ID: 1084258119

View in Genome Browser
Species Human (GRCh38)
Location 11:67956101-67956123
Sequence CTGTGTCTTGCATGATTTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084258115_1084258119 -4 Left 1084258115 11:67956082-67956104 CCTTGTCTTTGCTCTTACCCTGT No data
Right 1084258119 11:67956101-67956123 CTGTGTCTTGCATGATTTGGAGG No data
1084258113_1084258119 5 Left 1084258113 11:67956073-67956095 CCACAGCCACCTTGTCTTTGCTC No data
Right 1084258119 11:67956101-67956123 CTGTGTCTTGCATGATTTGGAGG No data
1084258110_1084258119 26 Left 1084258110 11:67956052-67956074 CCCCGAGAGGGTGGACATCAGCC No data
Right 1084258119 11:67956101-67956123 CTGTGTCTTGCATGATTTGGAGG No data
1084258111_1084258119 25 Left 1084258111 11:67956053-67956075 CCCGAGAGGGTGGACATCAGCCA No data
Right 1084258119 11:67956101-67956123 CTGTGTCTTGCATGATTTGGAGG No data
1084258114_1084258119 -1 Left 1084258114 11:67956079-67956101 CCACCTTGTCTTTGCTCTTACCC No data
Right 1084258119 11:67956101-67956123 CTGTGTCTTGCATGATTTGGAGG No data
1084258112_1084258119 24 Left 1084258112 11:67956054-67956076 CCGAGAGGGTGGACATCAGCCAC No data
Right 1084258119 11:67956101-67956123 CTGTGTCTTGCATGATTTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084258119 Original CRISPR CTGTGTCTTGCATGATTTGG AGG Intergenic
No off target data available for this crispr