ID: 1084263140

View in Genome Browser
Species Human (GRCh38)
Location 11:67991510-67991532
Sequence GAGGAGGGAGGCTGAGTCCG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 611
Summary {0: 6, 1: 1, 2: 1, 3: 64, 4: 539}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084263127_1084263140 10 Left 1084263127 11:67991477-67991499 CCCCGACCTCAGACGTGGTAAAC 0: 1
1: 5
2: 2
3: 2
4: 24
Right 1084263140 11:67991510-67991532 GAGGAGGGAGGCTGAGTCCGGGG 0: 6
1: 1
2: 1
3: 64
4: 539
1084263126_1084263140 11 Left 1084263126 11:67991476-67991498 CCCCCGACCTCAGACGTGGTAAA 0: 1
1: 5
2: 2
3: 3
4: 37
Right 1084263140 11:67991510-67991532 GAGGAGGGAGGCTGAGTCCGGGG 0: 6
1: 1
2: 1
3: 64
4: 539
1084263129_1084263140 8 Left 1084263129 11:67991479-67991501 CCGACCTCAGACGTGGTAAACTG 0: 1
1: 5
2: 1
3: 3
4: 65
Right 1084263140 11:67991510-67991532 GAGGAGGGAGGCTGAGTCCGGGG 0: 6
1: 1
2: 1
3: 64
4: 539
1084263128_1084263140 9 Left 1084263128 11:67991478-67991500 CCCGACCTCAGACGTGGTAAACT 0: 1
1: 5
2: 4
3: 3
4: 61
Right 1084263140 11:67991510-67991532 GAGGAGGGAGGCTGAGTCCGGGG 0: 6
1: 1
2: 1
3: 64
4: 539
1084263131_1084263140 4 Left 1084263131 11:67991483-67991505 CCTCAGACGTGGTAAACTGAGGC 0: 1
1: 5
2: 2
3: 14
4: 122
Right 1084263140 11:67991510-67991532 GAGGAGGGAGGCTGAGTCCGGGG 0: 6
1: 1
2: 1
3: 64
4: 539
1084263125_1084263140 12 Left 1084263125 11:67991475-67991497 CCCCCCGACCTCAGACGTGGTAA 0: 1
1: 4
2: 1
3: 0
4: 38
Right 1084263140 11:67991510-67991532 GAGGAGGGAGGCTGAGTCCGGGG 0: 6
1: 1
2: 1
3: 64
4: 539

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084263140 Original CRISPR GAGGAGGGAGGCTGAGTCCG GGG Exonic
900128274 1:1077507-1077529 GTGGGGGGAGGCTGAGTCTATGG + Intergenic
900316544 1:2060011-2060033 GAGGAAGGAGAGTGAGTCCCGGG + Intronic
900705225 1:4076295-4076317 GAGGTGGGAGGCTGGGACTGTGG + Intergenic
901181919 1:7347758-7347780 GAGGATGGAGGCAGAGGCTGGGG - Intronic
901445847 1:9307697-9307719 GAGGATGGTGGCTGAGTCTCTGG - Intronic
901739650 1:11333917-11333939 GGGGAGGGAGGCAGAGGCAGCGG + Intergenic
901798783 1:11695135-11695157 GAGCAGGGATGATGAGTCTGAGG + Intronic
902334402 1:15746806-15746828 GAGCAGGGAGGTCCAGTCCGGGG + Intronic
902466872 1:16624023-16624045 GGCCAGGGAGGCTGAGTCCCAGG - Intergenic
902507728 1:16948751-16948773 GGCCAGGGAGGCTGAGTCCCAGG + Intronic
902532285 1:17098134-17098156 GAGCAGGCAGCCGGAGTCCGAGG - Intronic
902612163 1:17603632-17603654 GGGGAGGGAGGCTGGGACTGGGG + Intronic
902659020 1:17888423-17888445 GAGGTGGGAGGTTGCATCCGTGG - Intergenic
902769847 1:18639535-18639557 GAGGAGGGAGTCTAAGTGCATGG - Intronic
904288433 1:29468684-29468706 GAGGTCTGAGGCTGAGGCCGTGG + Intergenic
904425835 1:30422428-30422450 GAGGAGAGAGGCTCAGGCCAGGG + Intergenic
904597777 1:31657539-31657561 AAGGAGGGAGGCAGGGTCCTTGG + Intronic
905463073 1:38134004-38134026 GAGGAGGGAGGCGGCGGCCGGGG + Intergenic
905595812 1:39205596-39205618 GAGGAGGAAGGGTCAGTCAGTGG + Intronic
905852701 1:41285972-41285994 GAGGAGGGAGAGTGAGTAGGAGG + Intergenic
907560171 1:55380840-55380862 GAGGAGGGAGGAGGAGTTCACGG - Intergenic
907922910 1:58929888-58929910 GGGCGGGGAGGCTGAGTCAGCGG - Intergenic
908416586 1:63918777-63918799 GAGGCATGAGGCTGAGTGCGTGG + Intronic
908581946 1:65525645-65525667 GAGGAGGGCAGCCGAGTGCGTGG - Intronic
910508567 1:87977938-87977960 GTTGAGGGAGGGTGAGTCTGTGG + Intergenic
911387327 1:97193708-97193730 GAGGAGGGAGACAGAGGCAGGGG - Intronic
911502288 1:98702962-98702984 GAGGGGGGATGCAGAGTCCTTGG - Intronic
911507159 1:98767527-98767549 GAAGTGGGAGGCTGAGGCAGAGG + Intergenic
914255754 1:145960554-145960576 GCGGAAGGAGGCGGAGTCCGGGG - Exonic
914753269 1:150549679-150549701 GGGGAGGGAGTCTGATCCCGTGG + Intronic
914760866 1:150596947-150596969 TACTAGGGAGGCTGAGTCAGGGG + Intergenic
914824997 1:151133533-151133555 GAGGAGGGAGGCTCAGCCAAGGG + Intronic
914825507 1:151135957-151135979 GAGGAGGGTGGCTGAGAACAGGG + Intronic
915507739 1:156368182-156368204 GCGGAGGGAGGCTGAATGCAAGG - Intergenic
915587884 1:156854163-156854185 GGCGAGGGAAGCTGAGGCCGCGG + Exonic
915895723 1:159809342-159809364 GAGGAGGGAGCCAGGGTCCTGGG + Intronic
916183219 1:162105936-162105958 TAGGAAGGGGGCTGAGTCAGGGG - Intronic
920308227 1:205032466-205032488 GAGGATGGAGGCTGAGTCGTTGG - Intergenic
920331515 1:205211574-205211596 GAGGAGGGAGGCCGGGCCTGCGG - Intergenic
920401480 1:205679369-205679391 GAAGATGGAGGCTGATTCAGAGG + Intronic
920997495 1:211009522-211009544 AAGGAGGGAAGCAGAGTACGTGG + Intronic
921070517 1:211654398-211654420 AGGGAGGGAGGCTGAGGCTGGGG + Intergenic
922471819 1:225881814-225881836 GAGGAGGGAGGCTGGGGACTCGG - Intronic
922583948 1:226719877-226719899 TGGGAGGCAGGCTGAGTCCCTGG + Intronic
1062832180 10:613282-613304 TAGGTGGGAGGCGGAGGCCGAGG - Intronic
1062916143 10:1242333-1242355 GAGGAGGGAGACGGGGGCCGTGG - Intronic
1062934359 10:1374954-1374976 CAGGAGGCAGGCTGGGGCCGGGG + Intronic
1063052701 10:2470322-2470344 ACGGAGGGAGGCTGAGGCTGAGG - Intergenic
1063426247 10:5952302-5952324 GAGTAGGAAGGCAGAGTCCAAGG - Intronic
1065456966 10:25916980-25917002 CAGGAGGGAGGCTGACTCCCAGG - Intergenic
1066237713 10:33502488-33502510 GAGGAGGGAGGCAAACTCAGAGG - Intergenic
1067234337 10:44435690-44435712 GAGGAGGGAGCCTGGGGACGAGG - Intergenic
1067375885 10:45727378-45727400 GAGAAGAGAGGCTGAGCCTGAGG - Intronic
1067427477 10:46220853-46220875 GAGGAAGGTGGCTGACTCGGAGG + Intergenic
1068228690 10:54140790-54140812 GAGGACTGAGGCTGAGGCAGGGG - Intronic
1068283724 10:54909367-54909389 TGGGAGGGAGGCTGAGACAGGGG - Intronic
1069777631 10:70936148-70936170 AAGGAGGGTGGCTGAGGCCAAGG - Intergenic
1069789887 10:71012808-71012830 GAGGAGGCAGGGTCATTCCGTGG - Intergenic
1069982240 10:72260769-72260791 GGGGAGGGAGGGAGAGGCCGAGG - Intergenic
1070631318 10:78086738-78086760 CAGGAGGCAGGTTGAGTTCGTGG + Intergenic
1070988294 10:80707642-80707664 GGTGAGGGAGGCTGAGTCCCTGG + Intergenic
1072119868 10:92396780-92396802 GAGGAGGGAGGTGGAGGCTGAGG + Intergenic
1072325053 10:94289313-94289335 CAGGAGAGAAGCTGAGTCTGGGG - Intronic
1072554177 10:96502202-96502224 GGGGAGGGAGGCTGAGTCATAGG + Intronic
1072916248 10:99538943-99538965 TAGGAGGGAGGCTAAGACCTTGG + Intergenic
1074769873 10:116726341-116726363 GAGGAGGGAGACAGAGACAGAGG - Intronic
1075407741 10:122205720-122205742 GCGGATGGAGGCGGAGTCTGGGG + Intronic
1075519872 10:123136876-123136898 GAGAAGGGACGCCGAGTCCTGGG - Intronic
1075897124 10:126006398-126006420 GAGGCAGAAGGCTGAGTCAGTGG + Intronic
1075948088 10:126454991-126455013 GAAGAGGGAGGCTGACACCCAGG - Intronic
1076043316 10:127269994-127270016 GAGGAGGCAGGTGGAGTCCCCGG - Intronic
1076178660 10:128388108-128388130 GGAGGGGGAGGCTGAGTCAGGGG + Intergenic
1076405079 10:130206385-130206407 GATGAGTGAGGCTGAGTCACTGG + Intergenic
1076483864 10:130803081-130803103 GGGGCGGGTGGCTCAGTCCGTGG + Intergenic
1076903967 10:133353126-133353148 GAGGAGGGTGGCCGAGTGCCTGG + Intergenic
1077060486 11:615772-615794 GGGGAGGGAGGCGGAGGCGGAGG - Intronic
1077217268 11:1400223-1400245 GGGGCGGGAGACTGAGTCCACGG - Intronic
1077274348 11:1696672-1696694 GAGGATGGAGGCAGAGACGGGGG + Intergenic
1077332889 11:1991052-1991074 CAGGCGGGAGGCCGGGTCCGCGG - Intergenic
1077361211 11:2140860-2140882 GAAGCTGGAGGCTGCGTCCGCGG + Exonic
1077482768 11:2824275-2824297 GAGGAGGGAGGCTAGGCCCAGGG + Intronic
1077523259 11:3048841-3048863 AAGGAGGGAGGCTGGGGCCTGGG - Intronic
1078389123 11:10920494-10920516 GAGGAGAGAGGCAGAGGCAGAGG - Intergenic
1078596792 11:12694098-12694120 AAGGCGGCAGGCTGAGTCCGGGG + Intronic
1079234861 11:18680959-18680981 GAGGAGGGAAGCTGAGGCCGTGG + Intergenic
1080382745 11:31790910-31790932 GAGGAGGGAGCCTGGGGCTGTGG - Intronic
1081584101 11:44372353-44372375 GGTGAGGGAGGCTGAGGCCTGGG - Intergenic
1081613132 11:44575382-44575404 GAGGTGGGAAGATGAGTCAGTGG + Intronic
1081773934 11:45665312-45665334 GAGGAGGGAGGCCGAGGAGGAGG - Exonic
1082669798 11:56020893-56020915 GAGGAGGGAGGAGGAGAACGAGG + Intergenic
1082813024 11:57490016-57490038 GAGGAGGAAGGCTCAGTGCCAGG + Intronic
1083746807 11:64741552-64741574 GTGGAGGGAGGCTGGGGGCGGGG + Intronic
1084189952 11:67494368-67494390 GAGGAGAGGGCGTGAGTCCGCGG + Intronic
1084225326 11:67711663-67711685 GAGGAGGGAGGCTGAGTCCGGGG + Intergenic
1084263140 11:67991510-67991532 GAGGAGGGAGGCTGAGTCCGGGG + Exonic
1084487745 11:69460690-69460712 GAAAAGGGAGGCTGATTCAGAGG + Intergenic
1084611962 11:70208975-70208997 GAGGGGTGAGGCTGAGGCTGGGG - Intergenic
1084679233 11:70656429-70656451 GCTGAGGGAGGCTGAAGCCGAGG - Intronic
1084810254 11:71607611-71607633 GAGGAGGGAGGCTGAGTCCGTGG - Intergenic
1085640571 11:78190046-78190068 AAGGAGGGAGGCTGGCTTCGAGG + Intronic
1087327525 11:96741964-96741986 CAGGAGTGAGGCTGAGTGGGAGG - Intergenic
1088745592 11:112801530-112801552 GAGGAGGTTGGCAGAGTCTGGGG - Intergenic
1088919169 11:114249127-114249149 CAGGAGGGAGGCAGGGTCCAGGG + Intronic
1090090708 11:123695147-123695169 GAGGAGGGAGGGAGAGTAGGTGG - Intergenic
1090285553 11:125496135-125496157 GCGGAGGGAGGCGGATCCCGGGG + Exonic
1090664448 11:128905475-128905497 GGGGAGGGAGGCTGGGACGGGGG - Intronic
1091238012 11:134034461-134034483 GAGGGGAGAGGCTGAGGCTGGGG - Intergenic
1091274581 11:134341944-134341966 GTGCTGGGTGGCTGAGTCCGGGG - Intronic
1202815872 11_KI270721v1_random:46228-46250 CAGGCGGGAGGCCGGGTCCGCGG - Intergenic
1091381800 12:66759-66781 GGGGAGGGAGGCTGGGCCGGTGG + Exonic
1091666209 12:2420227-2420249 GAGGAGGGAGGTTCAGTTAGTGG - Intronic
1091712732 12:2753223-2753245 CGGGAGGGAGGCTGGGCCCGTGG - Intergenic
1091790184 12:3267781-3267803 GAGGAGGCAGCCTGAGGCCCCGG - Intronic
1092040671 12:5381178-5381200 GAGGAGGGGGTTTGAGTCCAGGG - Intergenic
1092169509 12:6364215-6364237 GAGGAGGGAGGCGGGGTGGGTGG - Intronic
1092285953 12:7129444-7129466 TAGGAGGGAGGTGGAGCCCGAGG + Intergenic
1093728395 12:22541977-22541999 GAGGAAGGGGGCTGATTCAGGGG - Intronic
1095303505 12:40614312-40614334 TAGGAAGGGGGCTGAGTCCAGGG - Intergenic
1096538508 12:52290148-52290170 GCGGCGGGAGGCCGAGTGCGTGG - Exonic
1096540271 12:52303216-52303238 GCGGCGGGAGGCCGAGTGCGTGG + Exonic
1096543089 12:52319226-52319248 GCGGCGGGAGGCCGAGTGCGTGG - Exonic
1096546590 12:52344337-52344359 GCGGCGGGAGGCTGAGTGCGTGG + Intergenic
1096549882 12:52365032-52365054 GCGGCGGGAGGCCGAGTGCGTGG - Exonic
1096599222 12:52717684-52717706 GAGGAGCTAGGCCGAGGCCGAGG - Intergenic
1096614523 12:52824215-52824237 GAGGAGCCGGGCTGAGGCCGAGG - Exonic
1097284441 12:57866721-57866743 GAGGCAGGAGGCAGAGTCCCTGG + Intergenic
1097290219 12:57908203-57908225 GAGGTAGGAGGCAGAGTCTGAGG + Intergenic
1098029117 12:66236207-66236229 GAGGAGGGAGGATGAGGATGAGG + Intronic
1101827843 12:108234356-108234378 CAGGAGGGAGGCAGAGACTGGGG + Intronic
1102757086 12:115350556-115350578 GCGAAGGGAGGCAGAATCCGTGG - Intergenic
1102888271 12:116537831-116537853 GCAGATGGAGGCTGAGCCCGAGG - Intergenic
1103649617 12:122422575-122422597 GAGGCGGGAGGCGGCGGCCGCGG - Intronic
1103818239 12:123676168-123676190 TATGAGGGAGGCTGAGGTCGGGG + Intronic
1103832442 12:123790563-123790585 GAGGAAGGAGGCTGAGACAGCGG + Intronic
1103932386 12:124457603-124457625 GAGGAGGGAGGGTGAGATAGAGG + Intronic
1104092131 12:125526135-125526157 GAGGAGGGAGGCTGGTAACGGGG - Intronic
1104375920 12:128266038-128266060 GAGAGGGGATGCTGAGCCCGTGG + Intergenic
1104533425 12:129594771-129594793 GAGAGGGGAGGGGGAGTCCGTGG - Intronic
1104636127 12:130438674-130438696 GAGGTGGGAGGGTGGGGCCGGGG + Intronic
1104959059 12:132479600-132479622 GAGGGAGGATGCTGAGGCCGTGG - Intergenic
1105031418 12:132887176-132887198 GAGGTGCGGGGCTGAGGCCGGGG - Exonic
1105943624 13:25171520-25171542 CAGGAGGAAGGCGGAGGCCGGGG - Exonic
1106065467 13:26344037-26344059 GAGGAGGGAGGGTGAGGTTGGGG - Intronic
1107945277 13:45412483-45412505 GAGGAAAGAGGCTGACTCTGGGG + Intronic
1108755604 13:53498295-53498317 GAGGTGGGAGACTGAGGCAGAGG + Intergenic
1111553351 13:89846480-89846502 GAGGAGGGAGGCAATGTCCTTGG - Intergenic
1112041505 13:95552665-95552687 GAGGCGGGAGGCGGAGCCCCGGG + Intronic
1112471316 13:99692399-99692421 TACTAGGGAGGCTGAGGCCGGGG - Intronic
1112496763 13:99911414-99911436 GAGGGAGGAGGCTGAATCAGAGG - Intergenic
1113357894 13:109600800-109600822 GAAGAGGGATGCTGAGACCGTGG + Intergenic
1113654087 13:112057343-112057365 GGGGAGGGAGGTCGAGTCTGTGG + Intergenic
1113759913 13:112840171-112840193 GAGTGGGGAGGCTGAGGCTGGGG - Intronic
1113759980 13:112840394-112840416 GAGTAAGGAGGCTGAGGCAGGGG - Intronic
1113760000 13:112840459-112840481 GAGTAGGGAGGCTGAGGCTGGGG - Intronic
1113760021 13:112840524-112840546 GAGTAGGGAGGCTGAGGCTGGGG - Intronic
1113807105 13:113116304-113116326 GAGGTGGCAGGCTGAGTCCCAGG - Intronic
1114270945 14:21099574-21099596 GAGGAGGGAGGCAGGGTCCTGGG - Intronic
1114332360 14:21650374-21650396 CAGGAGGAAGGCTGAGTTGGAGG - Intergenic
1115988512 14:39127450-39127472 TACTAGGGAGGCTGAGGCCGGGG - Intronic
1117383840 14:55191832-55191854 GAGGGGTGAGGCTGGGTCCCTGG + Intergenic
1118347886 14:64952810-64952832 GAGGAGGGAGAGTGAATCTGGGG + Intronic
1119757313 14:77128238-77128260 GAGGAAGGAGGCAGGGTCCATGG + Intronic
1121905233 14:97735217-97735239 AGGGAGGGAGGCTGAGGCAGGGG - Intergenic
1122084394 14:99289804-99289826 TAGGAGGGAGTCTGAGGCCAGGG + Intergenic
1122123214 14:99565599-99565621 CAGGAGGGAGGCTGGGAGCGGGG + Intronic
1122530256 14:102420371-102420393 GTGGATGGTGGCTGAGTCGGGGG + Intronic
1122574198 14:102731559-102731581 GAGGAGGAAGGTTGAGGCCAAGG + Intergenic
1122826689 14:104374116-104374138 GAGGACAGAGGCAGAGTCGGGGG - Intergenic
1122922609 14:104886192-104886214 GAAGAGGCAGCCTGTGTCCGTGG - Intronic
1122979489 14:105185231-105185253 GAGGACGGAGGCAGAGTCGGGGG - Intergenic
1123038002 14:105479091-105479113 GAGGAGTGAGGCCGAGCCCCGGG - Intronic
1123986582 15:25651698-25651720 GCTGAGGGAGGCTGAGGCAGGGG - Intergenic
1124057475 15:26255352-26255374 GAAGAGGCAGGCTGAGGCAGGGG - Intergenic
1125436019 15:39645861-39645883 CAGGAGGCAGACAGAGTCCGGGG + Intronic
1126849035 15:52786624-52786646 GGGGAGGGAGCCTGAGTGCTGGG - Intronic
1127812130 15:62573574-62573596 GAGGAGGGAAGCTGGGTGCATGG - Intronic
1127863234 15:63011728-63011750 GCTGAGGGAGGCTGAGGCCAGGG + Intergenic
1127931986 15:63602861-63602883 GAGGAGGGAAGCTGAGTAGCAGG + Intergenic
1128004577 15:64226444-64226466 GACTAGGGAGGCTGAGGCAGGGG + Intronic
1128091157 15:64919844-64919866 GAGGAGGGAAGCAGAGGCTGGGG - Intronic
1128511956 15:68318842-68318864 GAGGACAGAGGCTGTGTCTGAGG + Intronic
1128647492 15:69388120-69388142 GAGGAGGGAGGCAGGGGCAGAGG - Intronic
1129714349 15:77838249-77838271 GAGGTGGGAGGCTGAGAGCAGGG - Intergenic
1130512445 15:84600898-84600920 CAGGAGGGAGGCTGGGCCCAAGG - Intergenic
1130932250 15:88437880-88437902 GAGGAGCTAGGCTGGCTCCGGGG + Intergenic
1131252334 15:90838758-90838780 AAGCAGGGACGCTGAGTCCCTGG + Intergenic
1131258640 15:90877227-90877249 GAGAAGGGAGGCAGAGACCGGGG - Intronic
1131279045 15:91006253-91006275 GAGAGGGGAGGCTGAGTCTATGG - Intronic
1132387230 15:101409167-101409189 AAGCAGGGAGGCTGAGCGCGGGG + Intronic
1132577041 16:668915-668937 CAGGAGGGAGGGAGAGCCCGCGG - Intronic
1132748058 16:1445160-1445182 GAGGAGGGAGGCTGAGGGGCGGG + Exonic
1132809449 16:1790558-1790580 CAGGTGGGGGCCTGAGTCCGGGG + Exonic
1132828147 16:1915030-1915052 GAGGAGGGAGGCTGAGATGGAGG - Intronic
1132942951 16:2517342-2517364 GAGGAAGGAGGCTGGGACCTGGG - Intronic
1132972721 16:2696744-2696766 GAGGAGGCAGGCAGATGCCGAGG - Intronic
1133402860 16:5501468-5501490 GGGGAGGCAGGCTGAATCCTGGG + Intergenic
1134090126 16:11387078-11387100 GAGGAGGGCGGCACAGCCCGGGG + Intronic
1135020855 16:18961842-18961864 GAGGAGGCAGGCTGATTCCCAGG - Intergenic
1135590928 16:23704906-23704928 GAAGAGGGTGGCTGTGTCCCGGG + Exonic
1135591999 16:23711691-23711713 GAGGAGGGAGACTGAGGCTCAGG + Intronic
1135607305 16:23835928-23835950 GGGGAGGGAGGCGGAGCCCCGGG - Intergenic
1135752569 16:25068768-25068790 GAGGAGAGAGGGTGTGTCTGGGG - Intergenic
1136027865 16:27481560-27481582 GAGGAAGGAGGCTGACTACATGG - Intronic
1136190236 16:28611027-28611049 GAGGAGGGAGGAGGGGTCCATGG - Intronic
1136228983 16:28876145-28876167 ATGGAGGGAGGCTGAGCCAGAGG - Intergenic
1136334319 16:29601551-29601573 GAGGCAGGAGGCTGAGGCAGGGG - Intergenic
1136499691 16:30664249-30664271 GAGGGGGGAGGCTGAGCCACGGG - Exonic
1136585097 16:31179656-31179678 GACGAGGGAGGCTGGAGCCGCGG + Intergenic
1136613646 16:31382174-31382196 GAGAAGGGAGACTGAGGCCTGGG - Intronic
1136990939 16:35151088-35151110 CAGCAGGGAGGCTGAGACCTGGG - Intergenic
1137246432 16:46709742-46709764 GAGTAGGAAGCCTGAGTCAGTGG + Intronic
1137298952 16:47127533-47127555 GAAGAGGGAGGCTGAGACTGAGG + Intronic
1137402314 16:48163583-48163605 TAGTTGGGAGGCTGAGTCAGGGG + Intergenic
1137617679 16:49856873-49856895 GAGGGGGGAGGCGGCGGCCGCGG + Intronic
1138023445 16:53503982-53504004 GAGGGGGGAGGCTGAGGACCAGG + Intronic
1138459196 16:57138066-57138088 GAGGAGCAGGGCTGAGTCAGGGG - Intronic
1138491451 16:57379483-57379505 GGGGAGGGAGGCTGAGTCAAAGG + Intronic
1138527277 16:57616381-57616403 GAGCAGAGAGGCTGAGCCCGCGG + Intronic
1138588319 16:57985583-57985605 GAGGAGGGAGGATGAGGTCTGGG + Intronic
1139346465 16:66306919-66306941 GGGGAGGGAGCCTGGGTGCGGGG + Intergenic
1141470464 16:84234877-84234899 GAGCAGGGAGGCTGAGGACGGGG - Intronic
1141585025 16:85027989-85028011 GGGGAGGGAGGAGGGGTCCGCGG + Intronic
1141754950 16:85984667-85984689 GGGCATGAAGGCTGAGTCCGGGG + Intergenic
1142252132 16:88996814-88996836 GAAGAGGGAGGCGGAGATCGTGG - Intergenic
1142299227 16:89247129-89247151 TAGGCGGGGGGCTGAGTCAGAGG - Intergenic
1142312782 16:89323586-89323608 GGGCAGGGGGGCTGAGCCCGGGG + Intronic
1142323874 16:89401803-89401825 GAAGAGGGAGGCGGAGATCGTGG + Intronic
1142693762 17:1622082-1622104 AAGGAGGGAGGCTGGGGCGGTGG + Intronic
1142734867 17:1890551-1890573 TACTAGGGAGGCTGAGGCCGGGG + Intronic
1143007375 17:3845904-3845926 GAGGAGGGAGCCAGCGTCCTGGG - Intronic
1143019235 17:3908076-3908098 GTGGAGGTGGGCTGAGTCCTGGG - Intronic
1143154632 17:4828483-4828505 TAGGTGGGAGGCTGAGGCAGGGG - Intergenic
1143631826 17:8144158-8144180 GAGGAAGCAGGGTGAGTCCATGG + Intronic
1143709625 17:8725367-8725389 GAGGAGGGGGGCTGATCCCAAGG + Intergenic
1143837274 17:9702270-9702292 GAGATAGGAGGCTGAGGCCGTGG + Intronic
1144042850 17:11428447-11428469 AAGGAGGGAGGCTGAGCATGAGG + Intronic
1144129176 17:12229303-12229325 CAGGAGGGAGGCTGAGCTCTTGG + Intergenic
1144408087 17:14972239-14972261 GAAGAGGGAGACTGGGTTCGAGG - Intergenic
1144517445 17:15928450-15928472 GAGCAGGGAGGCTGAGCATGGGG + Intergenic
1144624264 17:16836788-16836810 GAGGAAGGAGGCAGGGTGCGGGG - Intergenic
1144882165 17:18435931-18435953 GAGGAAGGAGGCAGGGTGCGGGG + Intergenic
1145150068 17:20508455-20508477 GAGGAAGGAGGCAGGGTGCGGGG - Intergenic
1145278731 17:21453423-21453445 GAGGAGGGTGGCTGTGTCCCAGG + Intergenic
1145399121 17:22517062-22517084 GAGGAGGGTGGCTGTGTCCCAGG - Intergenic
1146185459 17:30721370-30721392 GAGGAGGGAGGCAGAGATGGGGG - Intergenic
1146283792 17:31560944-31560966 GAGGAGGGAGGGTGAGAGGGAGG + Intergenic
1146928014 17:36758297-36758319 GAGAAGGGAGGGTGGGTCCTAGG + Intergenic
1146931298 17:36780040-36780062 TGGGAGGGAGGGTGAGTCCATGG + Intergenic
1147239793 17:39083253-39083275 GAGGAGGGAGCCTGAGTAGCTGG + Intronic
1147460942 17:40568631-40568653 TAGGAAGGAGGCTGAATCCAGGG + Intergenic
1147907560 17:43832939-43832961 GAAGAGGGAGGCGGGGGCCGAGG + Intronic
1147997952 17:44371573-44371595 GAGAAGGCAGGCTGTGTCCTTGG - Intergenic
1148081165 17:44968309-44968331 GAGGCGGGAGGCGGCGGCCGCGG - Intergenic
1148146380 17:45367576-45367598 GATGAGGGAGGCTGAGGCTGAGG - Intergenic
1148192284 17:45687993-45688015 GAGGTGGGAGGCTGGGTGAGAGG + Intergenic
1148325225 17:46779443-46779465 GAGGAGGGTGGCAGGGTCCTAGG - Intronic
1148775171 17:50091160-50091182 GTGGAGGGAGGCTGGGTGCAAGG + Intergenic
1148788916 17:50162079-50162101 CAGGAGTGAGGCGGAGGCCGGGG + Intergenic
1148790367 17:50169257-50169279 GAGGAGGGACCCTGGGTCCGGGG + Intronic
1150520800 17:65865576-65865598 GGGGAGGGAGGTTGAGGCCGTGG - Intronic
1150650341 17:67005975-67005997 GGTGAGGCAGGCTGAGTCCAAGG + Intronic
1151448340 17:74181839-74181861 GAGGAGGGAGGCAGAGGCTGGGG - Intergenic
1151618170 17:75228333-75228355 GTGGAGAGAGGCTGAGACTGGGG - Intronic
1152246350 17:79186621-79186643 GCGGAGGGAGGCTGCGTGCTGGG + Intronic
1152425601 17:80216973-80216995 GAGTAGACAGGCTGCGTCCGGGG - Intronic
1152945904 17:83197239-83197261 AAGGACGGATGCTGAGTCAGTGG + Intergenic
1153226388 18:2903171-2903193 GAGGAGGGAGGGTGGGGCTGGGG + Intronic
1153415540 18:4841957-4841979 GAGGATGCAGGCTGAGTCTTAGG + Intergenic
1153654792 18:7272939-7272961 GGCGAGGGAGGCTGAGTCTGAGG + Intergenic
1154095793 18:11413812-11413834 AAGGAGGGAGGCTGAGAGGGAGG - Intergenic
1155030411 18:21979022-21979044 GAGCAGGGCCGCTGTGTCCGTGG + Intergenic
1156365795 18:36426008-36426030 GGGGAGGGAGGCTGAGGCAGAGG - Intronic
1156519244 18:37707749-37707771 GAGGAGGAAGGAGCAGTCCGGGG - Intergenic
1157223140 18:45841231-45841253 GAGGATGGAGGCTGGGGCCTGGG + Intronic
1157638800 18:49190780-49190802 GAGGAGGGAGGACGAGTAGGGGG - Intronic
1158308077 18:56128221-56128243 GAGGAAGGAGACTGAGTTTGGGG - Intergenic
1160205086 18:76824839-76824861 GGAGAGGGAGGCTGGGTCAGAGG - Intronic
1160378536 18:78431504-78431526 GTGGATGGAGGCAGAGTCCCTGG - Intergenic
1160500959 18:79400856-79400878 GAGGAGGATGGCTGAGGCGGAGG - Intronic
1160564471 18:79778508-79778530 GGGGCCGGAGGCTGAGGCCGAGG + Intergenic
1160698184 19:494572-494594 GAGGAGGGAAACTGAGGCCCGGG - Intronic
1160698250 19:494788-494810 GAGGAGGGAAACTGAGGCCCAGG - Intronic
1160698277 19:494866-494888 GAGGAGGGAAACTGAGGCCCAGG - Intronic
1160698303 19:494944-494966 GAGGAGGGAAACTGAGGCCCAGG - Intronic
1160698317 19:494983-495005 GAGGAGGGAAACTGAGGCCCAGG - Intronic
1161149969 19:2702509-2702531 GAGGAGGGGGGCTGGGTCTGGGG - Intronic
1161196851 19:2991645-2991667 GAGAAGGGAGGCTGAGGGCTGGG + Intronic
1161249332 19:3271699-3271721 GAGGAGGGAAGCTGAGGGGGTGG + Intronic
1161286545 19:3471315-3471337 GGGGAGGGAGGCTGGGGCCCGGG + Intergenic
1161289032 19:3483080-3483102 GAGGAGGGTGGCCGGGGCCGGGG - Intergenic
1161319584 19:3634739-3634761 GAGCATGGAGGCAGAGCCCGAGG - Intronic
1161716827 19:5880850-5880872 CAGGAGGGAGGCTGGGGCCCCGG + Intronic
1161960791 19:7522113-7522135 GTGGAGGGAGGCTGAGATCGGGG + Intergenic
1162180961 19:8868384-8868406 GAGGAAGAATGCTGAGTCCTTGG - Intronic
1162421656 19:10568935-10568957 GAGGAGGGAGGGTGAGTTAGGGG - Exonic
1162973317 19:14194326-14194348 GAGGAGGGAGGCAGAGATGGGGG + Intronic
1163293172 19:16394060-16394082 GAGGTGGGTGGCTGTGTCCAAGG - Intronic
1163309264 19:16503319-16503341 AAGGAGTGAGGCTGAGACTGTGG + Exonic
1163479800 19:17548392-17548414 GAGGGAGGAGGCTGAGGCCCCGG + Intronic
1163648965 19:18506083-18506105 TTGGAGGGAGGCTGGGTCAGTGG - Intronic
1163660393 19:18573634-18573656 GGGGAGGGAGGCTCAGTTAGAGG - Intronic
1163831823 19:19550660-19550682 AAGGAGGGAGGCTGGGGCCCAGG - Intergenic
1164693284 19:30226241-30226263 GAGGGGGTAGGCTGGGGCCGCGG + Intergenic
1164934988 19:32203097-32203119 GAGAAGGGAGGCTGGTCCCGGGG + Intergenic
1165102597 19:33447660-33447682 GAGGACGGTGGCTGAGTGGGTGG + Intronic
1165502177 19:36198487-36198509 GTAGAGGGAGGCTGAGTGGGAGG + Intronic
1165781650 19:38438116-38438138 GAGGAGGGAGTCTGGGTGCTGGG - Intronic
1166294479 19:41882430-41882452 GAGGAGAGAGGCTGAGACCCAGG + Intergenic
1166310397 19:41959164-41959186 GAGGAGGGAGGAGGGGGCCGGGG + Intronic
1166380781 19:42354073-42354095 GAGGATGCAGGCTGGGTCAGGGG - Intronic
1166559087 19:43720068-43720090 GTGGAGGGAGCCTGTGTCCCTGG + Intergenic
1166803742 19:45472981-45473003 GAGGAGGGAGGGCGAGTTCAGGG - Exonic
1166998268 19:46730142-46730164 GAGCAGGAGGGCTGAGTCCAGGG - Intronic
1167105954 19:47429961-47429983 GAGAAGGGAGGCCGAGTCCCAGG + Exonic
1167242249 19:48351364-48351386 GAGGAGGGTGGCTGAGACCAAGG - Intronic
1167264053 19:48474665-48474687 GTGGAGGGAGGCTGAGGTGGCGG - Intronic
1167482216 19:49740034-49740056 GAGGAAGGAGGCTGAGGGCATGG - Intronic
1167492934 19:49802292-49802314 GAGCAGGGAGGCTGGGGCAGGGG - Intronic
1168083053 19:54024416-54024438 TAGCAGGGAGGCTGAGGCAGGGG - Intergenic
1168147720 19:54429276-54429298 GGGGAGGGAGGATCAGCCCGGGG - Intronic
1168156133 19:54473809-54473831 CAGGTGGGAGGCTGGGTCAGCGG + Intergenic
1168292359 19:55362781-55362803 CAGGAGGGAGGCTCAGGCTGTGG - Intronic
1168487567 19:56777425-56777447 GATGATGGAGGCTGAGGCCGTGG - Intronic
925160329 2:1678811-1678833 GAGGGCGGAGTCTGGGTCCGGGG + Intronic
925222522 2:2153530-2153552 GAGGAGGAAGGCAGAGGCTGGGG + Intronic
925858226 2:8150855-8150877 GAGGAGAGAGGCTCAGGCTGGGG + Intergenic
925871805 2:8278217-8278239 GAGGTGGGAGGGTGAGGCTGTGG - Intergenic
926686005 2:15698059-15698081 CAGGAGGGAGGGTGAGGCAGAGG + Intronic
927174969 2:20399462-20399484 GAGGTGGGAGGCAGAGTGGGTGG + Intergenic
928121687 2:28588287-28588309 GAGGATGTTGGCTGAGTCCTGGG - Intronic
928924975 2:36568186-36568208 GAGGAGGGAGACAGAGTGGGAGG + Intronic
929588470 2:43130596-43130618 GAGGTGAGGGGCTGAGTCCCAGG + Intergenic
929761116 2:44807237-44807259 AAGGAGGGAGGCAGGGTCCTCGG + Intergenic
930027024 2:47035129-47035151 GAGCAGGGGGGATGAGTCCCGGG + Intronic
930872385 2:56183105-56183127 AAGGAGGAAGTCTGAGTCCCTGG - Intergenic
931431772 2:62214239-62214261 GAGCAGGGAGGGTGTGTCCAGGG + Intronic
931674067 2:64676135-64676157 CAGGTGGGAGGGTGAGTCAGAGG - Intronic
931763732 2:65436796-65436818 GAGGAGGGAGGCGGGGGCAGGGG - Intergenic
932054788 2:68433050-68433072 CAGGAGGGAGGCTGAGTTGGGGG - Intergenic
932157998 2:69435860-69435882 GAGTTGGGAGGCTGAGGCAGGGG - Intronic
932221130 2:69999875-69999897 GAGGAAGGAGGAGGAGCCCGGGG - Intergenic
932887108 2:75558522-75558544 GAGAGGGGAGGCTGAGGCTGAGG + Intronic
933441720 2:82323127-82323149 GATGTGGGAGGCTGAGGCAGGGG + Intergenic
933476890 2:82802968-82802990 TAGGAGAGAGGCTGAGTCCAGGG + Intergenic
934158009 2:89221252-89221274 AAGGAGGAAGGCTGTGTCTGAGG + Intergenic
934209256 2:89961172-89961194 AAGGAGGAAGGCTGTGTCTGAGG - Intergenic
934655141 2:96113392-96113414 GAGCAGCGTGGCTGGGTCCGAGG + Exonic
934987855 2:98900351-98900373 GAGGATGGAGGCTCAGTGGGAGG + Intronic
934987877 2:98900413-98900435 GAGGATGGAGGCTCAGTGGGAGG + Intronic
935916286 2:107954478-107954500 GAGGAAGGAGGTTGAGGCTGGGG + Intergenic
937375832 2:121335112-121335134 GAGGAGGTGGGCTGAGCCTGCGG + Intergenic
937871442 2:126789158-126789180 GAGGAGGGAGGGAGAGACTGGGG - Intergenic
938066281 2:128283653-128283675 GAGGAGCGAGGGGGAGGCCGAGG - Intronic
938189671 2:129264951-129264973 CAGGAGGGAGGCTGAGGTCGTGG + Intergenic
938399922 2:130982106-130982128 GACTAGGGAGGCTGAGGCAGGGG - Intronic
941095499 2:161237000-161237022 GAGAAGGGAGGCTGGGTGGGCGG - Intergenic
942054785 2:172172525-172172547 GAGGAGGGAAGCTGCTCCCGCGG + Intergenic
942276311 2:174326479-174326501 GAGGAGGGAGCCTGCGTGCTGGG + Intergenic
943580170 2:189674783-189674805 GGAGAGGGACGCTGCGTCCGCGG - Intronic
946117767 2:217478539-217478561 AAGGAGAGAAACTGAGTCCGAGG - Intronic
946153175 2:217789789-217789811 GGTGGGGGAGGCTGAGTTCGAGG - Intergenic
946189976 2:218003017-218003039 GAGGAGGGAGGGTGAGCTGGAGG - Intergenic
946551665 2:220808060-220808082 TAGTAGGGAGGCTGAGGCAGGGG + Intergenic
947098372 2:226592167-226592189 TAGGAAGGGGGCTGAGTCCAGGG - Intergenic
947140303 2:227014133-227014155 GAGGAGGAAGATTGAGTCCAGGG - Intronic
947603544 2:231469120-231469142 CGGGAGGGAGGCTGAGGCAGGGG - Intronic
947834654 2:233166623-233166645 GAGGAGGGAGGCTGGCCCCAGGG - Intronic
948068716 2:235102580-235102602 GAGGGGGGAGGCAGAGTAGGAGG - Intergenic
948249353 2:236513210-236513232 GAGGAAGGAGCCTGGGTCCTTGG - Intergenic
948589570 2:239040378-239040400 AGGGGTGGAGGCTGAGTCCGAGG + Intergenic
948661305 2:239508173-239508195 GAGAAGGGAGGCTGGGTCCCAGG - Intergenic
948992998 2:241564154-241564176 GAGCGGGAAGGCTGAGTCCAGGG + Intronic
949008653 2:241666089-241666111 GAGGAGCCAGGCTGATTCCAGGG - Intronic
1168799390 20:634587-634609 GAGGAGGAAGGCTGGGTCTGTGG + Intergenic
1169026408 20:2375124-2375146 GGGGAGGGAGCCTGAGGCTGTGG - Intergenic
1170998692 20:21391790-21391812 GAGGAAGGAGGGTGCGCCCGAGG - Intergenic
1172197553 20:33102438-33102460 GAGATGGGAGGCTGAGGCCGGGG - Intronic
1172272636 20:33663307-33663329 CAGAAAGGAGGCGGAGTCCGGGG + Intronic
1172702693 20:36862903-36862925 GAGCAGCGACGCCGAGTCCGCGG - Exonic
1172803661 20:37596270-37596292 GAAGCGGGAGGTTGAGTCAGGGG - Intergenic
1172997705 20:39083378-39083400 AAGGAGGGAGGATGAGGCTGAGG - Intergenic
1174631785 20:51964628-51964650 GAGGAGAGAGGCTGGGTAAGAGG + Intergenic
1175221868 20:57421800-57421822 GAGGAGGCAGGCAGTGTCAGAGG - Intergenic
1175496684 20:59419351-59419373 GAGGAGGGAGGCAGGGCCTGGGG + Intergenic
1175789407 20:61732010-61732032 GAGGACAGAGTCTGAGTCCAAGG - Intronic
1175799916 20:61795728-61795750 AAGGAGGGAGGCTGGGCCCCAGG + Intronic
1175960144 20:62631730-62631752 GGGGAGTGAGGTTGAGGCCGTGG + Intergenic
1176062579 20:63178819-63178841 GAGGGGGGAGCCTGCGGCCGGGG + Intergenic
1176112199 20:63415844-63415866 GAGGAGGGAGGCTGCTTCCTGGG - Intronic
1176283404 20:64328074-64328096 GGGGAGGGAGGCTGGGCCGGTGG - Intergenic
1176312078 21:5157084-5157106 GAGGAAGGAGGCACAGACCGGGG - Intergenic
1179030721 21:37717486-37717508 GTGGAGGGAGGCAGAGGCCATGG + Intronic
1179292396 21:40030188-40030210 GAGCAGGGAGGCTGAGAGGGAGG - Intronic
1179844970 21:44104946-44104968 GAGGAAGGAGGCACAGACCGGGG + Exonic
1179947324 21:44687106-44687128 GAAGAAGGAGGCTGAGCCTGGGG + Intronic
1180941775 22:19664132-19664154 GGGGAGGGAGGCGGAGTCCCAGG - Intergenic
1181314510 22:21962718-21962740 GAGGAGGAAGGCTGGGCCCGTGG + Intronic
1181644376 22:24222978-24223000 GAGGCGGGAGGATGAGGCAGGGG + Intronic
1181690185 22:24554967-24554989 GAGGACGGAGGCGGAGGCAGCGG - Intronic
1181942862 22:26492255-26492277 GAGGCGGGAGGCTGAGAACATGG - Exonic
1181959946 22:26615894-26615916 GAGGAGGGAGGAGGAGGCCAAGG + Intronic
1182116933 22:27761956-27761978 GCGGGGGGAGGCTGAGTCCTAGG + Intronic
1183296698 22:37034029-37034051 GAGGAGACAGGCTGAGTGCTGGG - Intergenic
1183524955 22:38317362-38317384 GAGGAGGGAGGCGGCGGCGGCGG - Exonic
1183544740 22:38449426-38449448 CAGGAGGGAAGCTGAGTGCCAGG - Intronic
1183619352 22:38963638-38963660 GGGGAGGGGAGCTGAGTCCCGGG + Intronic
1183624499 22:38993233-38993255 GGGGAGGGGAGCTGAGTCCCGGG + Intergenic
1183640240 22:39088249-39088271 GGGGAGGGGAGCTGAGTCCCAGG + Intergenic
1184257871 22:43297265-43297287 GAGGCTGGAGGCTGAGACCCAGG - Intronic
1184775759 22:46621914-46621936 GAGGAGGGTGGTGGAGTCAGTGG + Intronic
1184783189 22:46659231-46659253 GAGGGGGGAGGCTGAGGGAGTGG - Intronic
1184915774 22:47567940-47567962 GAGGCGGGAGGCTGGATCAGGGG + Intergenic
1185206287 22:49541091-49541113 GAGGAGCGAGGCCGGGTTCGGGG - Intronic
1185208839 22:49555376-49555398 GAGGACGGAGGCGGAGATCGGGG + Intronic
1185258877 22:49850548-49850570 AAGGAGGGTGGCTGTGTCCCTGG - Intergenic
1185316211 22:50180307-50180329 GTGGAGGGAGGCGAAGTCCCCGG - Intergenic
949136036 3:566588-566610 TACGAGGGAGGCTGAGGCAGGGG + Intergenic
949980507 3:9499544-9499566 GAGGAGGGAGGCTAGTTCCCTGG - Exonic
950017960 3:9767613-9767635 GCTGAGGGAGGCTGAGTCCAGGG - Intronic
950154821 3:10713583-10713605 GAGGAGGGCTGCTAAGTCCAGGG + Intergenic
950421952 3:12904572-12904594 GAGGAGGGAGGCCATGTCCTGGG - Intronic
950464964 3:13148282-13148304 GAGGAGGGAGGCCTGGTACGGGG + Intergenic
950587369 3:13904169-13904191 TAGGAAGGGGGCTGAGTCTGGGG + Intergenic
950610925 3:14126014-14126036 CAGGAGGGAGGGTGTGTCTGGGG - Intronic
950795354 3:15505992-15506014 GAGGAGGGAGGCTGGGTTCCTGG + Intronic
952616369 3:35278312-35278334 TAGGAAGGAGGCTGAGTCCAGGG + Intergenic
953752413 3:45618810-45618832 CAGGAGGGAGGCTGTGGACGTGG + Intronic
953901501 3:46846340-46846362 GCCGAGGGAGGCTGAGCCCTGGG + Intergenic
954107895 3:48419147-48419169 CAGGAGGAGGGCAGAGTCCGAGG - Intronic
954275586 3:49539797-49539819 GAAGAGGGAGACAGTGTCCGCGG + Intergenic
954367509 3:50154521-50154543 TAGGCTGGAGGCTGAGCCCGCGG + Intergenic
954945245 3:54418401-54418423 GAGGAGGAAGGCTGGGCCAGAGG + Intronic
955687369 3:61561304-61561326 GAGGAGGGAGGCTGCCTTCTGGG - Intergenic
957078579 3:75619447-75619469 GAGGAGGGAGGCTGAGTCCGGGG + Intergenic
959502714 3:107124951-107124973 AGGGAGGGATGCTGAGTCCAAGG + Intergenic
959698942 3:109279987-109280009 AATAAGGGAGGCTGAGGCCGGGG + Intergenic
960333634 3:116391724-116391746 GAGCATGGGGGCTGAGCCCGGGG + Intronic
960955469 3:123027754-123027776 GAGCAGGGAGGAGGAGACCGCGG + Intronic
961644562 3:128385799-128385821 GAGGCAGGAGGCTGAGGCCTGGG + Intronic
961770741 3:129248311-129248333 GAGGCAGGAGGCTGAGGCAGAGG - Intergenic
962256151 3:133871608-133871630 GTGGAGGGAGGCAGTGTCAGTGG - Intronic
962600781 3:136989544-136989566 GAGGAGGGAGCCTGGTGCCGAGG + Exonic
963899711 3:150722466-150722488 GAGGTGGGAGGATGAGGCCAAGG - Intergenic
964024651 3:152058003-152058025 GAGGTGGGAGGCTGAGGCGGGGG - Intergenic
966454737 3:180102197-180102219 TAGGAAGGGGGCTGAATCCGGGG + Intergenic
967283132 3:187841790-187841812 AAGGAGGGAGGGTGACTCAGAGG - Intergenic
968230546 3:197002770-197002792 TGGGAGGGAGGCCGAGCCCGGGG - Exonic
968470650 4:781020-781042 GGGGAGGGTGGCTAAGCCCGAGG + Intergenic
968488795 4:878798-878820 GAGGTGGGAGGCAGACTCTGGGG - Intronic
968539095 4:1154069-1154091 GGGGAGGGAGGCTGGGTGTGGGG + Intergenic
968592363 4:1465471-1465493 GGAGAGGGAGGATGCGTCCGTGG + Intergenic
968611229 4:1558073-1558095 GAGGCGTGAGGCTGAGCCCTGGG - Intergenic
968818366 4:2833207-2833229 GAGGAGGGAGGCTGAGCAGGAGG - Intronic
969021662 4:4143420-4143442 GAGGAGGGAGGCTGAGTCCGGGG + Intergenic
969601890 4:8181766-8181788 GAGGAGAGAGGCTGGGCCCTAGG - Intergenic
969732206 4:8963995-8964017 GAGGAGGGAGGCTGAGTCCGGGG - Intergenic
970664294 4:18319283-18319305 GAGGCGGGAGGCTGCGCCCAGGG + Intergenic
970694763 4:18664206-18664228 GGGGAGGGAGTCTGAATACGAGG + Intergenic
970899165 4:21138757-21138779 GAGGTGGGAGGCTGAGTGTCAGG + Intronic
973283651 4:48390182-48390204 TAAGAGGGAGGCTGAGGCAGGGG - Intronic
975105384 4:70562535-70562557 GAGGAGGGAGACAGTGTCCGAGG - Intergenic
975712633 4:77175574-77175596 GAGGAGGGAGGAGGAGCCTGTGG - Intronic
977571401 4:98633031-98633053 GAGGATGGAGGCTCAGACCAGGG + Intronic
979576054 4:122293691-122293713 TAGGAAGGAGGCTGAATCCAGGG + Intronic
982632386 4:157847114-157847136 GGGGATGGAGGCAGAGTCCTGGG - Intergenic
982892853 4:160877561-160877583 CAGCTGTGAGGCTGAGTCCGGGG - Intergenic
983000613 4:162409310-162409332 AGGGAGGGAGGTTGAGGCCGTGG + Intergenic
984066426 4:175053799-175053821 CAGGATGTAGGCTGAGTCCCAGG + Intergenic
984169478 4:176343484-176343506 CAGGAGGGAGGCTGAGGTGGGGG - Intergenic
985580750 5:694051-694073 GAGAACGGAAGCTGAGGCCGGGG - Intergenic
985595372 5:785383-785405 GAGAACGGAAGCTGAGGCCGGGG - Intergenic
985848815 5:2373741-2373763 GATGAGGGAGGAGGAGACCGAGG + Intergenic
987065609 5:14286773-14286795 GGGGAGGGAAGCTGGGTCTGTGG + Intronic
987373939 5:17217524-17217546 GAGGAGGGAGGCTGGGCGGGCGG + Intronic
988271746 5:29026264-29026286 GAGGCAGGAGGCTGAGGCAGGGG - Intergenic
988276287 5:29085005-29085027 AATGAGGGAGGCAGAGACCGAGG + Intergenic
988702176 5:33686222-33686244 GGGGAGGGAGGCTGAGCCTGCGG - Intronic
988816461 5:34839317-34839339 GAGCTGGGAGGCTGGTTCCGGGG + Intronic
990310156 5:54530103-54530125 GAGGAGGGAGGCACAGACTGAGG - Intronic
990461819 5:56037758-56037780 GAGGAGCAAGGCTGAGGCAGAGG - Intergenic
990731267 5:58811781-58811803 GTGGAGGGAGGGTGGGTCTGGGG - Intronic
992098356 5:73382227-73382249 GGGGAGGGAGGCTGGGTACCGGG + Intergenic
992369676 5:76130043-76130065 GAGAAGGGAGGCTGAGGATGGGG - Intronic
992502253 5:77354731-77354753 GAGGAGCAAGGCTGAGTTGGTGG - Intronic
992595905 5:78347222-78347244 GGTGAGGGAGGCTCAGTCCCAGG - Intergenic
992888375 5:81181750-81181772 GAGGAGGGGAGCTGAGGCCAGGG - Intronic
993493942 5:88586630-88586652 TAGGAAGGAGGCTGAGTCCAGGG + Intergenic
996900459 5:128537722-128537744 GAGCAGGGAGCCCGAGCCCGAGG - Exonic
997205221 5:132044180-132044202 TAGGAAGGAGGCTGAATCCAGGG - Intergenic
997340249 5:133139362-133139384 GACTAGGGAGGCTGAGGCAGGGG - Intergenic
997475250 5:134138923-134138945 GAGGAGAGAAGCTGAGTGAGTGG - Intronic
997673881 5:135697945-135697967 GAGGTGGGAGCCTGGGTCAGAGG - Intergenic
998135073 5:139670173-139670195 GAGGCGGGAGGCTGAGGAGGAGG - Intronic
998498595 5:142612735-142612757 GAGCAGGAAGGCTGAGGCTGGGG - Intronic
998827237 5:146114932-146114954 TAGTAGGGAGGCTGAGGCAGTGG + Intronic
999790831 5:154938099-154938121 GGGGAGGGCGGCAGCGTCCGCGG + Exonic
1000876012 5:166639118-166639140 GAGGAGGGCTGCTGTGTCCAGGG - Intergenic
1001409841 5:171503161-171503183 GAGGAGGGACCCTGAGTTAGGGG + Intergenic
1001686197 5:173596700-173596722 GAAGAGTGAGGCTGAGCCCACGG - Intergenic
1001831634 5:174793965-174793987 AGGGAGGGAGGCTTAGTCCCGGG + Intergenic
1002633894 5:180597787-180597809 GAGGAAGGAGGCTGAGGAAGGGG + Intergenic
1002635947 5:180608892-180608914 GAGGAGGGAGGCTGGGGTCTGGG - Intronic
1002874418 6:1199154-1199176 AAGGAGGGAGGCTGACTATGAGG - Intergenic
1002890486 6:1327422-1327444 GAGGTGGGAGGCTGAGGCAGGGG - Intergenic
1003198809 6:3939828-3939850 GAGCAGGGACGCTGAGCCCAGGG + Intergenic
1004181201 6:13381793-13381815 GAGGAGGGTGGCTGAGGGCTTGG - Intronic
1005300200 6:24463015-24463037 GAAGAGGAAGGCTGAGTCTGGGG - Intronic
1005959495 6:30685578-30685600 GAGAAGAGAGACTAAGTCCGAGG - Exonic
1006175581 6:32119499-32119521 GGGGAGGGAGGCTGCCTCCTAGG - Intronic
1006437305 6:34032757-34032779 GGGTAGGGAGGCTGAGTTGGGGG + Intronic
1006985319 6:38172167-38172189 GAGAGTGGAGGCTCAGTCCGTGG - Exonic
1007298314 6:40845744-40845766 GAGAAGGGAGGCTGAGGTCCAGG + Intergenic
1007464397 6:42041841-42041863 GAGGAGGGAGGACCAGCCCGGGG - Intronic
1008569875 6:52806358-52806380 GAGGAGAGATGCTGAGTCCTGGG + Intergenic
1008932263 6:56953953-56953975 GGGGAGGGAGGAGGAGTCCTGGG + Intronic
1012347723 6:98212145-98212167 TAGGAGAGAGGATGAGTCCAGGG + Intergenic
1012909424 6:105102429-105102451 CTGGAGGGAGGCTGAGACAGCGG + Intronic
1014492570 6:122081048-122081070 GAGGAGGGAGTCTGATTCTAAGG + Intergenic
1014547921 6:122754363-122754385 GAGGAGGAAGGCAGAGCACGTGG - Intergenic
1015143109 6:129958102-129958124 GAGGAGTGAGGTTGAGGCTGCGG - Intergenic
1017103039 6:150865518-150865540 AGGGAGGGAGGCTGAGTCTCAGG + Intergenic
1017203023 6:151776123-151776145 GAGGAAAGAGGCTGGGTCAGAGG + Intronic
1018093112 6:160362699-160362721 GAGGAGGAAGACTGTGTCCAGGG + Intronic
1019006194 6:168798710-168798732 GAGGCTGGAGGCTGAGACCTGGG - Intergenic
1019140202 6:169938009-169938031 GAGGGAGGAGGCTGCGTCCCAGG - Intergenic
1019404612 7:877003-877025 GAGGCGGGAGTCAGAGGCCGAGG - Intronic
1019524154 7:1473226-1473248 CAGGAGGAAGGCTGGGTCAGGGG + Intronic
1019641643 7:2106590-2106612 GAGGAGGGAGGCGGTCTCCTAGG - Intronic
1019715933 7:2539404-2539426 GGGGATGGAGGCAGAGGCCGAGG - Intronic
1019716278 7:2540928-2540950 GAGGAGGGAGGCAGAGGCAGTGG - Intronic
1019729043 7:2620264-2620286 GAGGTGGGAGGATGAGGCAGGGG - Intergenic
1019740378 7:2670107-2670129 GAGGAGGAAGGGTGAGCCCCAGG + Intergenic
1020112716 7:5456489-5456511 GAGCAGGGAGGCAGAGCCTGAGG + Intronic
1020309075 7:6855450-6855472 GAGGAGCGAGGCTGAGTCCGGGG + Intergenic
1020626591 7:10589093-10589115 AAGGAGGGAGGTTGAGGCCAGGG - Intergenic
1021080573 7:16359229-16359251 CAAGAGGGAGGCTGAGGCAGAGG - Intronic
1023116186 7:36864894-36864916 GTGGAGGAAGCCTGAGTCCTAGG + Intronic
1023856037 7:44184714-44184736 CAGGAGGCAGGGTGAGTCAGTGG + Intronic
1024306381 7:47932722-47932744 GAGGAGGGAGGCTGAGAGTAAGG - Intronic
1024710608 7:52010943-52010965 GGGCAGGGAGGCAGAGTCCAAGG - Intergenic
1025017062 7:55448583-55448605 GATGACGGAGCCTGAGTCCCTGG - Intronic
1025069714 7:55887705-55887727 GAGGCGGGAGGCGGAGGCGGGGG + Intronic
1026252882 7:68685971-68685993 CAGGAGGGAGGCCGAGGCAGGGG + Intergenic
1026400913 7:70011936-70011958 GAGGAGGGAGTATGAGTCTCAGG + Intronic
1028163736 7:87514604-87514626 GAGTGGGGAGGCAGAGTCCAGGG - Intronic
1029630578 7:101747846-101747868 GAGGGTGGTGGCTGAGTCCAGGG - Intergenic
1029687712 7:102160249-102160271 GAGGAGAGAGGTGGAGTCGGTGG - Intronic
1029998076 7:105029151-105029173 TACGTGGGAGGCTGAGTCAGAGG + Intronic
1031100930 7:117479495-117479517 GAGGAGGAAGGCAGGCTCCGGGG + Intronic
1032089887 7:128906207-128906229 GAGGTGGCAGGCTGTGTCTGTGG + Intronic
1032189488 7:129755931-129755953 GAGATGGGAGGCTGAGGCCCGGG - Exonic
1032193491 7:129777462-129777484 GTGGAGGGAGGCTGGGGCCTGGG + Intergenic
1033477138 7:141702050-141702072 CAGGCGGGAGGCTGGGGCCGGGG - Exonic
1034458632 7:151186155-151186177 GTGGAGGGAGGCTGTGGCAGGGG - Intronic
1034483946 7:151344888-151344910 GAGTAGGGAGGCTGATGCAGGGG + Intronic
1035010728 7:155713355-155713377 GAGGAGGGAGTCTGTGTGTGGGG + Intronic
1035078736 7:156199015-156199037 GAGGAGGGAGAGTGAGACAGAGG + Intergenic
1035362035 7:158319873-158319895 TACGAGGGAGGCTGTGTACGAGG - Intronic
1035399508 7:158555602-158555624 GCTGAGGGAGGCTGGGTCTGGGG - Intronic
1035475712 7:159143086-159143108 GAGGAGGGAGGCAGAGGTGGGGG + Intronic
1035535460 8:387536-387558 CTCCAGGGAGGCTGAGTCCGAGG - Intergenic
1035570258 8:667898-667920 GAGGAGTGAAGGTGGGTCCGTGG - Intronic
1036635488 8:10547500-10547522 AAGGCAGGAGGCTGAGGCCGAGG - Intronic
1037297104 8:17413194-17413216 GAGGAGGGATGCTGAGCGCGCGG - Intronic
1038270183 8:26068619-26068641 GAGGAATAAGGCTGAGGCCGAGG - Intergenic
1038692495 8:29775818-29775840 GCAGAGGGAGGCTGAGACCCTGG - Intergenic
1040595483 8:48834241-48834263 GAGGGAGGACGCTGAGTCCAAGG - Intergenic
1041388620 8:57329877-57329899 GAGGAAGGTGGCTGTGGCCGAGG - Intergenic
1043400206 8:79877108-79877130 GATGAGTGAGGCTTAGTCCCTGG - Intergenic
1045354373 8:101372341-101372363 GAGAAGGGAAGCTGAGTGCCTGG + Intergenic
1045582791 8:103499374-103499396 GAGGAGGGAGGAAGGGTCCCTGG - Intergenic
1045733008 8:105263631-105263653 TAGGAAGGAGGCTGAATCCAGGG - Intronic
1046245229 8:111551178-111551200 GAGGCAGGAGGCTGAGGCAGGGG - Intergenic
1047371120 8:124256935-124256957 GGGGAAGGAGGATGAGTCTGGGG - Intergenic
1048993373 8:139774323-139774345 GAGGATGGAGGCTGGGACTGGGG + Intronic
1049409581 8:142466494-142466516 GAGGAGGGAGGCAGCGCCCCTGG + Intronic
1049537849 8:143190211-143190233 GAGGAGGGAGGCGGGGACCTGGG - Intergenic
1049641720 8:143718963-143718985 GAGGAGGCAGGCTGAGGCCCCGG - Intronic
1049826256 8:144670683-144670705 CAGGAGGGAGATTGAGTCTGGGG - Intergenic
1050349750 9:4729377-4729399 GAGGCAGGAGGCTGAGGCCCAGG + Intronic
1050550991 9:6748054-6748076 TATGAGGGAGGCTGAGGCAGGGG + Intronic
1051484215 9:17590852-17590874 GAGGAGGGAGGCTTGGGCCTGGG - Intronic
1051708363 9:19904292-19904314 GAGGAGAGAGGCAGAGGCCTTGG - Intergenic
1051783874 9:20721264-20721286 GAGGAGGGAGGCTTGGTGAGAGG - Intronic
1052751932 9:32500831-32500853 CAGGAGGAAGGCTGGTTCCGTGG - Exonic
1054352076 9:64026487-64026509 CAGGATGGAGGCTCAGTCCCAGG + Intergenic
1059023395 9:110599503-110599525 TAGGAAGGAGGCTGAATCCAGGG - Intergenic
1059423322 9:114206047-114206069 TAGGAGGGAGACTGAGTAGGAGG - Intronic
1059438326 9:114289314-114289336 CAGCAGGGAGACTGAGTCCCAGG + Intronic
1059525258 9:114985375-114985397 GAGGTGGAAGGCTGAGTCCTTGG + Intergenic
1059702031 9:116784639-116784661 GAGGAGAGAGGCTGTGTTGGGGG + Intronic
1060742084 9:126105598-126105620 GAGGAGACAGGCTGAGGCCATGG - Intergenic
1061430479 9:130527465-130527487 GTGCACGGAGGCTGACTCCGCGG - Intergenic
1061496476 9:130977744-130977766 GTGGAGGGAGGAGGAGTCCTCGG + Intergenic
1061946966 9:133913930-133913952 GAGGTGGGAGGCAGAGTCTGGGG - Intronic
1062357023 9:136169903-136169925 GAGAGGGGAGGCTGAGGACGGGG + Intergenic
1185612933 X:1402903-1402925 GAGGATGGAGGCTGCATTCGGGG - Intergenic
1188872370 X:35388707-35388729 AAGGAGGGAGACTAAGTCCTTGG + Intergenic
1191751069 X:64543300-64543322 TATGAGGGAGGCTGAGGCAGAGG - Intergenic
1193061863 X:77215324-77215346 TAGGAGAGAGGCTGAATCCAGGG - Intergenic
1193258727 X:79380159-79380181 TAGGAAGGGGGCTGAGTCTGGGG + Intergenic
1195923153 X:110002564-110002586 GAGGAGGGAGGCAGTGGCGGTGG + Intergenic
1196940782 X:120773612-120773634 GAGGATGGAGACTGAGTCGACGG - Intergenic
1197187232 X:123601403-123601425 GGGGAGGGAGGCTTAGTCAAAGG + Intronic
1197993223 X:132341262-132341284 GAGGTGGGAGGATGGGACCGGGG + Intergenic
1198311821 X:135432524-135432546 GAGGAGGGAAGCAGAGGCAGGGG - Intergenic
1199595690 X:149504454-149504476 GAGGAGGAAGCCTGAGTCCTGGG + Intronic
1199601534 X:149544093-149544115 GAGAAGGGAGGCAGAGTGGGAGG + Intronic
1199648843 X:149935391-149935413 GAGAAGGGAGGCAGAGTGGGAGG - Intronic
1200135224 X:153871469-153871491 GTGGGGGGAGGCTGAGGCTGAGG + Intronic
1200374944 X:155769833-155769855 TAGGAGGGAGGCCCAGTCAGTGG + Intronic