ID: 1084222853

View in Genome Browser
Species Human (GRCh38)
Location 11:67695248-67695270
Sequence AAGCAACACCAGCTGCAGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084222852_1084222853 6 Left 1084222852 11:67695219-67695241 CCAGCAGTAGGACTTATCATGAT No data
Right 1084222853 11:67695248-67695270 AAGCAACACCAGCTGCAGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084222853 Original CRISPR AAGCAACACCAGCTGCAGTG AGG Intergenic
No off target data available for this crispr