ID: 1084257393

View in Genome Browser
Species Human (GRCh38)
Location 11:67952456-67952478
Sequence GCTGTTGGTCAGACACACCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084257386_1084257393 17 Left 1084257386 11:67952416-67952438 CCAAATACCTAGGAGAGACTTTT No data
Right 1084257393 11:67952456-67952478 GCTGTTGGTCAGACACACCCTGG No data
1084257390_1084257393 -10 Left 1084257390 11:67952443-67952465 CCCTCCAGGAAGAGCTGTTGGTC No data
Right 1084257393 11:67952456-67952478 GCTGTTGGTCAGACACACCCTGG No data
1084257387_1084257393 10 Left 1084257387 11:67952423-67952445 CCTAGGAGAGACTTTTCTCTCCC No data
Right 1084257393 11:67952456-67952478 GCTGTTGGTCAGACACACCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084257393 Original CRISPR GCTGTTGGTCAGACACACCC TGG Intergenic
No off target data available for this crispr