ID: 1084261668

View in Genome Browser
Species Human (GRCh38)
Location 11:67983097-67983119
Sequence GATATTCCTCCTAATATTCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084261662_1084261668 10 Left 1084261662 11:67983064-67983086 CCCAAGATAGCAGTGGGTGTGCA No data
Right 1084261668 11:67983097-67983119 GATATTCCTCCTAATATTCCCGG No data
1084261663_1084261668 9 Left 1084261663 11:67983065-67983087 CCAAGATAGCAGTGGGTGTGCAT No data
Right 1084261668 11:67983097-67983119 GATATTCCTCCTAATATTCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084261668 Original CRISPR GATATTCCTCCTAATATTCC CGG Intergenic
No off target data available for this crispr