ID: 1084266190

View in Genome Browser
Species Human (GRCh38)
Location 11:68006550-68006572
Sequence GTGGTGTGAAGGGAATCACG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084266190_1084266199 28 Left 1084266190 11:68006550-68006572 CCACGTGATTCCCTTCACACCAC No data
Right 1084266199 11:68006601-68006623 ATTTTAAACATTAAAGCCAATGG No data
1084266190_1084266201 30 Left 1084266190 11:68006550-68006572 CCACGTGATTCCCTTCACACCAC No data
Right 1084266201 11:68006603-68006625 TTTAAACATTAAAGCCAATGGGG No data
1084266190_1084266200 29 Left 1084266190 11:68006550-68006572 CCACGTGATTCCCTTCACACCAC No data
Right 1084266200 11:68006602-68006624 TTTTAAACATTAAAGCCAATGGG No data
1084266190_1084266194 -10 Left 1084266190 11:68006550-68006572 CCACGTGATTCCCTTCACACCAC No data
Right 1084266194 11:68006563-68006585 TTCACACCACTTCCCTGGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084266190 Original CRISPR GTGGTGTGAAGGGAATCACG TGG (reversed) Intergenic
No off target data available for this crispr