ID: 1084256588

View in Genome Browser
Species Human (GRCh38)
Location 11:67947035-67947057
Sequence GTGCAGATCTGGAGGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084256588_1084256607 25 Left 1084256588 11:67947035-67947057 CCTTCCACCCTCCAGATCTGCAC No data
Right 1084256607 11:67947083-67947105 TGGCCCTGGCTCCTGCCCCGGGG No data
1084256588_1084256597 11 Left 1084256588 11:67947035-67947057 CCTTCCACCCTCCAGATCTGCAC No data
Right 1084256597 11:67947069-67947091 CCCCCAATGCCCCCTGGCCCTGG No data
1084256588_1084256605 23 Left 1084256588 11:67947035-67947057 CCTTCCACCCTCCAGATCTGCAC No data
Right 1084256605 11:67947081-67947103 CCTGGCCCTGGCTCCTGCCCCGG No data
1084256588_1084256593 5 Left 1084256588 11:67947035-67947057 CCTTCCACCCTCCAGATCTGCAC No data
Right 1084256593 11:67947063-67947085 AACCACCCCCCAATGCCCCCTGG No data
1084256588_1084256606 24 Left 1084256588 11:67947035-67947057 CCTTCCACCCTCCAGATCTGCAC No data
Right 1084256606 11:67947082-67947104 CTGGCCCTGGCTCCTGCCCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084256588 Original CRISPR GTGCAGATCTGGAGGGTGGA AGG (reversed) Intergenic
No off target data available for this crispr