ID: 1084255852

View in Genome Browser
Species Human (GRCh38)
Location 11:67942152-67942174
Sequence CACGGTGACCACAGTCTTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084255843_1084255852 22 Left 1084255843 11:67942107-67942129 CCAGAGACACAAATGAGAATCAG No data
Right 1084255852 11:67942152-67942174 CACGGTGACCACAGTCTTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084255852 Original CRISPR CACGGTGACCACAGTCTTGA AGG Intergenic
No off target data available for this crispr