ID: 1084265847

View in Genome Browser
Species Human (GRCh38)
Location 11:68004721-68004743
Sequence GCCCCCATCCTGCTGGGCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 374
Summary {0: 1, 1: 0, 2: 3, 3: 40, 4: 330}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084265841_1084265847 -10 Left 1084265841 11:68004708-68004730 CCCAGAGCCACCTGCCCCCATCC 0: 1
1: 0
2: 7
3: 46
4: 510
Right 1084265847 11:68004721-68004743 GCCCCCATCCTGCTGGGCACTGG 0: 1
1: 0
2: 3
3: 40
4: 330
1084265835_1084265847 14 Left 1084265835 11:68004684-68004706 CCCTGCCACAACCATGTAGTGGG 0: 1
1: 0
2: 1
3: 7
4: 95
Right 1084265847 11:68004721-68004743 GCCCCCATCCTGCTGGGCACTGG 0: 1
1: 0
2: 3
3: 40
4: 330
1084265837_1084265847 13 Left 1084265837 11:68004685-68004707 CCTGCCACAACCATGTAGTGGGG 0: 1
1: 0
2: 0
3: 8
4: 99
Right 1084265847 11:68004721-68004743 GCCCCCATCCTGCTGGGCACTGG 0: 1
1: 0
2: 3
3: 40
4: 330
1084265839_1084265847 9 Left 1084265839 11:68004689-68004711 CCACAACCATGTAGTGGGGCCCA 0: 1
1: 0
2: 0
3: 6
4: 81
Right 1084265847 11:68004721-68004743 GCCCCCATCCTGCTGGGCACTGG 0: 1
1: 0
2: 3
3: 40
4: 330
1084265840_1084265847 3 Left 1084265840 11:68004695-68004717 CCATGTAGTGGGGCCCAGAGCCA 0: 1
1: 0
2: 1
3: 18
4: 163
Right 1084265847 11:68004721-68004743 GCCCCCATCCTGCTGGGCACTGG 0: 1
1: 0
2: 3
3: 40
4: 330

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084265847 Original CRISPR GCCCCCATCCTGCTGGGCAC TGG Intronic
900212365 1:1462411-1462433 GCCCCCTTCCTGCTCAGCCCAGG + Intronic
900266647 1:1760491-1760513 GCCCCCAGCCTCCATGGCACCGG + Intronic
900697058 1:4019080-4019102 GCCGCCATCCTGCTGTGTCCTGG + Intergenic
900840261 1:5042929-5042951 CCCACCATGCTGCTGGGCTCCGG - Intergenic
901040147 1:6358703-6358725 CCAGCCAGCCTGCTGGGCACAGG + Intronic
901493620 1:9609098-9609120 GCCGTCTTCCTGCTGGGCATGGG - Intronic
901515683 1:9744339-9744361 GCACCCACCCTACTGGACACTGG + Intronic
901801052 1:11708178-11708200 GGACCCGTCCTGCTGGGCTCCGG + Intronic
901814273 1:11785060-11785082 GGCCCCCTCCCGCAGGGCACTGG + Intronic
902118260 1:14139686-14139708 GCCCATGCCCTGCTGGGCACTGG - Intergenic
902228899 1:15014849-15014871 GCCCTCACCCTGCCTGGCACTGG + Intronic
903326179 1:22569839-22569861 GCCCCCATCCTCCTGGGGAAGGG + Intronic
903481573 1:23657274-23657296 CCTCCCAGCCTGCTAGGCACAGG - Intergenic
903732292 1:25505463-25505485 GCCTCCATCCTGCTGGGGCCTGG + Intergenic
903780617 1:25817949-25817971 CCCCCCATCCTGTCAGGCACAGG + Exonic
903846283 1:26281390-26281412 GCCGCCATCCTGCCTGGCACTGG + Exonic
904001170 1:27339584-27339606 GCCCCCATCATCCTGGCCCCTGG - Intergenic
904287366 1:29461131-29461153 GCCCCCAGCCTCCTGGTGACTGG - Intergenic
904328800 1:29744863-29744885 GCCCCCAACCTCCTGGTGACTGG - Intergenic
904417670 1:30373115-30373137 GCCCCCATCCTCCTGGTGACTGG + Intergenic
904587421 1:31587988-31588010 CCCCCTTGCCTGCTGGGCACTGG - Intergenic
904636224 1:31883765-31883787 GCCAGCATCCTGTTGGGCCCTGG + Intergenic
905483063 1:38274993-38275015 GCTCACACCATGCTGGGCACAGG + Intergenic
906211209 1:44013239-44013261 TCCCTCATCCTGCTGGGAACAGG - Intronic
907552956 1:55319689-55319711 GCCGCCAGCCTGCTGGGGTCTGG + Intergenic
910059193 1:83068373-83068395 GCCTCCATCTCCCTGGGCACAGG + Intergenic
912797327 1:112701007-112701029 GACTCCACCCTGCTGGCCACTGG + Intergenic
913340466 1:117753155-117753177 CCCCTCATCCTGCTGGGCCCTGG - Intergenic
915092523 1:153436508-153436530 GCCAGCATCCAGCTGGGCACTGG - Intergenic
915327684 1:155089231-155089253 GCCCCTATCCTGCCTGGCCCGGG - Intergenic
915368077 1:155326465-155326487 GGCCTCACTCTGCTGGGCACTGG - Intronic
917579711 1:176363272-176363294 GCCCACTTCCTGCTGGACTCAGG - Intergenic
920646989 1:207811144-207811166 GCCCCCATCTGGCTGGGCCTGGG + Intergenic
921350265 1:214227508-214227530 GCCCCCCAACTGCTGGGCTCAGG + Intergenic
922125839 1:222722415-222722437 AACAGCATCCTGCTGGGCACTGG - Exonic
922169470 1:223142931-223142953 GTCTCCAACCTGCCGGGCACAGG + Intronic
922237934 1:223735704-223735726 TCCCCCTCGCTGCTGGGCACAGG - Intronic
922421868 1:225465832-225465854 GCCCCCTTCCTGCTGGGCCTCGG - Intergenic
922570548 1:226632246-226632268 GCGCCCATTCACCTGGGCACAGG + Exonic
924813884 1:247426257-247426279 GCCCCCATGTTGCTCTGCACTGG + Intronic
1062792869 10:320950-320972 GCCCTCATCCTGCTCCGCCCGGG - Intronic
1063415448 10:5869416-5869438 GCCCCCACCTTGCTGGACACAGG - Intronic
1063428592 10:5968324-5968346 GCCCCCAGCCTGCCTGGTACAGG - Intronic
1063940515 10:11123690-11123712 ACCCCCATCCTGCTGCGCAGTGG + Intronic
1064014207 10:11760273-11760295 GTCCCAAGCCTGCTGGGCACTGG - Intronic
1064297231 10:14089458-14089480 CCCCGCAGCATGCTGGGCACAGG + Intronic
1065304036 10:24351910-24351932 GCCACCACCCTGCTGCTCACAGG + Intronic
1065433894 10:25686843-25686865 CCCCAAATCCTGGTGGGCACTGG + Intergenic
1067063236 10:43088955-43088977 CCTCCCGTCCTGCCGGGCACTGG + Intronic
1069887400 10:71632666-71632688 GCCACCACCCTGCTGTGCAGCGG + Intronic
1070577046 10:77687227-77687249 AGTCCCCTCCTGCTGGGCACTGG + Intergenic
1070889216 10:79929750-79929772 GCCCCCACCCTGCAGGGCCAGGG + Intergenic
1073069866 10:100786676-100786698 GCGCCCATGGTCCTGGGCACAGG + Intronic
1074995575 10:118754755-118754777 TCCTCCATCCTGCTGGCCCCCGG + Exonic
1075536053 10:123273273-123273295 GCCCCATGCCTGCTGTGCACAGG - Intergenic
1075679722 10:124323463-124323485 GCCCCCTTTCTGCAGGGCAGAGG - Intergenic
1075719661 10:124577291-124577313 CACCCCAGCCTCCTGGGCACAGG + Intronic
1075873542 10:125788612-125788634 ACTTCCTTCCTGCTGGGCACAGG + Exonic
1076187656 10:128461642-128461664 GCCCTGAGTCTGCTGGGCACAGG + Intergenic
1076445095 10:130509060-130509082 TCTGCCATCCTGCTGGTCACAGG + Intergenic
1076582262 10:131519830-131519852 GCGCCCTTCCTGCTGGCCGCTGG + Intergenic
1076589040 10:131570624-131570646 GCCCCCTCCCTGCTGTGCGCTGG - Intergenic
1076686581 10:132200883-132200905 GCCCACAGCCTTCTGGGCAGTGG - Exonic
1077376694 11:2208615-2208637 CCCCCTGGCCTGCTGGGCACAGG + Intergenic
1077472402 11:2770205-2770227 GCCCCCACCCATCTGGGCCCTGG + Intronic
1077484001 11:2830605-2830627 GCCCCCAGCCTGCCTGGCCCAGG - Intronic
1079093398 11:17495844-17495866 GCTCAGATTCTGCTGGGCACGGG + Intronic
1081669046 11:44933227-44933249 GCCACCACTCTGCTGGGTACAGG + Exonic
1081848842 11:46260801-46260823 GCGCCCCTCCTGCTGGGGAGTGG + Intergenic
1083436349 11:62646230-62646252 GCCCCCTTCCTGCAGTGCGCGGG - Intronic
1083813152 11:65116761-65116783 GCCCGCATCCTGCTGGGCGAGGG - Exonic
1083827146 11:65210275-65210297 TCCCCCATCCTGTTGGGCAGGGG + Intronic
1083868501 11:65471898-65471920 GCCCCCACCCTGAGGGGCACAGG + Intergenic
1083893337 11:65607802-65607824 GCCCCTAGACTGCTGGGCGCAGG - Exonic
1083923112 11:65790989-65791011 GCCCCCACCCAGCCAGGCACAGG - Intronic
1084265847 11:68004721-68004743 GCCCCCATCCTGCTGGGCACTGG + Intronic
1084477881 11:69399067-69399089 GCCCACAGCAGGCTGGGCACGGG + Intergenic
1084531359 11:69729701-69729723 GCCTCCATCCTGCAGGGTAAGGG + Intergenic
1085307494 11:75496214-75496236 CCCGCCATCCAGCTGGGCAGTGG + Intronic
1085719238 11:78898445-78898467 GCTCCCATTCTGGTGGGGACTGG + Intronic
1085719246 11:78898482-78898504 GCTCCCATTCTGGTGGGGACTGG + Intronic
1085765628 11:79279431-79279453 GCTCCCACCTTGCTGGGCTCTGG - Intronic
1086392043 11:86375180-86375202 GCCCAGGTCCTGCAGGGCACGGG - Exonic
1087253063 11:95924577-95924599 ACTCCCTTCCTGCTAGGCACGGG - Intronic
1089329396 11:117679206-117679228 GCCACAAGCCTGCTGGGCCCAGG - Intronic
1090821815 11:130349448-130349470 ACCCACATCCAGCTGGCCACTGG + Intergenic
1091493165 12:950040-950062 CCCCGCATCCTAATGGGCACTGG - Intronic
1092848820 12:12608722-12608744 GTCCCCTTACCGCTGGGCACAGG - Intergenic
1094719744 12:33052240-33052262 GCCCCCAGCATGGTGGTCACAGG - Intergenic
1096609858 12:52794018-52794040 GCCCCCTGACTGCTGGGCAGTGG - Intronic
1097996343 12:65891868-65891890 GCCTCCGTTGTGCTGGGCACGGG - Intronic
1098138387 12:67427180-67427202 TCCTCCAGCCTGCTGGGCAGAGG - Intergenic
1099932045 12:89086181-89086203 CCACCCATCCTGCTGGAAACTGG - Intergenic
1100506409 12:95225033-95225055 CCCACCATCCTGCTGGCCTCGGG + Intronic
1101866648 12:108525157-108525179 GCCCGTATGCTGCTGGTCACAGG + Intronic
1104356181 12:128089144-128089166 ATCCCCATCCTTCTGGGCTCAGG - Intergenic
1104915727 12:132263496-132263518 GCCCCCCTCCCCCTGGGCTCTGG - Intronic
1105463130 13:20610211-20610233 CCCCCCACCCTGCTTGGCAGTGG + Intronic
1106410935 13:29511120-29511142 GCACCCTTCCAGCTGTGCACAGG + Exonic
1107456862 13:40563240-40563262 GGCCTCATCCTGCTGTGCAGAGG - Intronic
1107552776 13:41492819-41492841 GCCCCAGTCCTGCTGTGAACTGG + Intergenic
1113584601 13:111456524-111456546 GCCTCCTTCCTGGTGGGCTCTGG + Intergenic
1114590882 14:23863764-23863786 GCAGCCAGCCTCCTGGGCACAGG - Intergenic
1116797645 14:49409146-49409168 GCCCACATCCTGCTAGGCACTGG + Intergenic
1117458158 14:55918395-55918417 GTCCCCAACCTTTTGGGCACCGG - Intergenic
1118270841 14:64340707-64340729 CCTCCCATCCTGCTGTGCTCAGG + Intergenic
1121498132 14:94411732-94411754 ACCCCCATCCTGCAGTGCACAGG - Intergenic
1121817354 14:96938837-96938859 ACCCCCATCCTGCTGGTCCATGG + Intergenic
1122143208 14:99674567-99674589 GTTCCCAACCTGCTGGCCACTGG + Intronic
1122399255 14:101457753-101457775 GGCTCCATCCTCCTGGGCCCAGG - Intergenic
1122842794 14:104474658-104474680 TCCCCCATCCTCCTGGCCCCTGG - Intronic
1122898968 14:104774270-104774292 GCCACCATCAGGCTGGGCCCCGG + Intronic
1122946264 14:105011608-105011630 GCCCCCACGCTGCACGGCACAGG + Exonic
1123034487 14:105466372-105466394 GCCCCTCCCCTGCTGGGCAGAGG + Intronic
1125464058 15:39933940-39933962 GCCCACATCCTGCTGGGGGAAGG - Intergenic
1128085641 15:64884423-64884445 GCCCACAGCCTGCTTGGCACTGG - Intronic
1128124960 15:65185390-65185412 ACCCCCAGCCTACTGGGCCCGGG + Intergenic
1128762531 15:70227167-70227189 ACCCCCACCCTGCTGCCCACAGG - Intergenic
1129249330 15:74299990-74300012 GCCATGATCCTTCTGGGCACTGG - Intronic
1130026864 15:80277619-80277641 GCCCTCCTTCTGCTGGACACTGG - Intergenic
1131159135 15:90092999-90093021 GCCCCCACCCTCTTGGCCACTGG - Intronic
1132157397 15:99505297-99505319 TCACGCAGCCTGCTGGGCACAGG + Intergenic
1132932159 16:2464313-2464335 GCCCCCATCCTCCTGGGTCCTGG - Intronic
1133002179 16:2857145-2857167 GACCCCTTCCCACTGGGCACTGG - Intronic
1133062086 16:3181688-3181710 GCCCCAGTCCTGGTGGGCGCTGG + Intergenic
1133063533 16:3190315-3190337 GCCCCAGTCCTGGTGGGCGCTGG - Intergenic
1133222812 16:4326432-4326454 GACCCCATGCTGCTGGGAGCGGG + Intronic
1134090115 16:11387048-11387070 GCCCCCTGCCTCCTGGGCACAGG - Intronic
1135691258 16:24539695-24539717 GCCCGCAAGCTGCTGGGCAGCGG - Intronic
1135760990 16:25137898-25137920 GCCCCCATCATGCTGTCCACAGG + Intronic
1136418327 16:30116866-30116888 GCCCCACTGCTGCTGGGGACTGG + Intronic
1136451819 16:30357980-30358002 GCCCCCATGATGGTGGGGACAGG - Exonic
1137459016 16:48640855-48640877 GCCCCCAGCCAGCTGAGCAGCGG - Intergenic
1137617696 16:49856939-49856961 GCTCCCGTCCTCCTGGGCAGCGG + Intronic
1137852256 16:51757254-51757276 AAACCCATCCTGCTGGGCCCTGG - Intergenic
1138416628 16:56875327-56875349 GCCCCCATCTTGCAGGGCGGTGG + Intronic
1141271773 16:82547481-82547503 GCCCCCATCATACTGGGGAGCGG + Intergenic
1141343944 16:83228263-83228285 CTCCACATCCTGCTGTGCACAGG + Intronic
1142143869 16:88484589-88484611 GCCCCCATCGTGCTTCACACAGG + Intronic
1143490973 17:7285044-7285066 GACCCCAGCCTTTTGGGCACGGG - Intronic
1143611611 17:8020963-8020985 ACATCCATCCTGCTGGGCAGTGG + Intergenic
1143904759 17:10199216-10199238 GCCACCAGGCTGCTGGGCTCAGG - Intergenic
1144181099 17:12753271-12753293 GCCCTCATCCTCCGGGGCCCAGG + Exonic
1144674242 17:17151850-17151872 GCCCCCATGGGGCTGGGCCCTGG + Intronic
1145274459 17:21421562-21421584 GCTGCCACCCTGCTGGGCACTGG + Intergenic
1145277265 17:21439490-21439512 GCCTCCAGCCTGCTGGTCTCAGG - Intergenic
1145312315 17:21707461-21707483 GCTGCCACCCTGCTGGCCACTGG + Intergenic
1145315101 17:21725384-21725406 GCCTCCAGCCTGCTGGTCTCAGG - Intergenic
1145713535 17:26997321-26997343 GCCTCCAGCCTGCTGGTCTCAGG - Intergenic
1147383776 17:40070429-40070451 GCCCCCATGCTGAGGGGCAGAGG - Intronic
1148071295 17:44910401-44910423 GCCCCTGTCCTGCTAGGCCCTGG - Exonic
1148108729 17:45132724-45132746 GCCCCCATGCTGCGGGGCTGGGG + Intronic
1148664011 17:49361654-49361676 GCCCCCTTCCTCCTGGACCCGGG - Intronic
1150629777 17:66871203-66871225 CAGCCCATCCTGCTGGACACTGG + Intronic
1151275883 17:73033989-73034011 GCTCCCATCCTGTTGAGCAGAGG - Intronic
1151557898 17:74855839-74855861 AGCCCCCTCCTCCTGGGCACTGG + Intronic
1151704267 17:75758410-75758432 GCCCCGCTCCTGCCGGGCACAGG - Intronic
1151705166 17:75763572-75763594 GCCACCAACCTGCTGGGCCAAGG + Intronic
1152033729 17:77859124-77859146 GCAGCCATGCTGCTGGCCACAGG + Intergenic
1152058651 17:78052066-78052088 GCCCTTGTCCTGCTGGACACAGG - Intronic
1152093549 17:78259451-78259473 GCGCCCATTGTGTTGGGCACTGG - Intergenic
1152186579 17:78860516-78860538 GCCTCCATTGTCCTGGGCACGGG + Intronic
1152200194 17:78940994-78941016 TCCTCAATCCTGCTGGCCACAGG - Intergenic
1152223458 17:79081846-79081868 GGCCCCATCCTTCTGGGCCTGGG + Intronic
1152236359 17:79141067-79141089 GCTGCCACCCTGCTGGGCCCTGG - Intronic
1152378193 17:79929406-79929428 GCTCCCAGCCTGCTGGGCCCTGG + Intergenic
1152526323 17:80890105-80890127 ACACACATCCTGCTGCGCACGGG - Intronic
1152878674 17:82803314-82803336 TCTCCCGTCCTGCTGGGCCCGGG + Intronic
1152898106 17:82925194-82925216 GCCCCCTTCCTCCTGGCCACAGG - Intronic
1153984548 18:10340816-10340838 GCCCCACTCCTGCTCTGCACAGG + Intergenic
1154302017 18:13202791-13202813 GCCTCCCTCCTGCCGGGCATGGG + Intergenic
1157572283 18:48721049-48721071 GCCCACTGCCTGGTGGGCACAGG - Intronic
1160027826 18:75233051-75233073 GCTCCCAGGCTGCTGGACACAGG - Intronic
1160055565 18:75476592-75476614 TCCTTCATCCTGCTGGGGACAGG + Intergenic
1160444116 18:78914051-78914073 GCCCCCCTCCTGCTGGTCCCTGG + Intergenic
1160790923 19:923394-923416 CCCCCAACCCTGCTGGTCACTGG - Intergenic
1161395840 19:4044480-4044502 CCCCCCAGCCTGCCGGGCCCAGG - Exonic
1161583000 19:5090908-5090930 GCCCCCACCGGGCTGTGCACAGG - Intronic
1161728384 19:5944101-5944123 GCTCCCAGCGTGCAGGGCACTGG - Intronic
1162070162 19:8148370-8148392 GTCCCTTCCCTGCTGGGCACAGG - Intronic
1162282358 19:9709442-9709464 CCTCCCATCCTGCTGTGCTCAGG + Intergenic
1162823508 19:13237242-13237264 GCCTTCACCCTGCTGGGTACTGG - Intronic
1163122688 19:15227513-15227535 GCCCACATCCTGCCAGGCATAGG - Exonic
1163147707 19:15392412-15392434 GCCTCCAACCTCCTGGGCTCAGG - Intronic
1163323804 19:16590186-16590208 GCCAGCACCCTGCAGGGCACTGG + Intronic
1163439765 19:17316189-17316211 GCCTCCAGCCTCCTGAGCACTGG - Intronic
1163758239 19:19119719-19119741 ACCCTCATGCTGCTGGGCCCAGG + Exonic
1165060804 19:33204429-33204451 GTCCCCATCCAGGTGTGCACGGG - Intronic
1165067996 19:33240242-33240264 GCGCCAATCCCGATGGGCACTGG + Intergenic
1165139349 19:33689592-33689614 GCCACCCTGCTGCTAGGCACTGG - Intronic
1165160392 19:33812522-33812544 GCCACCATCCTGCTGCCCTCAGG - Intronic
1167715401 19:51139805-51139827 GTCCAGATCCTGCTGGCCACGGG - Intergenic
1167765655 19:51480516-51480538 GGGCCCAGGCTGCTGGGCACTGG - Exonic
1168258125 19:55178329-55178351 GCCACCATCGTGCTGGTCTCAGG - Exonic
1168536001 19:57171834-57171856 GCCTGCAACCTGCTGGGCGCAGG + Intergenic
925182639 2:1827027-1827049 CTCCCCATCCTGCAGGGCTCTGG + Intronic
925197582 2:1939150-1939172 GCGCCCATCCTGCGTGGCACAGG - Intronic
925552216 2:5088762-5088784 GCCCCCGAGATGCTGGGCACAGG - Intergenic
925914852 2:8597650-8597672 GTCCCCATCCTGCTGTGCACTGG - Intergenic
928264500 2:29800267-29800289 GCCACCAGCATGCTGGGCAAAGG + Intronic
929863282 2:45697277-45697299 GCCCACATTCTGCTTGGCTCTGG + Intronic
929885052 2:45870976-45870998 GCCCCAAAACTTCTGGGCACAGG - Intronic
933256085 2:80082338-80082360 GCTCCCATTCTGCTAGGTACTGG - Intronic
933658426 2:84907277-84907299 CCACCCTTCCTGCTGAGCACTGG - Intergenic
936092863 2:109512194-109512216 GCCCTCCTCCTGCTGGGCCCTGG + Intergenic
937904518 2:127046357-127046379 GTTCCCATCCTGCTGGGGAGGGG - Intergenic
937952662 2:127400842-127400864 GCCCCTCTGCTGCTGGGAACCGG + Intergenic
944413853 2:199464629-199464651 GACCCCGGCCCGCTGGGCACCGG - Intronic
945266392 2:207895350-207895372 GCCTCCTGCCTGCTGGGGACAGG - Intronic
946339794 2:219059899-219059921 GCCGCCAACCTGCTGGGCTGTGG + Intronic
947432904 2:230046304-230046326 GCCCCGATCAGGCCGGGCACAGG - Exonic
948150421 2:235740147-235740169 GCCCTGCTCCTGCTGGGCAGCGG - Intronic
948240463 2:236429088-236429110 CCCCCCACCCTGCTGCCCACAGG - Intronic
948588706 2:239036397-239036419 TCCCCCAGCCCGCTGGGCCCAGG - Intergenic
1170268626 20:14499061-14499083 GCCCCTCCCCTGCTGAGCACAGG - Intronic
1170301112 20:14885615-14885637 GACCCCATCCTGCAGGGCCTTGG - Intronic
1171360400 20:24582862-24582884 TCGCCCCTCCTGCTGGGCACAGG - Intronic
1172230612 20:33333354-33333376 GCCTCCATCCTGCTGCTCCCAGG - Intergenic
1172697917 20:36835222-36835244 GCCCTCCTCATGCTGGGCAAAGG + Intronic
1172801968 20:37582161-37582183 TCCCACACCATGCTGGGCACAGG + Intergenic
1173149994 20:40558860-40558882 GGCCCATTCCTACTGGGCACTGG + Intergenic
1173158968 20:40638517-40638539 GCCCCCATTGTGCTGGACAGTGG + Intergenic
1173792225 20:45834965-45834987 GCCCCCCACCTGATGGGCAGTGG + Exonic
1175381389 20:58566701-58566723 GCCCCCATGCACCTGGGCATGGG + Intergenic
1175944614 20:62552826-62552848 GCCCCGAACCTGCTGGGAGCGGG - Intronic
1176019154 20:62953719-62953741 GCCCTCATACAGCTGGGAACTGG - Intronic
1176033345 20:63024426-63024448 GCCCCCACGCCGCTGGACACTGG + Intergenic
1176160929 20:63648250-63648272 TCCCCCGTCCTCCTGAGCACAGG - Intronic
1177124792 21:17182298-17182320 ACCACCATCCTGATGGCCACAGG + Intergenic
1178675993 21:34632122-34632144 GTCCCCATCCTCCTGAGCAGAGG - Intergenic
1179894090 21:44351704-44351726 GCACCCGTCCTGTTGGGCACTGG + Intronic
1180049497 21:45324819-45324841 GTCCACATCCTGCTGGCCAGAGG - Intergenic
1180244439 21:46537683-46537705 GCCCCCATATTCCTGGGCAGGGG - Intronic
1180674884 22:17580409-17580431 CCCCCCACCCTGCTGGGTATAGG - Intronic
1180832573 22:18913490-18913512 GCCTGCATCCTGCTGACCACCGG - Exonic
1180945110 22:19688463-19688485 GCCCCCAACCTGCTCAGCCCAGG + Intergenic
1180954395 22:19735190-19735212 GCCACAAGCCTGCTGTGCACAGG + Intergenic
1182308439 22:29387973-29387995 GCCCGCCTCCGGCTAGGCACTGG - Intronic
1183406222 22:37631911-37631933 GCCCCCACCCGGCTGGCCTCAGG - Intronic
1183414611 22:37675277-37675299 GAGCCCAGCCTGCTGGCCACAGG + Intergenic
1183415262 22:37678146-37678168 GCCCCACTTGTGCTGGGCACCGG + Intronic
1184072061 22:42152601-42152623 GGCCCTGTCCAGCTGGGCACAGG + Intergenic
1184079865 22:42211820-42211842 GCGCCCAGCCTCCTGGGCACTGG + Exonic
1184467303 22:44676550-44676572 CCCCCCATCCTGCTGGCCCAGGG - Intronic
1184500025 22:44865841-44865863 CGCCCCATCCTACGGGGCACTGG - Intergenic
1184581961 22:45423992-45424014 GAGCCCTTCCTGCTGGGCATTGG + Intronic
1185031461 22:48445570-48445592 GCCCTCTTCGTGCTCGGCACTGG - Intergenic
1185077412 22:48690789-48690811 GCCCACAGCCTCCTGGGCAGAGG - Intronic
1185199877 22:49494727-49494749 GCCCCCATCCACATGGGCAGGGG + Intronic
1185244292 22:49765121-49765143 GCCCCCACCCAGGTGGGGACAGG + Intergenic
1185402437 22:50625940-50625962 AGCCCCCTGCTGCTGGGCACAGG - Exonic
949767628 3:7544453-7544475 GCACCCAACCTGCAGGGCCCTGG + Intronic
950272145 3:11625880-11625902 TCCCCCGTCCTGCTGGTCCCTGG - Intronic
950475253 3:13210773-13210795 GTCCCCATCAGGGTGGGCACAGG - Intergenic
953874391 3:46657703-46657725 GCCCCCAACCTTTTTGGCACCGG - Intergenic
953982258 3:47418714-47418736 GGCCCATACCTGCTGGGCACTGG - Exonic
954110148 3:48429167-48429189 GCCCCGATCCCGCCGGGCAGGGG - Intronic
954292158 3:49655409-49655431 GCCCCCAACCTACCGGGCACAGG + Exonic
954629411 3:52039981-52040003 GCCCCCACCCAGCCGGGCCCGGG - Intergenic
954652715 3:52175215-52175237 GACCACACCCTGCTGGTCACCGG + Intergenic
954689823 3:52389715-52389737 ACCACCCTCTTGCTGGGCACAGG - Intronic
955330387 3:58042428-58042450 GCCCCCACCTTCCTGGGCTCAGG + Intronic
956304175 3:67805724-67805746 GCAGCCCTCCTACTGGGCACTGG + Intergenic
958949414 3:100400789-100400811 GCACCCCTGCTGCTGGGCGCGGG - Exonic
959644088 3:108677958-108677980 GCTCACCTCCTGCTGTGCACTGG - Intronic
960101870 3:113750823-113750845 GCCCCAAACCTGCTGCTCACAGG - Intronic
961446253 3:126983110-126983132 GCCCCATTCATGCTGGGCATCGG + Intergenic
961455750 3:127023093-127023115 GCCCCCACCCTCCTGAGCCCAGG - Intronic
962259231 3:133892579-133892601 GCCACCATTATGCTAGGCACAGG + Intronic
963744785 3:149115278-149115300 GCTCACCTCCTGCTGTGCACAGG - Intergenic
965321003 3:167251082-167251104 CACCCCATCCTGCTGGTCAGTGG - Intronic
968135658 3:196217804-196217826 GCCCCCATGGTTCTGAGCACAGG + Intronic
969354078 4:6614913-6614935 CCCCCCATCATGCTGTGCAGGGG - Intronic
970238743 4:13985714-13985736 GCCTTCATCCTGCTGGCCTCGGG + Intergenic
971282833 4:25255798-25255820 AGCCTCATCCTGCTGGGCTCAGG + Intronic
971282838 4:25255824-25255846 AGCCTCATCCTGCTGGGCTCAGG + Intronic
973936576 4:55852711-55852733 GACCCTTTCCTGCTTGGCACCGG - Intergenic
979635449 4:122950808-122950830 GCCACCATTGTGCTGGGCTCTGG + Intronic
980178463 4:129375497-129375519 GACCTCATCTTCCTGGGCACAGG - Intergenic
985471739 5:50959-50981 GTCTTCATCCCGCTGGGCACTGG + Intergenic
985542054 5:491900-491922 CCCCCCATCGTGCTGGACGCCGG - Exonic
985931839 5:3064529-3064551 TCCTCCAGCCTGCTGGGCGCAGG - Intergenic
986776226 5:11016548-11016570 GCCCCCATCCCCCAGGTCACCGG - Intronic
988934202 5:36066428-36066450 GCCCCCATCCCGCAGGGCTGGGG - Intronic
988954936 5:36305999-36306021 GACCCCATTCTTGTGGGCACTGG - Intergenic
990981901 5:61609221-61609243 GGGCCCATCCTCCTGGGCACCGG + Intergenic
991674016 5:69074840-69074862 GCCTCCCTGCTGCTGGGCTCTGG - Intergenic
992655597 5:78906780-78906802 TCCTCCATCCTGGTGAGCACGGG + Intronic
997208969 5:132066645-132066667 TCCCCCATCTTCCTGGGCCCAGG - Intergenic
997407225 5:133660462-133660484 GCTGCCCTCCTGCTGGCCACAGG + Intergenic
999199557 5:149806114-149806136 GCCCCCAGCCTACTGGGAAGGGG + Intronic
999389594 5:151180534-151180556 GCCACCAACCTTCAGGGCACTGG + Intergenic
999721203 5:154400476-154400498 GCACCCAACCTCCTGGGCTCTGG - Intronic
1000326945 5:160179422-160179444 CCCCCTCTCCTGCTGGGCATGGG - Intergenic
1001485346 5:172115843-172115865 GCCCCCAGCCTGCTGGTAGCAGG + Intronic
1001512911 5:172336377-172336399 GCCCCCAACGCTCTGGGCACAGG + Exonic
1001589084 5:172853300-172853322 GCCCCCATCGTGCTGGGTGCTGG + Intronic
1002278543 5:178118128-178118150 GCCCGCTCCATGCTGGGCACTGG + Intronic
1002376630 5:178793794-178793816 TCCCTCATCCTGCTGGGGCCAGG - Intergenic
1003136441 6:3438253-3438275 GGACCCATCCTGCTGGGGAAGGG + Intronic
1004746412 6:18513121-18513143 ACCCCTTTCCTCCTGGGCACAGG + Intergenic
1004932427 6:20475407-20475429 GCCCCCAGCCTGCTGACCAGTGG + Intronic
1005812390 6:29527709-29527731 GCTCACAGGCTGCTGGGCACAGG - Intergenic
1006268898 6:32949121-32949143 GCCCCCATGGTGCTGGATACAGG + Intronic
1006437000 6:34030922-34030944 GCCCCACTCCTGCTGTGTACAGG - Intronic
1007984015 6:46189387-46189409 GCCAACATCCTGCAGTGCACAGG - Intergenic
1015147715 6:130005987-130006009 GCTCACCTCCTGCTGGGCACCGG + Intergenic
1015226066 6:130858974-130858996 GCTCCTATCCTGCTGCTCACAGG - Intronic
1015549090 6:134393423-134393445 GCCCTCCTGCTGCTGGGCCCAGG - Intergenic
1015845243 6:137513441-137513463 GGCCCCGGCCTGCTGGGCTCAGG - Intergenic
1017245889 6:152223868-152223890 GCCCCCACTCTCCTGTGCACCGG - Intronic
1018905006 6:168070889-168070911 GTCCCCACCCTGCTGGGTTCAGG - Intronic
1018914294 6:168123363-168123385 TCCCCCATGCTGCTGTGCATTGG - Intergenic
1019312667 7:370248-370270 GCCTCCGTCCTGCAGGGCAAAGG + Intergenic
1019538139 7:1539338-1539360 GCCCCCCTCCTCCTGGCAACAGG - Intronic
1019603998 7:1899410-1899432 GACCCTATCCTGCAGGCCACGGG + Intronic
1019719386 7:2559176-2559198 GCCACCATGTTCCTGGGCACCGG + Exonic
1020070449 7:5223699-5223721 TCCTCCTGCCTGCTGGGCACTGG + Intronic
1024142926 7:46480499-46480521 GCCTCCTTACTGCTGGGCAGGGG + Intergenic
1026970163 7:74462883-74462905 GCCGCCATCCAGGTGGGCTCTGG + Intronic
1026970430 7:74464527-74464549 GCCCCCCTCCTCCTGGGTTCAGG + Intronic
1029367809 7:100127627-100127649 GGCCCCATCCTGGTGGACACCGG + Exonic
1029765980 7:102626609-102626631 GCTCCTGTCCTGCTGGGCCCAGG + Intronic
1031302978 7:120086679-120086701 GCCCCCACCCTGCCCGGCCCCGG - Intergenic
1032328003 7:130950399-130950421 GCCCCCATCAATCTGGGTACAGG + Intergenic
1032750996 7:134841619-134841641 ACCTCCATCCCTCTGGGCACTGG + Intronic
1033607687 7:142939561-142939583 GCACGGATCCTGCTGGGCACTGG + Exonic
1034285265 7:149879749-149879771 GCCACCATCCTGCTGGGAACTGG + Exonic
1034843525 7:154421855-154421877 GCCTACAACATGCTGGGCACTGG - Intronic
1035169476 7:157009734-157009756 GACCCCATCAAGCTGGGCGCCGG - Exonic
1035375018 7:158402040-158402062 TCCCTGACCCTGCTGGGCACCGG - Intronic
1035751353 8:1998919-1998941 GCCCCCATCCTGCTGTCCAGTGG - Intronic
1036756201 8:11472866-11472888 GACTCTATCCTGCTGGGCAGAGG + Intronic
1039621159 8:38997505-38997527 GCGCCCAGCCTGCAGGGCTCCGG - Intronic
1040846373 8:51846248-51846270 GGCCACATTCTGCTAGGCACTGG - Intronic
1047338475 8:123957852-123957874 GCATCCATCCTGCTGTCCACAGG + Intronic
1048131806 8:131705974-131705996 GCCCCCATCGTGCTGGGCTAGGG - Intergenic
1048374952 8:133815163-133815185 CCTCTCATCCTGCTTGGCACTGG - Intergenic
1048384525 8:133899215-133899237 GACCCTATCCTTCAGGGCACTGG + Intergenic
1048985659 8:139733455-139733477 GGGCCCTTCCTGCTGGGCAAAGG + Intronic
1049196257 8:141317326-141317348 GCCCCATTCATGCTGGGCACTGG + Intergenic
1049482154 8:142830994-142831016 GGCCCCATTCTGCTGGGGATGGG - Intergenic
1049584902 8:143428597-143428619 GCCCCCACCCGACTGAGCACAGG + Exonic
1049671731 8:143873041-143873063 GCCTCCTGCCTGCTGGGCTCGGG - Exonic
1049738408 8:144222212-144222234 ACCCCCAGCCTCCTGGGCACTGG - Intronic
1052992112 9:34524526-34524548 GCCCTCACCCTGCTGGGTAATGG - Intergenic
1054915787 9:70494181-70494203 GCCCTGATCCTGGTGGGGACAGG + Intergenic
1057180507 9:93027183-93027205 GCACCTGTCCTGCTTGGCACAGG - Intronic
1057279950 9:93702036-93702058 GGCCCCATCCAGCGGGGCCCTGG - Intergenic
1057355036 9:94325522-94325544 GCCCCCAACCACCTGGGCAGAGG + Exonic
1057652715 9:96932112-96932134 GCCCCCAACCACCTGGGCAGAGG - Exonic
1058712567 9:107693616-107693638 TCTCCCATCCTTATGGGCACTGG - Intergenic
1059321644 9:113475056-113475078 ACCCAAATTCTGCTGGGCACAGG - Intronic
1060449705 9:123725635-123725657 GCCCTCCTGCTGCTGGGCAGAGG - Intronic
1060552708 9:124493037-124493059 GGCAGCATCCTGCTGGTCACCGG - Exonic
1060679581 9:125549827-125549849 CTCCCCTTCCAGCTGGGCACAGG + Intronic
1060892855 9:127199478-127199500 ACCCCCACCCTGCTAGGCACTGG + Intronic
1061061102 9:128250846-128250868 GCCCCCGGCCTGGAGGGCACGGG - Exonic
1061893690 9:133636010-133636032 GACCCCATCCCACTGGGGACTGG + Intergenic
1061901968 9:133677681-133677703 GTCCCCTTCCTGCTTGGCCCTGG + Intronic
1062126844 9:134868567-134868589 GCCCCCATCCTCATGGGAAGAGG + Intergenic
1062261329 9:135664634-135664656 GCACCCCTCCTCCAGGGCACAGG - Intronic
1062376709 9:136265086-136265108 GCCCCCATGCTGTGGGGCAGAGG - Intergenic
1062385105 9:136306182-136306204 GCTCCCGTGCTGCTGGGGACAGG - Intronic
1062463080 9:136669969-136669991 CCCGCCATCCTGCAGGGCAGCGG - Exonic
1062614799 9:137391461-137391483 CTCCCCATCTTGCTGGGCTCCGG - Intronic
1203778375 EBV:86736-86758 GCCCCAACCCTGTTAGGCACGGG - Intergenic
1185750792 X:2608787-2608809 GCCCCCTTCCAGCTGCTCACGGG - Intergenic
1186491727 X:9979173-9979195 GCCTCAATCAGGCTGGGCACCGG + Intergenic
1188833812 X:34932367-34932389 GCCCCCATCCTGACTGGCAGTGG + Intergenic
1197296666 X:124727547-124727569 GCCCCCTTGCTGCAGAGCACTGG - Intronic
1198511376 X:137355032-137355054 GGCCCTTTCCAGCTGGGCACTGG + Intergenic
1199715229 X:150503339-150503361 GCCCCCGTCCTGCCAGGCCCTGG + Intronic
1200211698 X:154349471-154349493 GGCCCCATGCTGGGGGGCACAGG + Exonic