ID: 1084225326

View in Genome Browser
Species Human (GRCh38)
Location 11:67711663-67711685
Sequence GAGGAGGGAGGCTGAGTCCG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084225313_1084225326 10 Left 1084225313 11:67711630-67711652 CCCCGACCTAAGACGTGGTAAAC No data
Right 1084225326 11:67711663-67711685 GAGGAGGGAGGCTGAGTCCGGGG No data
1084225311_1084225326 12 Left 1084225311 11:67711628-67711650 CCCCCCGACCTAAGACGTGGTAA No data
Right 1084225326 11:67711663-67711685 GAGGAGGGAGGCTGAGTCCGGGG No data
1084225314_1084225326 9 Left 1084225314 11:67711631-67711653 CCCGACCTAAGACGTGGTAAACT No data
Right 1084225326 11:67711663-67711685 GAGGAGGGAGGCTGAGTCCGGGG No data
1084225315_1084225326 8 Left 1084225315 11:67711632-67711654 CCGACCTAAGACGTGGTAAACTG No data
Right 1084225326 11:67711663-67711685 GAGGAGGGAGGCTGAGTCCGGGG No data
1084225317_1084225326 4 Left 1084225317 11:67711636-67711658 CCTAAGACGTGGTAAACTGAGGC No data
Right 1084225326 11:67711663-67711685 GAGGAGGGAGGCTGAGTCCGGGG No data
1084225312_1084225326 11 Left 1084225312 11:67711629-67711651 CCCCCGACCTAAGACGTGGTAAA No data
Right 1084225326 11:67711663-67711685 GAGGAGGGAGGCTGAGTCCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084225326 Original CRISPR GAGGAGGGAGGCTGAGTCCG GGG Intergenic
No off target data available for this crispr