ID: 1084227710

View in Genome Browser
Species Human (GRCh38)
Location 11:67727647-67727669
Sequence AAGGGCCTATTGAACTCCGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084227710_1084227717 8 Left 1084227710 11:67727647-67727669 CCCCCGGAGTTCAATAGGCCCTT No data
Right 1084227717 11:67727678-67727700 ATCATGGTCCATGCACTTGAAGG No data
1084227710_1084227714 -8 Left 1084227710 11:67727647-67727669 CCCCCGGAGTTCAATAGGCCCTT No data
Right 1084227714 11:67727662-67727684 AGGCCCTTTTCTTTCTATCATGG No data
1084227710_1084227718 9 Left 1084227710 11:67727647-67727669 CCCCCGGAGTTCAATAGGCCCTT No data
Right 1084227718 11:67727679-67727701 TCATGGTCCATGCACTTGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084227710 Original CRISPR AAGGGCCTATTGAACTCCGG GGG (reversed) Intergenic
No off target data available for this crispr