ID: 1084259110

View in Genome Browser
Species Human (GRCh38)
Location 11:67963300-67963322
Sequence TCCAGCCGGCAGGCAAGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084259110_1084259128 28 Left 1084259110 11:67963300-67963322 CCAGCACTTGCCTGCCGGCTGGA No data
Right 1084259128 11:67963351-67963373 CCGCACTAGGAGCTGCCGGATGG No data
1084259110_1084259123 15 Left 1084259110 11:67963300-67963322 CCAGCACTTGCCTGCCGGCTGGA No data
Right 1084259123 11:67963338-67963360 GGGCTTGGTGGCCCCGCACTAGG No data
1084259110_1084259120 -5 Left 1084259110 11:67963300-67963322 CCAGCACTTGCCTGCCGGCTGGA No data
Right 1084259120 11:67963318-67963340 CTGGAGTTCTGGGTGGGGGTGGG No data
1084259110_1084259119 -6 Left 1084259110 11:67963300-67963322 CCAGCACTTGCCTGCCGGCTGGA No data
Right 1084259119 11:67963317-67963339 GCTGGAGTTCTGGGTGGGGGTGG No data
1084259110_1084259121 0 Left 1084259110 11:67963300-67963322 CCAGCACTTGCCTGCCGGCTGGA No data
Right 1084259121 11:67963323-67963345 GTTCTGGGTGGGGGTGGGCTTGG No data
1084259110_1084259118 -9 Left 1084259110 11:67963300-67963322 CCAGCACTTGCCTGCCGGCTGGA No data
Right 1084259118 11:67963314-67963336 CCGGCTGGAGTTCTGGGTGGGGG No data
1084259110_1084259122 3 Left 1084259110 11:67963300-67963322 CCAGCACTTGCCTGCCGGCTGGA No data
Right 1084259122 11:67963326-67963348 CTGGGTGGGGGTGGGCTTGGTGG No data
1084259110_1084259124 24 Left 1084259110 11:67963300-67963322 CCAGCACTTGCCTGCCGGCTGGA No data
Right 1084259124 11:67963347-67963369 GGCCCCGCACTAGGAGCTGCCGG No data
1084259110_1084259116 -10 Left 1084259110 11:67963300-67963322 CCAGCACTTGCCTGCCGGCTGGA No data
Right 1084259116 11:67963313-67963335 GCCGGCTGGAGTTCTGGGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084259110 Original CRISPR TCCAGCCGGCAGGCAAGTGC TGG (reversed) Intergenic
No off target data available for this crispr