ID: 1084238789

View in Genome Browser
Species Human (GRCh38)
Location 11:67805290-67805312
Sequence TGGCGCCCGAGGAGAACGCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084238789_1084238796 -10 Left 1084238789 11:67805290-67805312 CCCCGCGTTCTCCTCGGGCGCCA No data
Right 1084238796 11:67805303-67805325 TCGGGCGCCATGACGTGGGCGGG No data
1084238789_1084238797 -9 Left 1084238789 11:67805290-67805312 CCCCGCGTTCTCCTCGGGCGCCA No data
Right 1084238797 11:67805304-67805326 CGGGCGCCATGACGTGGGCGGGG No data
1084238789_1084238806 26 Left 1084238789 11:67805290-67805312 CCCCGCGTTCTCCTCGGGCGCCA No data
Right 1084238806 11:67805339-67805361 CCGGAGACCGGGCGGAAGCCAGG No data
1084238789_1084238801 14 Left 1084238789 11:67805290-67805312 CCCCGCGTTCTCCTCGGGCGCCA No data
Right 1084238801 11:67805327-67805349 CCGCAGCGTTGCCCGGAGACCGG 0: 1
1: 4
2: 2
3: 4
4: 69
1084238789_1084238802 15 Left 1084238789 11:67805290-67805312 CCCCGCGTTCTCCTCGGGCGCCA No data
Right 1084238802 11:67805328-67805350 CGCAGCGTTGCCCGGAGACCGGG 0: 1
1: 6
2: 2
3: 3
4: 66
1084238789_1084238803 18 Left 1084238789 11:67805290-67805312 CCCCGCGTTCTCCTCGGGCGCCA No data
Right 1084238803 11:67805331-67805353 AGCGTTGCCCGGAGACCGGGCGG 0: 1
1: 4
2: 5
3: 3
4: 68
1084238789_1084238799 7 Left 1084238789 11:67805290-67805312 CCCCGCGTTCTCCTCGGGCGCCA No data
Right 1084238799 11:67805320-67805342 GGCGGGGCCGCAGCGTTGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084238789 Original CRISPR TGGCGCCCGAGGAGAACGCG GGG (reversed) Intergenic