ID: 1084236575

View in Genome Browser
Species Human (GRCh38)
Location 11:67791506-67791528
Sequence CTGCAGTTTCGGAAGTGATC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084236572_1084236575 -9 Left 1084236572 11:67791492-67791514 CCGGGTGGGCCGGGCTGCAGTTT No data
Right 1084236575 11:67791506-67791528 CTGCAGTTTCGGAAGTGATCAGG No data
1084236566_1084236575 9 Left 1084236566 11:67791474-67791496 CCACAAATGATGCTGGAGCCGGG No data
Right 1084236575 11:67791506-67791528 CTGCAGTTTCGGAAGTGATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084236575 Original CRISPR CTGCAGTTTCGGAAGTGATC AGG Intergenic
No off target data available for this crispr