGATTGG + Intergenic
972269541 4:37497228-37497250 TGTGATGACCTGGATGAGACTGG - Intronic
973070356 4:45850652-45850674 TGCAATAATCTGAATAGGATTGG - Intergenic
973110246 4:46389772-46389794 TGCCCTGATCTTGACGAGATAGG + Intronic
973249877 4:48049649-48049671 AGCAACGACCTGGAGGAGATGGG + Intergenic
973782963 4:54306876-54306898 TGCAGTGACCTGGATGAGACTGG + Intergenic
973787518 4:54347303-54347325 TGCAGTGACCTGGGTAAGATTGG + Intergenic
973831040 4:54759125-54759147 TTCAGCGACCTGGATGAGATTGG - Intergenic
973940859 4:55909326-55909348 TGCAGTGACCTGGATGAGATTGG + Intergenic
974008770 4:56587613-56587635 TGCAGTGACCTGGATGAAATTGG - Intronic
974152084 4:58023161-58023183 TGCAATGATCTTCAAGTGATAGG + Intergenic
974215943 4:58847741-58847763 TGCAGTGACCTGGATGAGATTGG - Intergenic
974327844 4:60438222-60438244 TGGAGTGATCTGGATGACATTGG + Intergenic
974951391 4:68586971-68586993 TGCAATGATCTGAATGAGATTGG + Intronic
975071410 4:70144327-70144349 TGCAAGAATGTGGATGAGATTGG - Intronic
975088594 4:70373403-70373425 TGCAGCAACCTGGATGAGATTGG - Intronic
975185271 4:71394770-71394792 TGCAGTGACCTGGATGGGATTGG + Intronic
975221375 4:71816387-71816409 TGCAATGACCTGGATAGGACTGG + Intergenic
975357275 4:73422843-73422865 TGCAGCGACCTGGATGAGACTGG + Intergenic
975517773 4:75266012-75266034 TGCAGTGACCTGGATGAGATTGG + Intergenic
975591841 4:76008827-76008849 AGCAGTGACCTGGATGAGATTGG + Intergenic
975681166 4:76877626-76877648 TGCAATGACCTGGATGAGATTGG - Intergenic
975808741 4:78141830-78141852 TTTAGTGACCTGGATGAGATTGG + Intronic
975929177 4:79497471-79497493 GACAATGATATGGATGAGACTGG + Intergenic
976384349 4:84438216-84438238 TTCAATTATCTGGATGACTTAGG - Intergenic
976479094 4:85518661-85518683 TGCAGTGACCTGGATGAGATTGG - Intronic
976556759 4:86459610-86459632 CGCAGTGACCTGGATGAGATTGG + Intronic
976664236 4:87572930-87572952 TGCAATAAGCTGAATGAGCTTGG - Intergenic
976685860 4:87813912-87813934 TGCAGTGACCTGGATGAGATTGG - Intergenic
976856804 4:89613799-89613821 TGCAGTGACCTGGATGAGACTGG + Intergenic
976984137 4:91271570-91271592 TGCAGCGACCTGGATGAGATTGG - Intronic
977019571 4:91742750-91742772 TTCAGTGACCAGGATGAGATTGG - Intergenic
977213113 4:94244174-94244196 TACAAAGATCTGTATGAGAAAGG - Intronic
977474391 4:97486941-97486963 TTCTGTGACCTGGATGAGATTGG + Intronic
977733628 4:100383923-100383945 TGCAACAATCTGGATGAGACTGG + Intergenic
977747238 4:100564072-100564094 TGCAGTGACCTGGATGAGATTGG + Intronic
977852527 4:101847667-101847689 TGCAGTGACCTGGATGAGATTGG - Intronic
978128824 4:105168882-105168904 TGCAGTGACCTGGATAAGACTGG - Intronic
978538037 4:109783880-109783902 TGCAGTGACCTGGATGAGATTGG + Intronic
978547847 4:109892194-109892216 TGCAGTGACCTGGATGAGATGGG + Intergenic
978726137 4:111971884-111971906 TGAAGTGATCTGGATAAGTTTGG - Intergenic
978998972 4:115194027-115194049 TGCAGTGACCTGGATGAGATTGG - Intergenic
979083211 4:116369984-116370006 TGCAGCAACCTGGATGAGATTGG - Intergenic
979276105 4:118815666-118815688 TGCAATGATGTGGCTGACAGAGG + Exonic
979381612 4:120012943-120012965 TGCAGTGACCTGGATGAGATTGG - Intergenic
979470253 4:121087810-121087832 TGCAGTGACCTGGATGAGATTGG + Intergenic
979497930 4:121405602-121405624 TGCAGCGACCTGGATGAAATTGG - Intergenic
979705977 4:123721253-123721275 TGCCATGACCTGGATGAGATTGG + Intergenic
979794453 4:124829384-124829406 TGCAGTAACCTGGATGAGATGGG - Intergenic
980152741 4:129068134-129068156 TGCAGCAACCTGGATGAGATTGG - Intronic
980194781 4:129574347-129574369 TGCAGTGACCAGGATGAGATTGG - Intergenic
980286265 4:130782414-130782436 TGCAGTGACCTGGATGAGATTGG - Intergenic
980505177 4:133709864-133709886 TGCAGTGACCTGGATGAGATTGG + Intergenic
980580569 4:134744855-134744877 TGCAGTGACCCAGATGAGATTGG + Intergenic
981347178 4:143689728-143689750 TGCAGTGACCTGGATGAGATCGG + Intronic
981400404 4:144307416-144307438 CCCAGTGACCTGGATGAGATTGG - Intergenic
981461876 4:145022360-145022382 CGCAGCGACCTGGATGAGATCGG + Intronic
981559886 4:146036038-146036060 TGCAGTGATCTGGATGAGATTGG + Intergenic
981626398 4:146760928-146760950 TACAGTGACCTGGATGAGATTGG + Intronic
981654496 4:147098127-147098149 TTCAGTGACCTGGATGAGATTGG + Intergenic
981720622 4:147797879-147797901 TGGGATGAGCTAGATGAGATGGG - Intronic
981731291 4:147902398-147902420 TGCAAAGAACTGCCTGAGATTGG + Intronic
981760271 4:148186908-148186930 TGCAGTGACCTGGATGAGATTGG - Intronic
981825315 4:148934114-148934136 TGCAGTGACCTGGATAAGACTGG + Intergenic
981887159 4:149690269-149690291 TGCAGCAACCTGGATGAGATTGG + Intergenic
981991150 4:150922463-150922485 TGCAGTGACCTGGATAAGACTGG + Intronic
982075769 4:151735803-151735825 TGCAATGACCTGGATGGGACTGG + Intronic
982119133 4:152123638-152123660 TGCAGTGACCTGGATGAGACTGG - Intergenic
982189281 4:152837074-152837096 TGGAGTGACCTGGATGAGATTGG - Intronic
982218292 4:153101754-153101776 TGCAGTGACCTGGATGAGACTGG - Intergenic
982311826 4:153994035-153994057 TGCAGCCACCTGGATGAGATTGG - Intergenic
982520181 4:156406875-156406897 TGCAGCGACCTGGATGAAATTGG + Intergenic
982646927 4:158035899-158035921 TGCAAAAATCTGGAGAAGATTGG + Intergenic
982679631 4:158413349-158413371 TGCAGTGACCTGGATGAGATTGG - Intronic
982983507 4:162172365-162172387 TGCAGCAACCTGGATGAGATTGG - Intergenic
982999655 4:162398218-162398240 TGCAGTGACCTGGATGAGACTGG + Intergenic
983175228 4:164580289-164580311 TGCATTGACCTGGATGAGACTGG - Intergenic
983422557 4:167538563-167538585 TGCAATGATCTGGATGAGATTGG + Intergenic
984527059 4:180870140-180870162 TGCAGTGACCTGGGTGAGACTGG - Intergenic
984563488 4:181299301-181299323 TGCAGTGACCTGAAAGAGATTGG + Intergenic
985008205 4:185555621-185555643 TGCAGTGACCTGGATGAGACTGG - Intergenic
985093385 4:186387304-186387326 TGCAGTGACCTGGATGAGATTGG + Intergenic
986047642 5:4054944-4054966 TGCAGCAACCTGGATGAGATTGG - Intergenic
986198651 5:5561074-5561096 TGCAGTGACCTGGATGAGATTGG - Intergenic
986651934 5:9972572-9972594 TGCAGTGACCTAGATGAGATTGG + Intergenic
986669711 5:10132112-10132134 TGTGGTGACCTGGATGAGATTGG + Intergenic
986844986 5:11741896-11741918 TGCAGTGACCTGGATGGAATTGG + Intronic
987185602 5:15415182-15415204 TGCAGTGACCTGGATGAGATTGG + Intergenic
987458172 5:18172497-18172519 TGCAGTGACCTGTATAAGATTGG - Intergenic
987704020 5:21440751-21440773 TTCAGTGACCTGGATGAGACTGG - Intergenic
988039406 5:25870388-25870410 TGCAATAACATGTATGAGATTGG - Intergenic
988173950 5:27696272-27696294 TGCAATGACCTGAATCAGAATGG + Intergenic
988246892 5:28696821-28696843 TTTAAAGATCTGGATGAGAGTGG - Intergenic
988797443 5:34664918-34664940 CACAGTGACCTGGATGAGATTGG - Intronic
988902709 5:35751164-35751186 TGCAGTGACCTGGATGAGACTGG + Intronic
989200687 5:38759949-38759971 TGCAATGAGCTGAATGGGATTGG + Intergenic
989721187 5:44530561-44530583 TGCAGCAATCTGGATGAAATTGG - Intergenic
990413941 5:55568043-55568065 TGCAGTGACCTGGATGAGACTGG - Intergenic
990673136 5:58155035-58155057 TGCAGCGACCTAGATGAGATTGG + Intergenic
990775652 5:59302673-59302695 TGCAGTGACCTGGATGAGATTGG - Intronic
990891280 5:60652899-60652921 TGCAGCAATCTGGATGAAATTGG - Intronic
991553029 5:67863540-67863562 TGCAACAACCTGGATGAGATTGG - Intergenic
991924351 5:71689749-71689771 CGCAGTGACCTGGATGAGATTGG + Intergenic
992520802 5:77548979-77549001 TGCAGTGTTCTGGATGAGATTGG + Intronic
992523794 5:77585669-77585691 CACAGTGACCTGGATGAGATTGG + Intronic
993277364 5:85877632-85877654 TGCAGTTACCTGGATGAGATTGG - Intergenic
993553844 5:89310331-89310353 TGCAGCGACCTGGATGAAATTGG - Intergenic
993754995 5:91717571-91717593 TGCAGCAACCTGGATGAGATTGG + Intergenic
993856295 5:93080045-93080067 TGCAATAATATGGATAAAATTGG - Intergenic
993883404 5:93389305-93389327 TGCAGTGACCTGGATGAGATTGG - Intergenic
993918223 5:93768043-93768065 TGCACCAACCTGGATGAGATTGG + Intronic
993965280 5:94352771-94352793 TGCAGTGACCTGGATGAGATTGG + Intronic
994330201 5:98496100-98496122 TGCAATGACCTGGATGAGATTGG + Intergenic
994804163 5:104421692-104421714 TGCTATGATCTGAATGTGTTTGG + Intergenic
994875884 5:105420226-105420248 TGCAGTGACCTGGATGAGATTGG + Intergenic
995095910 5:108235685-108235707 TGAAATGAATTAGATGAGATGGG - Intronic
995134481 5:108666117-108666139 TGCAGCAACCTGGATGAGATCGG - Intergenic
995150849 5:108843209-108843231 TGCAGTGACCTGGATGAGATTGG - Intronic
995293275 5:110485604-110485626 TGCAGTGACCTGGATAAGATTGG - Intronic
995694215 5:114861579-114861601 TGCAGCGACCTGAATGAGATTGG - Intergenic
995753680 5:115479098-115479120 TGCAATGACCTGGATGAGATTGG - Intergenic
995797692 5:115959415-115959437 TGGAATGACCTGGATGAGATTGG + Intergenic
995858870 5:116621064-116621086 CACAGTGACCTGGATGAGATTGG + Intergenic
995955872 5:117775857-117775879 TGCAGTGACCTGGCTGAGATCGG + Intergenic
996032430 5:118721086-118721108 TGCAGTGACCTGGATGAGATGGG + Intergenic
996123582 5:119699569-119699591 TGCAGTGACCTGGATGAGATTGG - Intergenic
996156534 5:120109663-120109685 TGCAGTGACCAGCATGAGATTGG + Intergenic
996325888 5:122272914-122272936 TGCAGTGACCTGGCTGAGAATGG + Intergenic
996663540 5:126031685-126031707 TGCAGTGACTTGGATGAGATTGG + Intergenic
996834891 5:127780027-127780049 TGCAGCAACCTGGATGAGATTGG - Intergenic
996956784 5:129192803-129192825 TGCAACAATATGGATGGGATTGG + Intergenic
997007236 5:129832538-129832560 CACAGTGACCTGGATGAGATGGG - Intergenic
997084349 5:130780257-130780279 CACAGTGACCTGGATGAGATTGG + Intergenic
997761335 5:136451177-136451199 TGCGGTGACCTGGATGAGATTGG + Intergenic
997796102 5:136813156-136813178 TTCAGTGACCTGGATGAGACTGG + Intergenic
997832272 5:137160254-137160276 TGCAGTGACCTGGATGAGATTGG - Intronic
997867114 5:137473936-137473958 TGCAGTGACCCGTATGAGATTGG + Intronic
998854819 5:146384421-146384443 TGCAGTGACCTGGATGAGATTGG - Intergenic
998917601 5:147032651-147032673 TGCAGTGATCTGGATGAGAATGG - Intronic
998941340 5:147286120-147286142 TGCAGTGACCTGGATGAGATTGG + Intronic
999159847 5:149486222-149486244 AGCAATGAACTGGCTGAGCTGGG - Intergenic
999343473 5:150794513-150794535 TGCAGTGACCTGGATGAGATTGG + Intronic
999345278 5:150812965-150812987 TGCAGTGACCTGGATGTGATTGG + Intergenic
999429734 5:151515745-151515767 TGCAATAATTTGGATAAGAGAGG - Intronic
999800762 5:155031938-155031960 CACAGTGACCTGGATGAGATTGG - Intergenic
999819267 5:155209166-155209188 TGCAGTGACCTGGATGAGATTGG + Intergenic
999913011 5:156226364-156226386 CGCAGTGACCTGGATGAGATTGG - Intronic
999982705 5:156973113-156973135 TGCAGTGACCTGGATGAGAGTGG - Intergenic
1000260082 5:159579712-159579734 TGCAGTGACCTGGATGACATTGG + Intergenic
1000396735 5:160783313-160783335 TGCAGTGACCTGGATGACACTGG - Intronic
1000404397 5:160871664-160871686 TGCAGTGACCTGAATGAGATTGG - Intergenic
1000584884 5:163085313-163085335 CACAGTGACCTGGATGAGATTGG + Intergenic
1001176686 5:169475576-169475598 TGCAGTAACCTGGATGGGATTGG - Intergenic
1001292375 5:170472724-170472746 TGTAGTGACCTGGATGAGATTGG - Intronic
1001458120 5:171883080-171883102 TGCGGTGACTTGGATGAGATTGG - Intronic
1001767898 5:174268453-174268475 TGCAATGACCTGGATGAGATTGG + Intergenic
1002097871 5:176842556-176842578 TGCAGTGACCTGGATGAGACTGG + Intronic
1002814372 6:665625-665647 TGCAGTGACGTGGATGAGATTGG + Intronic
1003028939 6:2583788-2583810 TGCAGTGATCTGGATGAGACTGG - Intergenic
1003269520 6:4594969-4594991 TTCAGTGACCCGGATGAGATTGG - Intergenic
1003473505 6:6460195-6460217 TGGAGAGACCTGGATGAGATTGG + Intergenic
1003582492 6:7353788-7353810 TGCAGTGACCTGGATGAGACTGG + Intronic
1003711512 6:8597143-8597165 TGCAGTGACATGGAGGAGATTGG - Intergenic
1003746831 6:9011419-9011441 TGCAATGACCTGGATGAGATTGG + Intergenic
1004100223 6:12602041-12602063 TGCAAAGCTTTGGCTGAGATTGG + Intergenic
1004522915 6:16379106-16379128 TGCAGTGACCTGGATGAGATTGG + Intronic
1004592645 6:17068731-17068753 TGCAGTAACCTAGATGAGATTGG - Intergenic
1004679090 6:17874911-17874933 TGCAGCGACCTGCATGAGATTGG - Intronic
1004711470 6:18174756-18174778 TGCAGCAACCTGGATGAGATAGG - Intronic
1004778068 6:18871311-18871333 TGCAGTGACCTGGATGAGATTGG + Intergenic
1004853550 6:19725767-19725789 TGCAGTGACCTGGATGAGATTGG + Intergenic
1004931321 6:20465744-20465766 TGCAGCTACCTGGATGAGATTGG - Intronic
1005073104 6:21880924-21880946 TGCAGTGACCTGGATGAGATTGG + Intergenic
1005760920 6:28967557-28967579 TGCAATGACCTGAATGGGATTGG + Intergenic
1005833671 6:29691196-29691218 TTCAGTGACCTGGATGAGATTGG + Intergenic
1006199468 6:32274892-32274914 TGCAGCAATCTGGATGGGATTGG + Intergenic
1006279796 6:33041693-33041715 TGCAGTGACCTGTTTGAGATTGG - Intergenic
1006287719 6:33110257-33110279 TGCAGCGACCTGGATGAGATTGG - Intergenic
1006722548 6:36166966-36166988 TGCAGTGACCTGGATGAGACTGG + Intergenic
1007299799 6:40858307-40858329 TACAGTGACCTGGATGAGACTGG - Intergenic
1007998337 6:46332604-46332626 TGTAATGACATGGATGAAATTGG - Intronic
1008121218 6:47619367-47619389 TGCAGTGACCTGCATGAAATTGG - Intronic
1008220604 6:48850047-48850069 TGCAGTGACCTGGATGAGACTGG + Intergenic
1008305783 6:49898448-49898470 TGCAGTGACCTGGATGAGATTGG + Intergenic
1008409290 6:51154444-51154466 TGCAGTGACCTGGATGAGATTGG - Intergenic
1008710808 6:54224879-54224901 TGCAGTGACCTGGATGAGACTGG - Intronic
1008926047 6:56893298-56893320 TGCAGTGACCTGGATGAGATTGG - Intronic
1009383973 6:63067154-63067176 TGCAGTGACCTGGATGAGATTGG - Intergenic
1009465695 6:63966210-63966232 TGCAGCGACCTGGATGAGATTGG + Intronic
1009495356 6:64339747-64339769 TGCAGCGACCTGGATGAGATTGG + Intronic
1009878657 6:69538052-69538074 TGCAGTGACCTGGATGAGATTGG - Intergenic
1009888059 6:69648620-69648642 TGCAGTGATAATGATGAGATGGG - Intergenic
1010164576 6:72900249-72900271 CACAGTGATCTGGATGAGATTGG - Intronic
1010469004 6:76203156-76203178 TGCAGTAACCTGGCTGAGATTGG - Intergenic
1010707258 6:79129442-79129464 ATTAATGACCTGGATGAGATTGG - Intergenic
1010718859 6:79260928-79260950 TGCAATCATTTGGAGGAGAAGGG + Intergenic
1011093026 6:83628151-83628173 TGCAGTGACCTGGATTAGATTGG - Intronic
1011169097 6:84484901-84484923 TGCAGTGACTTGGATGAGACTGG + Intergenic
1011319511 6:86075102-86075124 TGCAGTGACCTGGATGAGATTGG - Intergenic
1011327615 6:86167602-86167624 TGCTGTGACCTGGATGAGATTGG + Intergenic
1011789206 6:90879786-90879808 TGCAGTGACCTGGATAAGATTGG - Intergenic
1011878720 6:91996128-91996150 TGCAGTGACCTTGATGAGATTGG + Intergenic
1012063192 6:94512635-94512657 TGCAATCATCTGGAGGAGAAGGG - Intergenic
1012156363 6:95824683-95824705 TGCAGTGACCTGGATGAGATTGG + Intergenic
1012320449 6:97838375-97838397 TGCAGTGACCTGGATGAGATTGG + Intergenic
1012634201 6:101515193-101515215 TACAGTGAGCTGGATGAGATTGG - Intronic
1012923217 6:105241419-105241441 TGCAGTGACCTGGATGAAATTGG + Intergenic
1013448738 6:110258043-110258065 CCCAATGATATGGATGATATGGG - Intronic
1013461651 6:110379665-110379687 TGCAATCATTTGGAGGAGAAGGG - Intergenic
1013721170 6:113030037-113030059 TGCAGTGACCTGGATGAGATTGG + Intergenic
1013852174 6:114529161-114529183 TGCAGTGACCTGGATGAGATTGG - Intergenic
1013900529 6:115150829-115150851 TTCAATGACCTGGATGACATTGG - Intergenic
1013940572 6:115656558-115656580 TGCAGTGACCTGGATAAGATTGG - Intergenic
1014285526 6:119493207-119493229 TTCAGTGACCTGGATGAGACTGG + Intergenic
1014304366 6:119721970-119721992 AACAGTGACCTGGATGAGATTGG - Intergenic
1014337302 6:120152861-120152883 TGCAGTGACCTGGATGAGATTGG + Intergenic
1014530986 6:122559045-122559067 TGCAGTGACCTGGATGAGTTTGG - Intronic
1014541055 6:122677040-122677062 TGCTATGTTATGGATGATATTGG + Intronic
1014604365 6:123453976-123453998 TGCAGTGACCTGGATGAGATTGG + Intronic
1015167929 6:130219629-130219651 CGCAGTGACCTGGATGAGATTGG - Intronic
1015184569 6:130399980-130400002 TGCGATGACCTGGATGAGATTGG - Intronic
1015566035 6:134572703-134572725 TGCAGTGACCTGGATGAGACTGG + Intergenic
1015568431 6:134597318-134597340 TGCAATGATCTGGATGAGATTGG - Intergenic
1015582805 6:134744942-134744964 TGCAGCAACCTGGATGAGATTGG - Intergenic
1015914419 6:138201515-138201537 TGCAATGACCTGGATAAGATTGG + Intronic
1015961855 6:138658488-138658510 TGCTACGATATGGATGAGCTTGG - Intronic
1016196980 6:141356007-141356029 TGCAGTGACCTGGATGAGATTGG - Intergenic
1017081252 6:150671021-150671043 TGCAGTGACCTGGATGAGATTGG - Intronic
1017190010 6:151643007-151643029 CGCAGTGACCTGGATGAGATTGG - Intergenic
1017534801 6:155335384-155335406 TGCAGTGATCTGGATGAGATTGG - Intergenic
1018010276 6:159663714-159663736 TGCAGTGACCTGGATGAGATTGG + Intergenic
1018380067 6:163250956-163250978 TGCAGTGACCTGGATGAGACTGG + Intronic
1018563941 6:165131675-165131697 TGGAATAATCTGAATGTGATTGG - Intergenic
1019788066 7:2992069-2992091 TGCAGGGCCCTGGATGAGATTGG - Intronic
1020374918 7:7474136-7474158 TGCAGTGACCTGAATGAGATTGG + Intronic
1020703532 7:11513004-11513026 TGCCATGACCTGGATGAGATTGG + Intronic
1020861270 7:13494919-13494941 TGCAATGACCTGGATGAGATTGG + Intergenic
1020915433 7:14186714-14186736 TGCAGTGCCCTGGATGAGACTGG + Intronic
1021204765 7:17767207-17767229 TGCAGTGACCTAGATGAGATTGG + Intergenic
1021334889 7:19387572-19387594 TGCAGTGACCTGAATGAGATTGG - Intergenic
1021373316 7:19877495-19877517 TGCAGTGATCTGGATGAGATTGG - Intergenic
1021492107 7:21230420-21230442 GGCAGTCACCTGGATGAGATTGG + Intergenic
1021779044 7:24083901-24083923 TGCAATGACCTGATTGAGATTGG + Intergenic
1021779431 7:24087892-24087914 TGCAGCTACCTGGATGAGATTGG - Intergenic
1021977376 7:26023841-26023863 TGCAGTGACCTGGTTGAGATTGG - Intergenic
1022295838 7:29052001-29052023 TGCAGTGACCTGGATGAGATTGG + Intronic
1022568114 7:31423751-31423773 TGCAGCGACCTGGATGAGATTGG - Intergenic
1023355640 7:39364561-39364583 TGCAGTGACCTGGATGAAACTGG - Intronic
1023544326 7:41301586-41301608 TGTAGTGACCTGGATGAGATTGG - Intergenic
1023709764 7:42979544-42979566 TGCAGTGACCTGGATGAGATTGG + Intergenic
1023748445 7:43345727-43345749 TGCAGTGATCTGGATGAGGCTGG - Intronic
1024111285 7:46149143-46149165 TGCAGTGACCTGGATGAGATTGG - Intergenic
1024126898 7:46308082-46308104 TGCAGCGACATGGATGAGATTGG + Intergenic
1024179354 7:46874424-46874446 TGCAATCATCTGGATGAGATCGG + Intergenic
1024546027 7:50519588-50519610 CGCAGTGACCTGGATAAGATTGG + Intronic
1024615820 7:51110832-51110854 TGCAGTGACCTGGATGAGATTGG - Intronic
1024744879 7:52394444-52394466 TGCAATGAGCTGGATGAGATTGG - Intergenic
1024916759 7:54509948-54509970 TGCTGTGACCTGGATGAGACTGG - Intergenic
1025018355 7:55461080-55461102 TGCAGTGATCTGGATGAGATTGG + Intronic
1025773370 7:64534852-64534874 TGCAGTGACCTGGATGAGATTGG + Intronic
1026164303 7:67896395-67896417 TGCAGTGACCTGGATGAGATTGG - Intergenic
1026235772 7:68526008-68526030 TGCAGTGACCTGGATGAGATTGG + Intergenic
1026466552 7:70659569-70659591 TGCAATAATCTCTAGGAGATAGG - Intronic
1026579368 7:71601056-71601078 TGCAGTGAGCTGGATGAGATTGG - Intronic
1027295899 7:76769890-76769912 TACAGTGACCTGGATGAGACAGG + Intergenic
1027349871 7:77300436-77300458 TGCAATGACCTAGATGAGACTGG - Intronic
1027422689 7:78032848-78032870 TGCAAAGATCCTGATGAGAGAGG + Intronic
1027699694 7:81454613-81454635 TGCCATGACCTGGATGAGATTGG + Intergenic
1028182482 7:87742500-87742522 TGTGATGACCTGGATGAGATTGG - Intronic
1028506354 7:91574866-91574888 TGCAGCGACCTAGATGAGATTGG - Intergenic
1028578584 7:92380842-92380864 TGCAATCCTCTGGAGGAGATGGG - Intronic
1028992955 7:97069575-97069597 TGCAGTGACATGGAGGAGATTGG - Intergenic
1029000069 7:97143599-97143621 TGCAGTGACCTGGATGAGACTGG - Intronic
1029152956 7:98493891-98493913 TGCAGTGACCTGGATGAGATTGG - Intergenic
1029847148 7:103424034-103424056 TGTAATGATCTGGAGGAGTTAGG - Intronic
1029884355 7:103851180-103851202 TGCAGTGACCTGGGTGAGGTTGG + Intronic
1030326241 7:108221546-108221568 TGCGGTGACCTGGATGAGAATGG + Intronic
1030389982 7:108915647-108915669 TGCAGTGACCTGGATGTGATTGG - Intergenic
1030455043 7:109761916-109761938 TGCAAGGATGTGGATGAAGTTGG + Intergenic
1030936456 7:115590758-115590780 TGCAGTGATCTGGATGACATCGG + Intergenic
1031105579 7:117538198-117538220 TATAATGTTCTGGAAGAGATTGG + Intronic
1031186500 7:118487628-118487650 TTCAATGACCTGAATGAGATTGG + Intergenic
1031192452 7:118571259-118571281 TGCAGTGAACTGGATGAGATTGG + Intergenic
1031234679 7:119159455-119159477 TGCAGTGACTTGGATGAGATTGG - Intergenic
1031575085 7:123405911-123405933 TGCAGCAACCTGGATGAGATTGG - Intergenic
1031644830 7:124211601-124211623 TGCAGCAACCTGGATGAGATTGG + Intergenic
1031740448 7:125423225-125423247 CACAGTGACCTGGATGAGATTGG + Intergenic
1031760628 7:125708930-125708952 TGCAGTGACATGGATGAGATTGG - Intergenic
1032857959 7:135852106-135852128 TGCAGTGACCTGTATGAGACAGG - Intergenic
1033078746 7:138274276-138274298 CGCAGTGACCTGGATGAGATTGG + Intergenic
1033260189 7:139837507-139837529 TGCAGTGACCTGGATGAGATTGG + Intronic
1033268034 7:139903240-139903262 TGCAGTGACTTGGATGAGACTGG - Intronic
1033310401 7:140257523-140257545 TACAACGACCTGGATGAGATTGG + Intergenic
1033624459 7:143095229-143095251 TGCACTGACCTGAATGAGATTGG + Intergenic
1033628508 7:143134113-143134135 TGCAGTGACCTGTATGAGATTGG - Intronic
1033721819 7:144068207-144068229 TGCAGTGACTTGGATGAAATTGG + Intergenic
1033828874 7:145227542-145227564 TGCAGTGATCTGGATGAGACTGG - Intergenic
1033945372 7:146710027-146710049 TGCAAGGATCTGAATGAAAAGGG + Intronic
1034888429 7:154817254-154817276 TGCAGTGCTATGGATGAGAAGGG + Intronic
1035255689 7:157625426-157625448 TGCAGTGACCCGGATGAGACTGG + Intronic
1035852170 8:2931520-2931542 TGCAGCGACCTGGATGAGATTGG + Intergenic
1035979714 8:4356250-4356272 TGCAGTGACCGGGATGAGATTGG - Intronic
1035982458 8:4388399-4388421 TGCAGAGACCTGGATGACATTGG + Intronic
1036015665 8:4780864-4780886 TTCAGTGAACTGGATGAGATTGG - Intronic
1036469851 8:9042967-9042989 TGCAAGGATCTGGAGAAGAAAGG + Intronic
1037055254 8:14432374-14432396 TGCAGTGACCTCGATGAGACTGG + Intronic
1037135879 8:15459765-15459787 CGCATTGACCGGGATGAGATTGG - Intronic
1037358577 8:18049266-18049288 TGCAGTGACCTGGATGAGATTGG + Intergenic
1037560485 8:20069636-20069658 TGCAGCGACCTGGATGAGATCGG + Intergenic
1038101529 8:24382488-24382510 TGCAACAACCTGGATGGGATTGG + Intergenic
1038237547 8:25774873-25774895 TGCAGTGACCTGGATGAGATTGG + Intergenic
1038463506 8:27737959-27737981 TGCAGTGACCTGGATGAGACTGG + Intronic
1038997082 8:32935722-32935744 TGCAGTGACCTGGATGAGATTGG + Intergenic
1039074739 8:33679849-33679871 TGTAATGACCTGGATGAGATTGG + Intergenic
1039082809 8:33749951-33749973 TGCAGCGACCTGGATGAGATTGG - Intergenic
1039091370 8:33833251-33833273 TGCAGTGACCTGGATGAGATTGG + Intergenic
1039124065 8:34181026-34181048 TGCAGTGACCTGGATGTGCTTGG + Intergenic
1039397753 8:37241597-37241619 TGCAGTGACCTGGATGAGATTGG + Intergenic
1039636004 8:39166338-39166360 TGCAGCGACCTGGATGAGATTGG - Intronic
1039671558 8:39606000-39606022 TGCAGTGACCTGGGTGAGTTTGG - Intronic
1039710137 8:40047783-40047805 TGCAGTGATCTGGGTGAGATTGG + Intergenic
1039728152 8:40244375-40244397 TGCAGTGACCTGGTTGAGATTGG + Intergenic
1040535063 8:48301893-48301915 TGCAAAGACATGGATGATATAGG + Intergenic
1040843913 8:51815243-51815265 TGCAGCGACCTGGATGAGATTGG + Intergenic
1041228242 8:55722519-55722541 TGCAGTGACCTCGACGAGATTGG + Intronic
1041319412 8:56597945-56597967 TGCCCTGACCTGGATGTGATGGG + Intergenic
1041364359 8:57085327-57085349 TACAGTGACTTGGATGAGATTGG + Intergenic
1041877490 8:62706979-62707001 TGCAGTGACCTGGATGAGATTGG - Intronic
1042122308 8:65501365-65501387 TGTAGTGACCTGGATGAGACTGG - Intergenic
1042361044 8:67883516-67883538 TGCAGCAACCTGGATGAGATTGG - Intergenic
1042450972 8:68945308-68945330 TGCAGTGACCTGGATGAGATTGG - Intergenic
1042466953 8:69139379-69139401 TGCAGTGACCTGGATGAGATTGG - Intergenic
1042616472 8:70655177-70655199 TGTAGTGACCTGGTTGAGATTGG - Intronic
1043070838 8:75633962-75633984 TGCAGTGACTTGGATGAGATTGG - Intergenic
1043096329 8:75979550-75979572 TGCAGAGAACTGGATGAGCTGGG + Intergenic
1043223089 8:77691514-77691536 TTCAGTGACCTGGGTGAGATTGG + Intergenic
1043396611 8:79843375-79843397 TGCAGTCATCTGGAGGAGAGAGG - Intergenic
1043568354 8:81572251-81572273 TGCAGTGACCAGGATGAGACAGG - Intergenic
1043628009 8:82288633-82288655 TGCTGTGACCTGGATGAGATTGG - Intergenic
1043671877 8:82896527-82896549 TGCAGTGACCTAGATGAGATTGG - Intergenic
1043816415 8:84807309-84807331 TGCAGTAACCTGGATGAGACTGG - Intronic
1044168691 8:89022032-89022054 AGTAGTGACCTGGATGAGATTGG - Intergenic
1044228128 8:89742700-89742722 TGCAGTGACCTGGATGAGATCGG + Intergenic
1044258105 8:90089852-90089874 TGCAGTGACTTGGATGAGATTGG - Intronic
1044394117 8:91689403-91689425 TGCAGTGACCTGGATGATATTGG + Intergenic
1044415376 8:91933025-91933047 TGCAGCGACCTGGCTGAGATTGG + Intergenic
1044758770 8:95494600-95494622 TGCAATGACATGGATGAACTTGG + Intergenic
1044907716 8:97023170-97023192 CGCAGTGACCTGGATGAGACTGG + Intronic
1045121718 8:99044782-99044804 TGTAGTGACCTGGAGGAGATTGG - Intronic
1045380805 8:101622981-101623003 TGCAGTGACCTGGATAAGATTGG - Intronic
1045780388 8:105855862-105855884 GGCAGTGACCTGGATGAGATTGG + Intergenic
1045881420 8:107045459-107045481 TGCAATGACCTGGATGAGACTGG + Intergenic
1046033070 8:108806566-108806588 TGCAGTGACCTGGATGAGATTGG - Intergenic
1046075926 8:109311618-109311640 CACAGTGACCTGGATGAGATTGG + Intronic
1046147039 8:110173854-110173876 TGCCATGATATGGATGAAACTGG + Intergenic
1046369561 8:113283933-113283955 TGCAGTGACCTGGATGAGACTGG + Intronic
1046498690 8:115047090-115047112 TGCAGCAACCTGGATGAGATTGG + Intergenic
1046861295 8:119094548-119094570 GGCCATGATCTGGAGGAGAAGGG + Intronic
1046973100 8:120244679-120244701 TGCAGCAACCTGGATGAGATTGG - Intronic
1047032832 8:120901872-120901894 TGCAGTGACCTGGATGAGATTGG + Intergenic
1047090688 8:121572392-121572414 TGCAATGACCTGGATGAGACTGG + Intergenic
1047271682 8:123366573-123366595 TGCAACTACTTGGATGAGATTGG + Intronic
1047332023 8:123898575-123898597 TGCAGTGACCTGGATGAGATTGG - Intronic
1047457303 8:125027464-125027486 TGCAGTGACCCGGATGAGACTGG + Intronic
1047558394 8:125959172-125959194 TGCAGCAACCTGGATGAGATTGG - Intergenic
1047839460 8:128734738-128734760 TGCAAAGAACTGTATCAGATGGG - Intergenic
1047913177 8:129553486-129553508 TGCAGCAACCTGGATGAGATCGG + Intergenic
1048262640 8:132958083-132958105 TGCAGCGACCTGGATGAGACTGG - Intronic
1048418002 8:134248678-134248700 TGCAACAACCTGGATGAGACTGG + Intergenic
1048599266 8:135901743-135901765 TGCAGTGACCTGGATGAGATTGG - Intergenic
1048631350 8:136246453-136246475 TGCAGCAACCTGGATGAGATTGG + Intergenic
1049839932 8:144764468-144764490 TGGAATGACCTGAATGAGAGCGG + Intergenic
1049897668 9:124850-124872 CGCAGTGACCTGGATAAGATTGG - Intronic
1050147858 9:2589210-2589232 TACAGTGACCTGGATGAGATTGG - Intergenic
1050147867 9:2589351-2589373 TACAGTGACCTGGATGAGATTGG + Intergenic
1050341958 9:4648971-4648993 AGCAATGACCTGGATGAAATTGG - Intronic
1050503277 9:6321339-6321361 TGCAGTGACCTGGCTGAGATTGG + Intergenic
1050675561 9:8048977-8048999 CACAGTGACCTGGATGAGATTGG + Intergenic
1051384991 9:16498362-16498384 TGCAGTGACCTAGATGAGATTGG + Intronic
1051677983 9:19577933-19577955 TGCAGTGATCTGAATGAGATTGG + Intronic
1051700694 9:19820130-19820152 TGCAGTGACTTGGATGAGATTGG + Intergenic
1051893033 9:21962432-21962454 TGCAGTGGCCTGGATGAGAATGG - Intronic
1052247439 9:26353169-26353191 TGCAGTGGCCTGGATGACATTGG + Intergenic
1052347046 9:27420639-27420661 TGCAGTGACCCGGATGAGATTGG + Intronic
1052367925 9:27634000-27634022 TGCAGTGATATGGCTCAGATCGG - Intergenic
1052393011 9:27903192-27903214 TGCAGCAACCTGGATGAGATTGG - Intergenic
1052460844 9:28760798-28760820 TGCAGTGATGTGGATGAGATTGG - Intergenic
1052564361 9:30128576-30128598 TGCAGCAACCTGGATGAGATTGG - Intergenic
1052638568 9:31134373-31134395 TGCAGTGACCTGGATGAGATTGG + Intergenic
1052731004 9:32285651-32285673 TGCAGTGTCCTGGATGAGACTGG - Intergenic
1052777556 9:32747960-32747982 TGCAGCAACCTGGATGAGATTGG - Intergenic
1052895505 9:33744073-33744095 TGCAGTGACCTGGATGAGACTGG + Intergenic
1052951340 9:34215382-34215404 TGCAGTGACTTGGATGAGATTGG + Intronic
1053043937 9:34897969-34897991 TGCAGCGACCTGGATGAGATTGG - Intergenic
1053212016 9:36237956-36237978 TGCAGTGACCTAGATGAGACTGG - Intronic
1053401008 9:37822488-37822510 TGCAATGACCTGGATGAGATTGG + Intronic
1053471503 9:38348916-38348938 CACAGTGACCTGGATGAGATTGG - Intergenic
1053672840 9:40386306-40386328 TGCAGCAACCTGGATGAGATTGG + Intergenic
1053922653 9:43012687-43012709 TGCAGCAACCTGGATGAGATTGG + Intergenic
1054383950 9:64526370-64526392 TGCAGCAACCTGGATGAGATTGG + Intergenic
1054443748 9:65291293-65291315 CGCAGTGACCTGGATAAGATTGG - Intergenic
1054486526 9:65730210-65730232 CGCAGTGACCTGGATAAGATTGG + Intronic
1054511786 9:65989977-65989999 TGCAGCAACCTGGATGAGATTGG - Intergenic
1054702085 9:68423019-68423041 TGCAGGGACCTGGATGAGACTGG - Intronic
1054995958 9:71389679-71389701 TGCAGTGACCTGGATGAGATTGG + Intronic
1055144937 9:72922013-72922035 TGGAATAATCAGGAAGAGATGGG + Intronic
1055345839 9:75337675-75337697 TGCAGGGACCTGGACGAGATAGG - Intergenic
1055656866 9:78459416-78459438 TGCAGTGACCTCGCTGAGATTGG + Intergenic
1055905151 9:81285010-81285032 TGCAGTGACTGGGATGAGATTGG - Intergenic
1055905331 9:81287049-81287071 TGCAGTGACTTGGATGAGATTGG - Intergenic
1056300036 9:85231223-85231245 TGCAATGACTTGGATGAGATTGG - Intergenic
1056322246 9:85446633-85446655 TGCAGTGATCTGGATGAGATTGG - Intergenic
1056698558 9:88881478-88881500 TGCAGTGACCTAGATGAGATTGG - Intergenic
1056704414 9:88939901-88939923 TGCAGTGACCTGGATGAGATTGG - Intergenic
1057344752 9:94239482-94239504 TGCAGCAACCTGGATGAGATTGG - Intergenic
1057644005 9:96855553-96855575 TGCAGCGACCTGAATGAGATTGG - Intronic
1057873903 9:98738940-98738962 CGCAGTGACCTGGATGAGATTGG + Intronic
1057992023 9:99780557-99780579 TGCAGTGACCTGGATGATATTGG - Intergenic
1058012791 9:99996825-99996847 TACAGTGATCTGGATGAGATTGG - Intronic
1058084510 9:100734093-100734115 TGCAGTGACCTGGATGAGATTGG - Intergenic
1058622713 9:106900136-106900158 TGCAGTGACCTGGATAAGACTGG - Intronic
1058771230 9:108234377-108234399 TGCAGTGACCTGGATGAGACTGG + Intergenic
1058945459 9:109851402-109851424 TGTTAAGAACTGGATGAGATGGG + Intronic
1059074952 9:111182946-111182968 TGCAGTGACCTGGATGAGATTGG - Intergenic
1059327031 9:113510232-113510254 TGCAGCGACCTGGATGAGATTGG - Intronic
1059499752 9:114741494-114741516 TGCAGTGACCTGGATGAGACTGG + Intergenic
1059609127 9:115872898-115872920 TGCAGCAACCTGGATGAGATTGG - Intergenic
1059734732 9:117089823-117089845 TGCCACAACCTGGATGAGATTGG - Intronic
1062732805 9:138119129-138119151 TGAAATTTTCTGGATGAGAGTGG - Intronic
1203721457 Un_GL000216v2:16390-16412 TGGAATGAAATGGATTAGATTGG - Intergenic
1203387491 Un_KI270438v1:68777-68799 TGCAATTATTTGGATTTGATTGG + Intergenic
1185633267 X:1532585-1532607 TGGAGTGGCCTGGATGAGATTGG + Intronic
1185715697 X:2340360-2340382 TGCAGTGACCTGGATGAGACTGG - Intronic
1185852636 X:3503556-3503578 TGCAGCGGCCTGGATGAGATTGG + Intergenic
1185933272 X:4227328-4227350 TGCAGTGACCTGGATGAGACTGG + Intergenic
1185986441 X:4839899-4839921 TGCAATGATATGGATGAAACTGG - Intergenic
1186158724 X:6753267-6753289 TGCAGTGACCTGGATGAAATTGG - Intergenic
1186210106 X:7241866-7241888 TGCAACTATCTGAATGAGCTTGG - Intronic
1186238544 X:7541253-7541275 GGCAGTGACCTGGATGAGATTGG - Intergenic
1186351695 X:8746513-8746535 TGCAGTGCCCTGGATGAGATTGG + Intergenic
1187102354 X:16206983-16207005 TGCAGTGACCTGGATGAGATTGG + Intergenic
1187399607 X:18947846-18947868 TGCAGCGACCTGGATGAGACTGG + Intronic
1187430571 X:19220420-19220442 TGCAGTGACCTGGATGAGATTGG - Intergenic
1187636349 X:21233127-21233149 TGCAGTGACCTTGATAAGATAGG - Intergenic
1187681874 X:21776180-21776202 TGCAGTGACCTGGATGAGACTGG + Intergenic
1187749239 X:22443827-22443849 TGCAGTGACCTGGATGAGACTGG + Intergenic
1187944343 X:24411889-24411911 TGCAATGATCTGGATGGTCAGGG - Intergenic
1188039983 X:25360515-25360537 TGCAGTGACCTGGATGAAATTGG - Intergenic
1188045411 X:25420647-25420669 TCCAGTGACCTGGATGAGATGGG - Intergenic
1188171049 X:26926873-26926895 TGGAATAATCTGGATGCCATAGG - Intergenic
1188254222 X:27940282-27940304 TACAATGTTCTGGAGGAGAGAGG - Intergenic
1188433114 X:30129412-30129434 TGCAGTGACCTGGAGGAGAATGG + Intergenic
1188608843 X:32070666-32070688 TGCAATGACCTGGATGCGATTGG + Intronic
1188638950 X:32474123-32474145 TGCAGTGACCTGAATGAGATTGG - Intronic
1188699660 X:33242404-33242426 TGCAGTGACCTGGATGAGATTGG - Intronic
1188737747 X:33739394-33739416 TGCAGTGACCTGGATGAGACTGG - Intergenic
1188794472 X:34444812-34444834 TGCAGTGACCTGGATGAAATTGG + Intergenic
1188799278 X:34507091-34507113 TGCAGTGATCTGAATGACATTGG - Intergenic
1188861925 X:35268687-35268709 TGCAATGATCTGGATGAGATTGG + Intergenic
1189218642 X:39350489-39350511 TGCAGTAAGCTGGATGAGATTGG + Intergenic
1189414198 X:40800578-40800600 TGCAATGACCTGGATGAGACTGG + Intergenic
1189544764 X:42029941-42029963 TGCAGTGACCTGGATGAGACTGG - Intergenic
1189733477 X:44046027-44046049 TGCAGCGACCAGGATGAGATTGG - Intergenic
1189878623 X:45465478-45465500 TGCAGTGACCTGGATGAGATTGG - Intergenic
1189927960 X:45976781-45976803 TGCAATGACCTGGATGAGACTGG + Intergenic
1189962665 X:46339311-46339333 TGCAGTGACCTGGATGAGATTGG + Intergenic
1190894987 X:54608649-54608671 TGCAGTGACCTGGATGAGACTGG - Intergenic
1191013039 X:55781203-55781225 TGCAGTGACCTGGATGAGATTGG + Intergenic
1191150499 X:57216419-57216441 TGCAATGACCTGGATGAGATTGG - Intergenic
1191601024 X:63007220-63007242 TGCAGTAACCTGGAAGAGATTGG + Intergenic
1191679674 X:63828339-63828361 TTCAGTGACCTGGATGAGATTGG + Intergenic
1191692568 X:63956117-63956139 TGCAATGACCTGGATGAGACTGG + Intergenic
1191891852 X:65951644-65951666 TGCAGCGACCTGGGTGAGATTGG - Intergenic
1191913281 X:66174305-66174327 TGCAGCGACCTGAATGAGATTGG - Intronic
1191960785 X:66699491-66699513 TGCAGTGACCTAGATGAAATTGG - Intergenic
1191964685 X:66744668-66744690 TGCAGTGAACTGGATGAGATTGG - Intergenic
1191994526 X:67077684-67077706 TGCAGTGACCTGGATGAGATTGG + Intergenic
1192026468 X:67457530-67457552 TGCAATTATCTGGAGGAGAATGG - Intergenic
1192073868 X:67970390-67970412 GACAGTGATCTGGATGAGATTGG + Intergenic
1192403187 X:70857901-70857923 TGCAGTGACCTGGATGAGATTGG + Intronic
1192686647 X:73313844-73313866 TGCAGTGATCTGGATGAGACTGG - Intergenic
1192879860 X:75272428-75272450 TGCAGCGACCTGGATGAGATTGG + Intergenic
1192943826 X:75942707-75942729 TGCAGTGACCTGGATGAGATTGG - Intergenic
1192947167 X:75976780-75976802 TGCAGCGATCTGGATGAGATTGG - Intergenic
1192968857 X:76209271-76209293 TGCAGTGACCCGGGTGAGATTGG - Intergenic
1192994113 X:76493732-76493754 TGCAATCATTTGGAGGAGAAGGG - Intergenic
1192994596 X:76499339-76499361 TGCAGTGACCTGGATGAGATTGG - Intergenic
1193111984 X:77739283-77739305 TGCAGTAACCTGGATGGGATTGG - Intronic
1193158083 X:78195804-78195826 TGCTGTGACCTGGATGAGACTGG + Intergenic
1193228806 X:79018153-79018175 TGCAGCAATCTGGATGAGATTGG + Intergenic
1193386358 X:80876572-80876594 TGCAGTGACCTGGATGAGATTGG + Intergenic
1193503052 X:82304238-82304260 TGCAACAACCTGGATGAGATTGG + Intergenic
1193578959 X:83238231-83238253 TGCAACGATCTGGATGAGATTGG + Intergenic
1193589863 X:83375790-83375812 TGCAGTGACCTGGAAGAGACTGG - Intergenic
1193680768 X:84516428-84516450 TGCAGCAACCTGGATGAGATTGG - Intergenic
1193779448 X:85684431-85684453 TGCTGTGACGTGGATGAGATTGG - Intergenic
1193937988 X:87645746-87645768 TGCAGCAACCTGGATGAGATTGG + Intronic
1194031180 X:88817607-88817629 TGCAGTGACCTGGATGAGATTGG + Intergenic
1194380529 X:93185436-93185458 TCCAATGATCTGAATAAGTTTGG - Intergenic
1194393947 X:93356504-93356526 TGCAGCGACCTGGATGAGATTGG - Intergenic
1194411999 X:93568559-93568581 TGCAGTGACCTGGATGAGATTGG - Intergenic
1194537776 X:95127834-95127856 TGCAACAATATGGATGAAATTGG + Intergenic
1194543004 X:95198065-95198087 TGCAGTGACCTGGATGAGACTGG - Intergenic
1194791354 X:98154669-98154691 TGTAGTGACCTGGATGAGATTGG - Intergenic
1194882115 X:99266628-99266650 CACAGTGACCTGGATGAGATTGG - Intergenic
1194917973 X:99727982-99728004 TGCAGTGACCTGGATGAGATTGG + Intergenic
1194932440 X:99904030-99904052 TGCAGTGACCTGGATGAGATTGG + Intergenic
1194956101 X:100182525-100182547 TGCAGCTATCTGGATGAGATTGG + Intergenic
1194997067 X:100602460-100602482 TGCAGTAACATGGATGAGATTGG - Intergenic
1195018912 X:100806520-100806542 TGCAGTGACCTGGATGAGATTGG - Intergenic
1195135241 X:101899601-101899623 TTCAGTTATCTGGATGAGATTGG - Intronic
1195401528 X:104466132-104466154 TGCAATAATATGGATGAGATTGG - Intergenic
1195463266 X:105151844-105151866 TGCAGCAATCTGGATGAGATTGG + Intronic
1195912930 X:109906743-109906765 TGCAGCGACCTGGATGAGATTGG - Intergenic
1195984719 X:110616286-110616308 TGCAATGACCTGGATGAAATTGG - Intergenic
1195999252 X:110763420-110763442 TGCAATGACCTAGATGAGATTGG - Intronic
1196160904 X:112481455-112481477 TGCCATAATATGGATGAGCTTGG - Intergenic
1196179557 X:112674966-112674988 TGCAGCGACCTGGATGAGATTGG + Intronic
1196264890 X:113631346-113631368 TGCAATGATCTAGCTGACACAGG + Intergenic
1196308521 X:114133174-114133196 TGCAGTGACCTGGATGAGATTGG + Intergenic
1196465304 X:115966477-115966499 TGCAGTGACCTGGATGAGATTGG + Intergenic
1196531194 X:116788691-116788713 CGCAGTGACCTGGATGAGATTGG + Intergenic
1196590070 X:117476663-117476685 TGCAGTGACCTAGATGAGATTGG - Intergenic
1196675213 X:118412990-118413012 TGCAGCAACCTGGATGAGATTGG - Intronic
1196738068 X:118998308-118998330 TGCAGTGACCTGGATGAGATTGG + Intronic
1196946848 X:120835452-120835474 TGCAGCGACCTGGATGAGATTGG - Intergenic
1197065714 X:122231580-122231602 TGCAATAACCTGGATGAGACTGG - Intergenic
1197102960 X:122678351-122678373 TGCAGTGATCTGGATGAGATTGG + Intergenic
1197145029 X:123162295-123162317 TTCAGGGACCTGGATGAGATTGG - Intergenic
1197364028 X:125542086-125542108 TGTTGTGACCTGGATGAGATTGG + Intergenic
1197525491 X:127556988-127557010 TGCAGTGACCTGGATAAGATGGG - Intergenic
1197589361 X:128389750-128389772 TGCAGTGGCCTGGATGAGATTGG + Intergenic
1197664142 X:129205002-129205024 TGCAGTGACCTGGATGAGATTGG - Intergenic
1197668599 X:129250529-129250551 CACAGTGACCTGGATGAGATTGG - Intergenic
1197671027 X:129277752-129277774 TGCAGTGACCTGGATGAGATTGG - Intergenic
1197956283 X:131951848-131951870 TGCAGTGACCTGGATGAGATTGG - Intergenic
1198323369 X:135542131-135542153 TGCAATGAATTGGATGATATGGG - Intronic
1198570319 X:137948062-137948084 TGCCATTAGCTGGATGACATTGG + Intergenic
1198596586 X:138242889-138242911 TGCAGTGACCTGGATGAGACTGG + Intergenic
1198668624 X:139053142-139053164 TGCAGTGACCTGGATGAGATTGG - Intronic
1199008052 X:142725606-142725628 TGCAGGAACCTGGATGAGATCGG + Intergenic
1199057590 X:143316525-143316547 TGCAGTGACCTGGGTGAGACTGG - Intergenic
1199150105 X:144421768-144421790 TGCAGTGACCTGGATGAGACTGG - Intergenic
1199173255 X:144756686-144756708 TGCAATAATTTGGAGGAGAAGGG + Intergenic
1199421148 X:147646085-147646107 TGCAGTGATCTGGATGACACTGG + Intergenic
1199425949 X:147701289-147701311 TGCAGCGACCTGGATGAAATTGG + Intergenic
1199498678 X:148484842-148484864 TGCAGTGACCTGGATGAGATTGG + Intergenic
1199521029 X:148735912-148735934 TGCACTGATCTGGATGAGACTGG - Intronic
1199564332 X:149198724-149198746 TGCAATCATTTGGAGGAGTTGGG + Intergenic
1199669033 X:150126684-150126706 TGCAGTGACATGGATGATATTGG + Intergenic
1199811246 X:151351910-151351932 TGCAATCATATGGATGGAATGGG - Intergenic
1199821238 X:151449220-151449242 TGCAGTGACCGAGATGAGATTGG - Intergenic
1200317624 X:155150129-155150151 TGCAGTGACCTGGATGGGATTGG - Intergenic
1200415500 Y:2905878-2905900 TGCAGTGACCTGGATGAGATTGG + Intronic
1201316239 Y:12649284-12649306 TGCAGTGGCTTGGATGAGATTGG + Intergenic
1201414329 Y:13732640-13732662 TGCAGTGCCGTGGATGAGATTGG - Intergenic
1201714228 Y:17026412-17026434 TGCAGTGACCTGGATGAGATTGG - Intergenic
1201714241 Y:17026753-17026775 TGCAGTGACCTGGATGAGATTGG + Intergenic
1201756235 Y:17488819-17488841 TGCAATGACCTGAATGAGATTGG + Intergenic
1201845317 Y:18417166-18417188 TGCAATGACCTGAATGAGATTGG - Intergenic
1202617050 Y:56730359-56730381 TGCAATGGACTCGAAGAGATTGG + Intergenic
1202620816 Y:56762401-56762423 TGCAATGGACTCGAAGAGATTGG + Intergenic