ID: 1084255843

View in Genome Browser
Species Human (GRCh38)
Location 11:67942107-67942129
Sequence CTGATTCTCATTTGTGTCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084255843_1084255855 28 Left 1084255843 11:67942107-67942129 CCAGAGACACAAATGAGAATCAG No data
Right 1084255855 11:67942158-67942180 GACCACAGTCTTGAAGGGGAAGG No data
1084255843_1084255848 4 Left 1084255843 11:67942107-67942129 CCAGAGACACAAATGAGAATCAG No data
Right 1084255848 11:67942134-67942156 AGGCATGGCCCTGGTCCTCACGG No data
1084255843_1084255853 23 Left 1084255843 11:67942107-67942129 CCAGAGACACAAATGAGAATCAG No data
Right 1084255853 11:67942153-67942175 ACGGTGACCACAGTCTTGAAGGG No data
1084255843_1084255854 24 Left 1084255843 11:67942107-67942129 CCAGAGACACAAATGAGAATCAG No data
Right 1084255854 11:67942154-67942176 CGGTGACCACAGTCTTGAAGGGG No data
1084255843_1084255852 22 Left 1084255843 11:67942107-67942129 CCAGAGACACAAATGAGAATCAG No data
Right 1084255852 11:67942152-67942174 CACGGTGACCACAGTCTTGAAGG No data
1084255843_1084255847 -5 Left 1084255843 11:67942107-67942129 CCAGAGACACAAATGAGAATCAG No data
Right 1084255847 11:67942125-67942147 ATCAGGAACAGGCATGGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084255843 Original CRISPR CTGATTCTCATTTGTGTCTC TGG (reversed) Intergenic
No off target data available for this crispr