ID: 1084260791

View in Genome Browser
Species Human (GRCh38)
Location 11:67977320-67977342
Sequence CCTTATATCCAGAGGGAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084260784_1084260791 17 Left 1084260784 11:67977280-67977302 CCAATATCGCAGGGGGTGTACAC No data
Right 1084260791 11:67977320-67977342 CCTTATATCCAGAGGGAGAGAGG No data
1084260783_1084260791 18 Left 1084260783 11:67977279-67977301 CCCAATATCGCAGGGGGTGTACA 0: 162
1: 699
2: 1290
3: 1803
4: 1767
Right 1084260791 11:67977320-67977342 CCTTATATCCAGAGGGAGAGAGG No data
1084260786_1084260791 -8 Left 1084260786 11:67977305-67977327 CCCTGTGAAAATCTTCCTTATAT No data
Right 1084260791 11:67977320-67977342 CCTTATATCCAGAGGGAGAGAGG No data
1084260785_1084260791 -7 Left 1084260785 11:67977304-67977326 CCCCTGTGAAAATCTTCCTTATA No data
Right 1084260791 11:67977320-67977342 CCTTATATCCAGAGGGAGAGAGG No data
1084260787_1084260791 -9 Left 1084260787 11:67977306-67977328 CCTGTGAAAATCTTCCTTATATC No data
Right 1084260791 11:67977320-67977342 CCTTATATCCAGAGGGAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084260791 Original CRISPR CCTTATATCCAGAGGGAGAG AGG Intergenic
No off target data available for this crispr