ID: 1084261663

View in Genome Browser
Species Human (GRCh38)
Location 11:67983065-67983087
Sequence ATGCACACCCACTGCTATCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084261663_1084261668 9 Left 1084261663 11:67983065-67983087 CCAAGATAGCAGTGGGTGTGCAT No data
Right 1084261668 11:67983097-67983119 GATATTCCTCCTAATATTCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084261663 Original CRISPR ATGCACACCCACTGCTATCT TGG (reversed) Intergenic
No off target data available for this crispr