ID: 1084238926

View in Genome Browser
Species Human (GRCh38)
Location 11:67805690-67805712
Sequence CAGGATAAGGGTCCTGGAGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084238921_1084238926 -10 Left 1084238921 11:67805677-67805699 CCTTGCGTGGGGGCAGGATAAGG No data
Right 1084238926 11:67805690-67805712 CAGGATAAGGGTCCTGGAGGCGG No data
1084238915_1084238926 3 Left 1084238915 11:67805664-67805686 CCTGGAGTCGGGGCCTTGCGTGG No data
Right 1084238926 11:67805690-67805712 CAGGATAAGGGTCCTGGAGGCGG No data
1084238911_1084238926 18 Left 1084238911 11:67805649-67805671 CCAGGTTGGAGGCGTCCTGGAGT No data
Right 1084238926 11:67805690-67805712 CAGGATAAGGGTCCTGGAGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084238926 Original CRISPR CAGGATAAGGGTCCTGGAGG CGG Intergenic
No off target data available for this crispr