ID: 1084253659

View in Genome Browser
Species Human (GRCh38)
Location 11:67922954-67922976
Sequence CTGTGTTTAAGGTGAGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084253659_1084253666 12 Left 1084253659 11:67922954-67922976 CCCTCTTCTCACCTTAAACACAG No data
Right 1084253666 11:67922989-67923011 TCCCATCATTCCAACCCTTGGGG No data
1084253659_1084253664 10 Left 1084253659 11:67922954-67922976 CCCTCTTCTCACCTTAAACACAG No data
Right 1084253664 11:67922987-67923009 CTTCCCATCATTCCAACCCTTGG No data
1084253659_1084253665 11 Left 1084253659 11:67922954-67922976 CCCTCTTCTCACCTTAAACACAG No data
Right 1084253665 11:67922988-67923010 TTCCCATCATTCCAACCCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084253659 Original CRISPR CTGTGTTTAAGGTGAGAAGA GGG (reversed) Intergenic
No off target data available for this crispr